Satellite database app by ALGGEN

Id Genbank id Name Type Indice Satlength Numrep Replength Seed Seq
143343 NZ_CP035632.1 Synechococcus-sp Bacteria 1379463-1389651 10189 479 18 GAGTCGCTGT GAGTCGCTGTCGGAATCCGAGTCACTGTCTGAGTCGGAGTCACTGTCGGAATCCGAGTCGCTGTCGGAGTCCGAGTCGCTATCCGAGTCGGAGTCGCTGTCCGAATCCGAGTCGCTATCTGAGTCGGAGTCGCTGTCGGAATCCGAGTCACTGTCTGAGTCGGAGTCACTGTCGGAATCCGAGTCGCTGTCGGAGTCCGAGTCGCTATCGGAGTCCGAATCGCTGTCCGAGTCGGAGTCACTGTCTGAGTCCGAGTCGCTATCGGAGTCCGAATCGCTGTCCGAGTCGGAGTCACTGTCTGAGTCCGAGTCGCTATCGGAGTCCGAGTCACTGTCGGAGTCCGAGTCGCTGTCCGAGTCGGAGTCACTGTCTGAGTCCGAGTCACTGTCGGAATCCGAATCGCTGTCGGAATCCGAGTCGCTATCGGAGTCGGAGTCACTGTCGGAATCCGAGTCGCTATCGGAGTCCGAGTCGCTATCGGAATCGGAGTCGCTGTCGGAGTCGGAGTCGCTGTCCGAGTCGGAGTCACTGTCTGAGTCCGAGTCGCTATCGGAGTCCGAATCGCTGTCCGAGTCGGAGTCACTGTCTGAGTCCGAGTCGCTATCGGAGTCCGAATCGCTGTCCGAGTCGGAGTCGCTGTCGGAGTCCGAGTCGCTGTCGGAGTCCGAATCGCTGTCTGAATCCGAGTCGCTGTCGGAATCCGAATCGCTGTCTGAATCCGAGTCGCTGTCGGAATCGGAGTCACTGTCTGAGTCCGAGTCGCTGTCTGAATCCGAATCGCTGTCGGAATCCGAATCGCTGTCTGAGTCCGAGTCGCTGTCCGAATCGGAATCGCTGTCCGAATCCGAGTCACTGTCCGAGTCGGAGTCGCTGTCGGAATCCGAGTCGCTGTCGGAATCCGAGTCGCTATCGGAGTCGGAGTCGCTATCGGAGTCGGAGTCGCTGTCGGAGTCCGAGTCGCTATCGGAATCGGAGTCGCTGTCGGAGTCGGAGTCACTGTCCGAATCGGAATCGCTGTCCGAATCCGAGTCGCTGTCCGCGTCGGAGTCACTGTCGGAATCCGAATCGCTGTCGGAGTCCGAGTCACTGTCCGAATCCGAGTCGCTGTCCGCGTCGGAGTCACTGTCGGAATCCGAATCGCTGTCGGAGTCCGAGTCACTGTCCGAATCCGAGTCGCTGTCCGAATCCGAGTCGCTGTCCGAATCCGAGTCGCTATCGGAGTCGGAGTCGCTGTCCGAGTCCGAATCGCTGTCGGAATCCGAGTCGCTATCGGAGTCGGAGTCGCTGTCCGAGTCGGAGTCGCTATCGGAGTCCGAGTCGCTATCGGAGTCGGAGTCGCTATCGGAGTCCGAGTCGCTATCGGAGTCGGAGTCACTGTCGGAGTCCGAATCGCTGTCTGAATCCGAGTCGCTGTCTGAATCGGAGTCGCTATCGGAATCGGAGTCGCTATCGGAGTCGGAGTCACTGTCGGAGTCCGAATCGCTGTCTGAATCCGAGTCGCTGTCTGAATCGGAGTCGCTATCGGAATCGGAGTCGCTGTCGGAGTCGGAGTCACTGTCCGAATCGGAATCGCTGTCCGAATCCGAGTCACTGTCCGAGTCGGAGTCGCTGTCGGAGTCCGAGTCGCTGTCCGAATCCGAGTCGCTGTCGGAATCCGAGTCACTGTCTGAGTCGGAATCGCTGTCGGAATCCGAGTCGCTGTCGGAATCCGAGTCACTGTCGGAGTCCGAATCGCTGTCGGAGTCCGAATCGCTGTCGGAGTCCGAATCGCTGTCGGAATCCGAGTCACTGTCTGAGTCGGAATCGCTGTCGGAATCCGAGTCGCTGTCGGAATCCGAGTCACTGTCGGAGTCCGAATCGCTGTCTGAATCCGAGTCGCTGTCTGAATCGGAGTCGCTGTCGGAGTCCGAGTCACTGTCGGAATCCGAGTCACTGTCGGAGTCCGAATCGCTGTCGGAGTCCGAATCGCTGTCGGAGTCCGAATCGCTGTCTGAATCCGAGTCGCTGTCGGAGTCCGAATCGCTGTCGGAATCCGAATCGCTGTCGGAGTCCGAGTCGCTGTCCGAGTCGGAGTCACTGTCCGAGTCGGAGTCACTGTCGGAGTCCGAGTCACTGTCGGAATCCGAATCGCTGTCGGAGTCCGAGTCACTGTCCGAGTCGGAGTCGCTGTCGGAGTCCGAATCGCTGTCGGAATCCGAGTCGCTGTCTGAATCGGAGTCGCTGTCTGAATCGGAGTCGCTGTCGGAGTCCGAATCGCTGTCGGAGTCCGAATCGCTGTCGGAGTCCGAGTCGCTGTCCGAGTCGGAGTCGCTGTCGGAATCCGAGTCGCTATCCGAGTCGGAGTCACTGTCGGAGTCCGAGTCACTGTCTGAGTCGGAGTCGCTGTCGGAATCCGAATCGCTGTCGGAGTCCGAATCGCTGTCGGAGTCCGAGTCGCTGTCGGAATCGGAGTCACTGTCGGAGTCCGAGTCACTGTCGGAGTCCGAATCGCTGTCGGAATCCGAATCGCTGTCCGAGTCGGAGTCGCTGTCCGAGTCGGAGTCGCTGTCTGAGTCCGAATCGCTGTCGGAATCCGAGTCGCTGTCCGAGTCGGAGTCACTGTCCGAGTCGGAGTCACTGTCGGAGTCCGAGTCACTGTCGGAATCCGAATCGCTGTCGGAGTCCGAGTCACTGTCCGAGTCGGAGTCGCTGTCGGAGTCCGAATCGCTGTCGGAATCCGAGTCGCTGTCTGAATCGGAGTCGCTGTCTGAATCGGAGTCGCTGTCGGAGTCCGAATCGCTGTCGGAGTCCGAATCGCTGTCGGAGTCCGAGTCGCTGTCCGAGTCGGAGTCGCTGTCGGAATCCGAGTCGCTATCCGAGTCGGAGTCACTGTCGGAGTCCGAGTCACTGTCTGAGTCGGAGTCGCTGTCGGAATCCGAATCGCTGTCGGAGTCCGAGTCGCTGTCCGAGTCGGAGTCACTGTCCGAGTCGGAGTCACTGTCGGAGTCCGAGTCACTGTCGGAATCCGAATCGCTGTCGGAGTCCGAGTCACTGTCCGAGTCGGAGTCGCTGTCGGAGTCCGAATCGCTGTCGGAATCCGAGTCGCTGTCTGAATCGGAGTCGCTGTCTGAATCGGAGTCGCTGTCGGAGTCCGAATCGCTGTCGGAGTCCGAATCGCTGTCGGAGTCCGAGTCGCTGTCCGAGTCGGAGTCGCTGTCGGAATCCGAGTCGCTATCCGAGTCGGAGTCACTGTCGGAGTCCGAGTCACTGTCTGAGTCGGAGTCGCTGTCGGAATCCGAATCGCTGTCGGAGTCCGAATCGCTGTCTGAGTCCGAATCGCTGTCGGAATCCGAATCGCTGTCGGAGTCCGAGTCGCTGTCCGAGTCGGAGTCACTGTCCGAGTCGGAGTCACTGTCGGAGTCCGAGTCACTGTCGGAATCCGAATCGCTGTCGGAGTCCGAGTCACTGTCCGAGTCGGAGTCGCTGTCGGAGTCCGAATCGCTGTCGGAATCCGAGTCGCTGTCTGAATCGGAGTCGCTGTCTGAATCGGAGTCGCTGTCGGAGTCCGAATCGCTGTCGGAGTCCGAGTCGCTGTCCGAGTCGGAGTCGCTGTCGGAATCCGAGTCGCTGTCGGAGTCCGAGTCGCTGTCGGAATCGGAGTCGCTGTCGGAATCCGAGTCGCTGTCCGAGTCGGAGTCACTGTCGGAGTCCGAATCGCTGTCGGAATCGGAGTCGCTGTCCGAGTCGGAGTCGCTGTCTGAGTCCGAGTCGCTGTCGGAATCCGAGTCGCTGTCTGAGTCGGAATCGCTGTCGGAATCCGAGTCGCTATCCGAGTCGGAGTCGCTGTCTGAATCCGAGTCGCTGTCTGAGTCCGAGTCGCTGTCCGAATCCGAGTCGCTGTCGGAGTCCGAGTCACTGTCCGAATCCGAGTCGCTGTCGGAGTCCGAGTCGCTGTCGGAGTCCGAGTCGCTGTCCGAATCCGAGTCGCTGTCGGAGTCCGAGTCGCTGTCGGAATCCGAGTCACTGTCTGAGTCGGAATCGCTGTCGGAATCCGAGTCGCTATCCGAGTCGGAGTCACTGTCGGAGTCCGAATCGCTGTCTGAGTCGGAGTCGCTGTCGGAATCCGAATCGCTGTCGGAGTCCGAGTCGCTGTCCGAGTCGGAGTCACTGTCCGAGTCGGAGTCACTGTCGGAGTCCGAGTCACTGTCGGAATCCGAATCGCTGTCGGAGTCCGAGTCACTGTCCGAGTCGGAGTCGCTGTCGGAGTCCGAATCGCTGTCGGAATCCGAGTCGCTGTCTGAATCGGAGTCGCTGTCGGAATCCGAGTCACTGTCGGAGTCCGAGTCGCTGTCCGAGTCGGAGTCGCTGTCGGAGTCCGAATCGCTGTCGGAATCCGAGTCGCTGTCTGAATCGGAGTCGCTGTCGGAATCCGAGTCGCTGTCGGAGTCCGAGTCACTGTCGGAGTCGGAATCGCTGTCGGAATCCGAGTCGCTGTCGGAATCGGAGTCGCTGTCGGAGTCCGAGTCACTGTCGGAATCGGAGTCGCTGTCGGAGTCCGAATCGCTGTCGGAATCCGAGTCGCTGTCGGAATCCGAGTCACTGTCGGAGTCCGAGTCGCTGTCCGAGTCGGAGTCGCTGTCGGAATCCGAGTCGCTGTCGGAGTCCGAGTCGCTGTCGGAATCCGAGTCGCTGTCGGAGTCGGAGTCACTGTCCGAATCGGAATCGCTGTCCGAATCCGAGTCACTGTCCGAGTCGGAGTCGCTGTCGGAGTCCGAGTCGCTGTCCGAATCCGAGTCGCTGTCGGAATCCGAGTCACTGTCTGAGTCGGAATCGCTGTCGGAGTCCGAGTCGCTGTCCGAGTCGGAGTCACTGTCCGAGTCGGAGTCACTGTCCGAGTCGGAGTCACTGTCGGAGTCGGAATCGCTGTCCGAATCCGAGTCGCTGTCGGAGTCCGAGTCGCTGTCGGAGTCCGAGTCGCTGTCGGAATCCGAGTCACTGTCTGAGTCGGAATCGCTGTCGGAATCCGAGTCGCTATCCGAGTCGGAGTCACTGTCGGAGTCCGAGTCGCTGTCTGAGTCGGAGTCGCTGTCGGAATCCGAATCGCTGTCGGAGTCCGAGTCGCTGTCCGAGTCGGAGTCACTGTCCGAGTCGGAGTCGCTGTCTGAATCCGAGTCGCTATCCGAGTCGGAGTCACTGTCGGAGTCCGAGTCGCTGTCTGAATCCGAGTCGCTATCCGAGTCGGAGTCACTGTCGGAGTCCGAGTCGCTGTCCGAATCGGAGTCGCTATCCGAGTCGGAGTCACTGTCGGAGTCCGAATCGCTGTCGGAATCGGAGTCGCTGTCCGAATCGGAATCGCTGTCCGAATCCGAGTCGCTGTCGGAATCGGAGTCGCTGTCGGAATCCGAGTCACTGTCTGAGTCCGAGTCGCTGTCGGAATCGGAGTCGCTGTCCGAATCCGAGTCGCTGTCTGAATCGGAGTCGCTGTCGGAATCGGAGTCGCTGTCGGAATCCGAGTCGCTGTCGGAATCGGAGTCGCTGTCCGAATCCGAGTCGCTGTCTGAATCGGAGTCGCTGTCGGAATCCGAGTCACTGTCGGAATCGGAGTCACTGTCGGAATCGGAATCGCTGTCTGAGTCGGAGTCGCTGTCGGAATCCGAATCGCTGTCGGAGTCCGAGTCGCTGTCCGCGTCGGAGTCACTGTCCGAGTCGGAGTCGCTGTCGGAATCGGAGTCGCTGTCCGAGTCGGAGTCACTGTCGGAATCCGAGTCGCTATCCGAGTCGGAGTCGCTGTCTGAATCCGAGTCGCTGTCGGAATCCGAGTCGCTGTCCGAGTCGGAATCGCTGTCTGAGTCGGAGTCGCTGTCGGAATCCGAATCGCTGTCGGAGTCCGAGTCGCTGTCTGAGTCGGAATCGCTGTCGGAATCCGAGTCGCTATCCGAGTCGGAGTCGCTGTCTGAATCCGAGTCGCTGTCGGAGTCCGAATCGCTGTCGGAGTCCGAGTCGCTGTCGGAATCGGAGTCGCTGTCGGAATCCGAGTCGCTATCCGAGTCGGAGTCACTGTCGGAGTCCGAGTCACTGTCTGAGTCGGAGTCACTGTCGGAGTCCGAGTCACTGTCTGAGTCGGAGTCGCTGTCGGAATCCGAATCGCTGTCGGAGTCCGAATCGCTGTCTGAGTCCGAATCGCTGTCGGAATCCGAGTCGCTGTCTGAATCGGAGTCGCTGTCGGAGTCCGAGTCACTGTCGGAATCCGAATCGCTGTCGGAGTCCGAGTCACTGTCCGAGTCGGAGTCGCTGTCGGAATCCGAGTCGCTATCCGAGTCGGAGTCGCTGTCTGAATCCGAGTCGCTGTCGGAGTCCGAATCGCTGTCGGAGTCCGAGTCGCTGTCGGAATCGGAGTCGCTGTCGGAATCCGAGTCGCTATCCGAGTCGGAGTCACTGTCGGAGTCCGAGTCACTGTCTGAGTCGGAGTCACTGTCGGAGTCCGAGTCACTGTCTGAGTCGGAGTCGCTGTCGGAATCCGAATCGCTGTCGGAGTCCGAATCGCTGTCTGAGTCCGAATCGCTGTCTGAATCCGAGTCGCTGTCTGAATCGGAGTCGCTGTCTGAATCGGAGTCGCTGTCGGAGTCCGAGTCACTGTCGGAATCCGAATCGCTGTCGGAGTCCGAGTCACTGTCCGAGTCGGAGTCGCTGTCGGAGTCCGAATCGCTGTCGGAATCCGAGTCGCTGTCGGAATCGGAGTCGCTGTCGGAGTCCGAGTCGCTGTCCGAGTCGGAGTCGCTGTCGGAATCCGAGTCGCTGTCGGAATCGGAGTCGCTGTCCGAGTCGGAGTCGCTGTCGGAATCCGAGTCGCTGTCCGAATCGGAATCGCTGTCTGAATCGGAGTCGCTGTCCGAATCGGAGTCGCTATCCGAGTCGGAGTCACTGTCGGAGTCCGAATCGCTGTCTGAGTCGGAGTCACTGTCGGAGTCC
33566 NZ_AP018936.1 Streptococcus-pneumoniae-NU83127-DNA Bacteria 1676260-1694836 18577 464 24 GCTGAAGCCG GCTGAGGCCGAAGCACTCGTTGATGCTGAAGCTGAGGCACTGGTGCTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCCGACGCACTGGTGCTTGCTGAAGCTGACGCACTTGTTGATGCGGAAGCCGAAGCACTCGTTGAGGCTGAAGCTGACGCACTGGTACTTGCTGAAGCCGAGGCGCTTGTGCTTGCTGAAGCTGAGGCGCTTATGCTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCTGAAGCACTCGTTGATGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTGCTTGCTGAAGCTGACGCACTTGTTGATGCGGAAGCCGAAGCACTCGTTGAGGCTGAAGCTGACGCACTTGTACTTGCTGAGGCCGACGCACTGGTACTTGCGGAAGCCGACGCACTCGTTGATGCTGAAGCCGACGCACTGGTGCTTGCTGAGGCCGAAGCACTGGTACTTGCTGAAGCTGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTACTTGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGAAGCACTGGTGCTTGCTGAAGCTGACGCACTTGTTGATGCGGAAGCCGAAGCACTCGTTGAGGCTGAAGCTGACGCACTGGTACTTGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTGCTTGCTGAGGCCGAAGCACTGGTACTTGCTGAAGCTGAGGCGCTTGTGCTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCCGAGGCACTCGTTGATGCTGAAGCCGAGGCGCTTGTCGATGCTGAGGCCGACGCACTGGTACTTGCTGAAGCTGAGGCGCTTGTGCTTGCTGAAGCCGACGCACTGGTACTTGCTGAAGCTGAGGCGCTTGTGCTTGCTGAAGCCGAAGCACTGGTACTTGCGGAAGCCGACGCACTCGTTGATGCTGAAGCTGAGGCACTGGTACTTGCTGAGGCCGAAGCACTGGTACTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTGCTTGCTGAGGCCGAAGCACTGGTACTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCCGACGCACTCGTTGATGCTGAAGCTGAAGCACTCGTTGATGCTGAAGCCGAGGCACTCGTTGATGCTGAAGCCGAGGCACTGGTTGATGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTGCTTGCTGAAGCTGACGCACTTGTTGATGCGGAAGCCGAAGCACTCGTTGAGGCTGAAGCTGACGCACTTGTACTTGCTGAGGCCGAAGCACTTGTACTTGCTGAAGCCGACGCACTCGTTGATGCGGAAGCCGAAGCACTGGTACTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTGCTTGCTGAGGCCGAAGCACTGGTACTTGCTGAAGCTGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTACTTGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGAAGCACTGGTGCTTGCTGAAGCTGACGCACTTGTTGATGCGGAAGCCGAAGCACTCGTTGAGGCTGAAGCTGACGCACTGGTACTTGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTGCTTGCTGAGGCCGAAGCACTGGTACTTGCTGAAGCTGAGGCGCTTGTGCTTGCTGAAGCCGAAGCACTCGTTGATGCTGAAGCCGAGGCACTCGTTGATGCTGAAGCCGACGCACTGGTACTTGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGAAGCACTGGTGCTTGCTGAAGCTGACGCACTTGTTGATGCGGAAGCCGAAGCACTCGTTGAGGCTGAAGCTGACGCACTGGTACTTGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTGCTTGCTGAGGCCGAAGCACTGGTACTTGCTGAAGCTGAGGCGCTTGTGCTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCCGAGGCGCTTGTCGATGCTGAGGCCGACGCACTGGTACTTGCTGAAGCTGAGGCGCTTGTGCTTGCTGAAGCCGACGCACTGGTACTTGCTGAAGCTGAGGCGCTTGTGCTTGCTGAAGCCGAAGCACTGGTACTTGCGGAAGCCGACGCACTCGTTGATGCTGAAGCTGAGGCACTGGTACTTGCTGAGGCCGAAGCACTGGTACTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTGCTTGCTGAGGCCGAAGCACTGGTACTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCCGACGCACTCGTTGATGCTGAAGCTGAAGCACTCGTTGATGCTGAAGCCGAGGCACTCGTTGATGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTGCTTGCTGAAGCTGACGCACTTGTTGATGCGGAAGCCGAAGCACTCGTTGAGGCTGAAGCTGACGCACTTGTACTTGCTGAGGCCGAAGCACTTGTACTTGCTGAAGCTGAGGCGCTTGTGCTTGCTGAAGCCGACGCACTCGTTGATGCGGAAGCCGAAGCACTGGTACTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCCGACGCACTCGTTGATGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTGCTTGCTGAGGCCGAAGCACTGGTACTTGCTGAAGCTGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTACTTGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGAAGCACTGGTGCTTGCTGAAGCTGACGCACTTGTTGATGCGGAAGCCGAAGCACTCGTTGAGGCTGAAGCTGACGCACTGGTACTTGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTGCTTGCTGAGGCCGAAGCACTGGTACTTGCTGAAGCTGAGGCGCTTGTGCTTGCTGAAGCCGAAGCACTCGTTGATGCTGAAGCCGAGGCACTCGTTGATGCTGAAGCCGACGCACTGGTACTTGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGAAGCACTGGTGCTTGCTGAAGCTGACGCACTTGTTGATGCGGAAGCCGAAGCACTCGTTGAGGCTGAAGCTGACGCACTGGTACTTGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTGCTTGCTGAGGCCGAAGCACTGGTACTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCCGACGCACTCGTTGATGCTGAAGCTGAAGCACTCGTTGATGCTGAAGCCGAGGCACTCGTTGATGCTGAAGCCGAGGCACTGGTTGATGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTGCTTGCTGAAGCTGACGCACTTGTTGATGCGGAAGCCGAAGCACTCGTTGAGGCTGAAGCTGACGCACTTGTACTTGCTGAGGCCGAAGCACTTGTACTTGCTGAAGCCGACGCACTCGTTGATGCGGAAGCCGAAGCACTGGTACTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTGCTTGCTGAGGCCGAAGCACTGGTACTTGCTGAAGCTGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTACTTGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGAAGCACTGGTGCTTGCTGAAGCTGACGCACTTGTTGATGCGGAAGCCGAAGCACTCGTTGAGGCTGAAGCTGACGCACTGGTACTTGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTGCTTGCTGAGGCCGAAGCACTGGTACTTGCTGAAGCTGAGGCGCTTGTGCTTGCTGAAGCCGAAGCACTCGTTGATGCTGAAGCCGAGGCACTCGTTGATGCTGAAGCCGACGCACTGGTACTTGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGAAGCACTGGTGCTTGCTGAAGCTGACGCACTTGTTGATGCGGAAGCCGAAGCACTCGTTGAGGCTGAAGCTGACGCACTGGTACTTGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTGCTTGCTGAGGCCGAAGCACTGGTACTTGCTGAAGCTGAGGCGCTTGTGCTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCCGAGGCGCTTGTCGATGCTGAGGCCGACGCACTGGTACTTGCTGAAGCTGAGGCGCTTGTGCTTGCTGAAGCCGACGCACTGGTACTTGCTGAAGCTGAGGCGCTTGTGCTTGCTGAAGCCGAAGCACTGGTACTTGCGGAAGCCGACGCACTCGTTGATGCTGAAGCTGAGGCACTGGTACTTGCTGAGGCCGAAGCACTGGTACTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTGCTTGCTGAGGCCGAAGCACTGGTACTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCCGACGCACTCGTTGATGCTGAAGCTGAAGCACTCGTTGATGCTGAAGCCGAGGCACTCGTTGATGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTGCTTGCTGAAGCTGACGCACTTGTTGATGCGGAAGCCGAAGCACTCGTTGAGGCTGAAGCTGACGCACTTGTACTTGCTGAGGCCGAAGCACTTGTACTTGCTGAAGCTGAGGCGCTTGTGCTTGCTGAAGCCGACGCACTCGTTGATGCGGAAGCCGAAGCACTGGTACTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCCGACGCACTCGTTGATGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTGCTTGCTGAGGCCGAAGCACTGGTACTTGCTGAAGCTGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTACTTGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGAAGCACTGGTGCTTGCTGAAGCTGACGCACTTGTTGATGCGGAAGCCGAAGCACTCGTTGAGGCTGAAGCTGACGCACTGGTACTTGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTGCTTGCTGAGGCCGAAGCACTGGTACTTGCTGAAGCTGAGGCGCTTGTGCTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCCGAGGCACTCGTTGATGCTGAAGCCGAGGCGCTTGTCGATGCTGAGGCCGACGCACTGGTACTTGCTGAAGCTGAGGCGCTTGTGCTTGCTGAAGCCGACGCACTGGTACTTGCTGAAGCTGAGGCGCTTGTGCTTGCTGAAGCCGAAGCACTGGTACTTGCGGAAGCCGACGCACTCGTTGATGCTGAAGCTGAGGCACTGGTACTTGCTGAGGCCGAAGCACTGGTACTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCCGACGCACTGGTGCTTGCTGAGGCCGAAGCACTGGTACTTGCTGAAGCTGAGGCGCTTGTGCTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCCGAGGCACTCGTTGATGCTGAAGCCGAGGCGCTTGTCGATGCTGAGGCCGACGCACTGGTACTTGCTGAAGCTGAGGCGCTTGTGCTTGCTGAAGCCGACGCACTGGTACTTGCTGAAGCTGAGGCGCTTGTGCTTGCTGAAGCCGAAGCACTGGTACTTGCGGAAGCCGACGCACTCGTTGATGCTGAAGCTGAGGCACTGGTACTTGCTGAGGCCGAAGCACTGGTACTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTGCTTGCTGAGGCCGAAGCACTGGTACTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCCGACGCACTCGTTGATGCTGAAGCTGAAGCACTCGTTGATGCTGAAGCCGAGGCACTCGTTGATGCTGAAGCCGAGGCACTGGTTGATGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTGCTTGCTGAAGCTGACGCACTTGTTGATGCGGAAGCCGAAGCACTCGTTGAGGCTGAAGCTGACGCACTTGTACTTGCTGAGGCCGAAGCACTTGTACTTGCTGAAGCTGAGGCGCTTGTGCTTGCTGAAGCCGAAGCACTCGTTGATGCGGAAGCCGAAGCACTGGTACTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTGCTTGCTGAGGCCGAAGCACTGGTACTTGCTGAAGCTGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTACTTGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGAAGCACTGGTGCTTGCTGAAGCTGACGCACTTGTTGATGCGGAAGCCGAAGCACTCGTTGAGGCTGAAGCTGACGCACTGGTACTTGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTGCTTGCTGAGGCCGAAGCACTGGTACTTGCTGAAGCTGAGGCGCTTGTGCTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCCGAGGCACTCGTTGATGCTGAAGCCGAGGCGCTTGTCGATGCTGAGGCCGACGCACTGGTACTTGCTGAAGCTGAGGCGCTTGTGCTTGCTGAAGCCGACGCACTGGTACTTGCTGAAGCTGAGGCGCTTGTGCTTGCTGAAGCCGAAGCACTGGTACTTGCGGAAGCCGACGCACTCGTTGATGCTGAAGCTGAGGCACTGGTACTTGCTGAGGCCGAAGCACTGGTACTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTGCTTGCTGAGGCCGAAGCACTGGTACTTGCTGAAGCTGATGCGCTTGTCGATGCTGAAGCCGAAGCACTGGTTGAGGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTGCTTGCTGAAGCTGACGCACTGGTTGATGCGGAAGCCGAAGCACTCGTTGAGGCTGAAGCTGACGCACTTGTACTTGCTGAAGCCGAAGCACTGGTGCTTGCTGAGGCCGAAGCACTTGTACTTGCTGAAGCTGAGGCGCTTGTGCTTGCTGAAGCTGACGCGCTTGTGCTT
23957 NC_017591.1 Streptococcus-pneumoniae Bacteria 1653375-1665417 12043 385 24 CTGAAGCTGA CTGAAGCTGAGGCGCTAGTACTTGCTGAAGCCGAGGCACTGGTTGATGCTGAGGCTGAGGCGCTAGTACTTGCTGAAGCCGAAGCACTCGTTGATGCTGAGGCTGAAGCACTGGTTGACGCTGAAGCTGAGGCACTCGTTGAGGCTGAAGCCGAAGCACTCGTTGATGCGGAAGCTGACGCACTGGTACTTGCAGAAGCTGAGGCACTGGTTGACGCAGAAGCTGAGGTACTGGTGCTTGCTGAAGCTGATGCACTTGTTGATGCTGAAGCCGAAGCACTGGTGCTTGCGGAAGCTGACGCACTGGTTGACGCTGAAGCCGAGGCACTTGTCGACGCTGAGGCTGAGGCACTGGTTGATGCTGAAGCTGAAGCGCTTGTCGATGCTGAAGCTGATGCACTGGTACTTGCTGAGGCTGAGGCACTGGTGCTTGCTGAAGCTGATGCACTGGTTGATGCTGAGGCTGAAGCACTTGTACTTGCGGAAGCTGAGGCGCTTGTGCTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCTGAAGCGCTTGTCGATGCTGAGGCTGACGCACTTGTCGACGCTGAAGCTGAAGCACTGGTTGACGCTGAAGCTGATGCACTCGTTGACGCTGAAGCTGAAGCGCTGGTTGAGGCTGAGGCTGACGCACTTGTGCTTGCTGAAGCGGACGCACTCGTTGATGCTGAGGCTGACGCACTTGTGCTTGCTGAAGCCGATGCACTCGTTGATGCGGAAGCTGATGCACTTGTTGATGCGGAAGCTGATGCACTCGTTGATGCTGAAGCTGAGGCGCTAGTACTTGCTGAAGCCGAGGCACTTGTCGACGCTGAGGCTGAAGCACTGGTACTTGCTGAGGCTGACGCACTGGTACTTGCTGAAGCTGAGGCGCTAGTACTTGCTGAAGCCGAGGCGCTGGTGCTTGCTGAAGCCGAAGCACTGGTTGACGCTGAAGCTGAGGCGCTAGTACTTGCTGAAGCTGATGCACTGGTTGATGCTGAAGCTGAAGCACTTGTTGACGCTGAAGCCGAAGCACTTGTTGACGCTGATGCTGAGGCGCTAGTACTTGCTGAGGCTGACGCACTGGTACTTGCTGAAGCTGAGGCACTTGTCGACGCTGAAGCCGAAGCACTGGTGCTTGCTGAAGCTGAAGCACTGGTGCTTGCTGAGGCTGACGCACTTGTACTTGCTGAAGCCGACGCACTGGTGCTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCTGAAGCACTCGTTGATGCTGAAGCCGACGCACTCGTTGATGCTGAGGCTGACGCACTGGTACTTGCTGAAGCTGAGGCACTTGTCGACGCTGAAGCCGAGGCACTGGTGCTTGCTGAAGCCGAAGCACTTGTCGACGCTGAAGCTGAAGCGCTTGTCGATGCTGAGGCTGACGCACTTGTCGACGCTGAAGCTGAAGCGCTTGTCGATGCTGAAGCTGACGCACTCGTTGATGCTGAAGCCGAGGCACTGGTTGACGCTGAAGCTGAGGCGCTTGTTGATGCTGAGGCTGAGGCACTAGTACTTGCTGAAGCCGAAGCACTTGTTGACGCTGATGCTGAGGCGCTAGTACTTGCTGAGGCTGACGCACTGGTTGATGCGGAAGCTGAGGCGCTTGTGCTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCTGAAGCGCTTGTCGATGCTGAGGCTGACGCACTTGTCGACGCTGAAGCTGAAGCACTGGTTGACGCTGAAGCTGATGCACTCGTTGACGCTGAAGCTGAAGCGCTGGTTGAGGCTGAGGCTGACGCACTTGTGCTTGCTGAAGCGGACGCACTCGTTGATGCTGAGGCTGACGCACTTGTGCTTGCTGAAGCCGATGCACTCGTTGATGCGGAAGCTGATGCACTTGTTGATGCGGAAGCTGATGCACTCGTTGATGCTGAAGCTGAGGCGCTAGTACTTGCTGAAGCTGACGCACTGGTTGACGCTGAAGCCGAGGCGCTAGTGCTTGCTGAAACTGAGGCACTTGTGCTTGCTGAAGCCGAAGCACTGGTACTTACTGAAGCTGAGGCACTCGTACTTGCTGAAGCCGACGCACTGGTACTTGCTGAAGCTGAGGCGCTAGTACTTGCTGAAGCTGATGCACTGGTTGATGCTGAGGCTGAAGCACTTGTACTTGCTGAGGCTGAGGCGCTTGTACTTGCTGAGGCTGAAGCACTGGTGCTTGCTGAAGCTGAAGCACTTGTTGACGCTGAGGCTGAAGCACTTGTTGATGCTGAAGCTGATGCACTGGTGCTTGCTGAAGCTGAGGCGCTAGTACTTGCTGAAGCTGATGCACTGGTTGATGCTGAAGCTGAAGCACTTGTTGACGCTGAAGCCGAAGCACTTGTTGACGCTGATGCTGAGGCGCTAGTACTTGCTGAGGCTGACGCACTGGTACTTGCTGAAGCCGAGGCACTGGTGCTTGCTGAAGCCGAAGCACTTGTCGACGCTGAAGCTGAAGCGCTTGTCGATGCTGAGGCTGACGCACTTGTACTTGCTGAAGCCGACGCACTGGTGCTTGCTGAGGCTGAAGCACTCGTTGATGCTGAGGCTGAGGCGCTAGTACTTGCTGAAGCTGACGCACTTGTACTTGCTGAAGCTGACGCACTTGTACTTGCTGAAGCTGACGCACTGGTACTTGCTGAAGCTGAGGCGCTAGTACTTGCTGAGGCTGAGGCGCTGGTTGAGGCTGAAGCCGACGCACTCGTTGATGCGGAAGCTGACGCACTGGTGCTTGCTGAGGCTGACGCACTGGTTGATGCTGAAGCTGAGGCGCTTGTGCTTGCTGAGGCTGACGCACTGGTTGATGCTGAAGCTGAGGCGCTTGTGCTTGCTGAAGCCGAAGCACTGGTTGATGCTGAAGCTGAGGCGCTTGTACTTGCTGAAGCCGACGCACTGGTTGATGCTGAGGCTGAGGCGCTGGTACTTGCTGAAGCCGAGGCACTTGTCGACGCTGAGGCTGAGGCACTGGTTGATGCTGAAGCTGACGCACTTGTTGATGCTGAAGCTGAAGCACTTGTTGACGCTGAGGCTGAAGCACTTGTTGATGCTGAAGCTGATGCACTGGTGCTTGCTGAGGCTGACGCACTTGTCGACGCTGAAGCCGAAGCACTGGTGCTTGCTGAAGCTGAAGCACTGGTGCTTGCTGAGGCTGACGCACTTGTACTTGCTGAAGCCGACGCACTGGTGCTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCTGAAGCACTCGTTGATGCTGAAGCCGACGCACTCGTTGATGCTGAGGCTGACGCACTGGTACTTGCTGAAGCTGAGGCACTTGTCGACGCTGAAGCCGAGGCACTGGTGCTTGCTGAAGCTGAGGCGCTTGTTGATGCTGAGGCTGAGGCACTAGTACTTGCTGAAGCCGAAGCACTTGTTGACGCTGATGCTGAGGCGCTAGTACTTGCTGAGGCTGACGCACTGGTTGATGCGGAAGCTGAGGCGCTTGTGCTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCTGAAGCGCTTGTCGATGCTGAGGCTGACGCACTTGTCGACGCTGAAGCTGAAGCACTGGTTGACGCTGAAGCTGATGCACTCGTTGACGCTGAAGCTGAAGCGCTGGTTGAGGCTGAGGCTGACGCACTTGTGCTTGCTGAAGCGGACGCACTCGTTGATGCTGAGGCTGACGCACTTGTGCTTGCTGAAGCCGATGCACTCGTTGATGCGGAAGCTGATGCACTTGTTGATGCGGAAGCTGATGCACTCGTTGATGCTGAAGCTGAGGCGCTAGTACTTGCTGAAGCTGACGCACTGGTTGACGCTGAAGCCGAGGCGCTAGTGCTTGCTGAAACTGAGGCACTTGTGCTTGCTGAAGCCGAAGCACTGGTACTTACTGAAGCTGAGGCACTCGTACTTGCTGAAGCCGACGCACTGGTACTTGCTGAAGCTGAGGCGCTAGTACTTGCTGAAGCTGATGCACTGGTTGATGCTGAGGCTGAAGCACTTGTACTTGCTGAGGCTGAGGCGCTTGTACTTGCTGAGGCTGAAGCACTGGTGCTTGCTGAAGCTGAAGCACTTGTTGACGCTGAGGCTGAAGCACTTGTTGATGCTGAAGCTGATGCACTGGTGCTTGCTGAAGCTGAGGCGCTAGTACTTGCTGAAGCTGATGCACTGGTTGATGCTGAAGCTGAAGCACTTGTTGACGCTGAAGCCGAAGCACTTGTTGACGCTGATGCTGAGGCGCTAGTACTTGCTGAGGCTGACGCACTGGTACTTGCTGAAGCCGAGGCACTGGTGCTTGCTGAAGCCGAAGCACTTGTCGACGCTGAAGCTGAAGCGCTTGTCGATGCTGAGGCTGACGCACTTGTACTTGCTGAAGCCGACGCACTGGTGCTTGCTGAGGCTGAAGCACTCGTTGATGCTGAGGCTGAGGCGCTAGTACTTGCTGAAGCTGACGCACTTGTACTTGCTGAGGCTGACGCACTTGTGCTTGCTGAAGCCGATGCACTCGTTGATGCTGAAGCTGACGCACTGGTACTTGCTGAAGCCGAGGCGCTAGTGCTTGCTGAAACTGAGGCACTTGTGCTTGCTGAAGCCGAAGCACTGGTACTTACTGAAGCTGAGGCACTCGTACTTGCTGAAGCCGACGCACTGGTACTTGCTGAAGCTGAGGCGCTAGTACTTGCTGAAGCTGATGCACTGGTTGATGCTGAGGCTGAAGCACTTGTACTTGCTGAGGCTGAGGCGCTTGTACTTGCTGAGGCTGAAGCACTGGTGCTTGCTGAAGCTGAAGCACTTGTTGACGCTGAGGCTGAAGCACTTGTTGATGCTGAAGCTGATGCACTGGTGCTTGCTGAAGCTGAGGCGCTAGTACTTGCTGAAGCTGATGCACTGGTTGATGCTGAAGCTGAAGCACTTGTTGACGCTGAAGCCGAAGCACTTGTTGACGCTGATGCTGAGGCGCTAGTACTTGCTGAGGCTGACGCACTGGTACTTGCTGAAGCCGAGGCACTGGTGCTTGCTGAAGCCGAAGCACTTGTCGACGCTGAAGCTGAAGCGCTTGTCGATGCTGAGGCTGACGCACTTGTACTTGCTGAAGCCGACGCACTGGTGCTTGCTGAGGCTGAAGCACTCGTTGATGCTGAGGCTGAGGCGCTAGTACTTGCTGAAGCTGACGCACTTGTACTTGCTGAAGCTGACGCACTTGTACTTGCTGAAGCTGACGCACTGGTACTTGCTGAAGCTGAGGCGCTAGTACTTGCTGAGGCTGAGGCGCTGGTTGAGGCTGAAGCCGACGCACTCGTTGATGCGGAAGCTGACGCACTGGTGCTTGCTGAGGCTGACGCACTGGTTGATGCTGAAGCTGAGGCGCTTGTGCTTGCTGAGGCTGACGCACTGGTTGATGCTGAAGCTGAGGCGCTTGTGCTTGCTGAAGCCGAAGCACTGGTTGATGCTGAAGCTGAGGCGCTTGTACTTGCTGAAGCCGACGCACTGGTTGATGCTGAGGCTGAGGCGCTGGTACTTGCTGAGGCTGAGGCACTGGTTGATGCTGAAGCTGACGCACTTGTTGATGCTGAAGCTGAAGCACTTGTTGACGCTGAGGCTGAAGCACTTGTTGATGCTGAAGCTGATGCACTGGTGCTTGCTGAGGCTGACGCACTTGTCGACGCTGAAGCCGAAGCACTGGTGCTTGCTGAAGCTGAAGCACTGGTGCTTGCTGAGGCTGACGCACTTGTACTTGCTGAAGCCGACGCACTGGTGCTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCTGAAGCACTCGTTGATGCTGAAGCCGACGCACTCGTTGATGCTGAGGCTGACGCACTGGTACTTGCTGAAGCTGAGGCACTTGTCGACGCTGAAGCCGAGGCACTGGTGCTTGCTGAAGCCGAAGCACTTGTCGACGCTGAAGCTGAAGCGCTTGTCGATGCTGAGGCTGACGCACTTGTCGACGCTGAAGCTGAAGCGCTTGTCGATGCTGAAGCTGACGCACTCGTTGATGCTGAAGCCGAGGCACTGGTTGACGCTGAAGCTGAGGCGCTTGTTGATGCTGAGGCTGAGGCACTAGTACTTGCTGAAGCCGAAGCACTTGTTGACGCTGATGCTGAGGCGCTAGTACTTGCTGAGGCTGACGCACTGGTTGATGCGGAAGCTGAGGCGCTTGTGCTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCTGAAGCGCTTGTCGATGCTGAGGCTGACGCACTTGTCGACGCTGAAGCTGAAGCACTGGTTGACGCTGAAGCTGATGCACTCGTTGACGCTGAAGCTGACGCGCTGGTTGAGGCTGAGGCTGACGCACTTGTGCTTGCTGAAGCGGACGCACTCGTTGATGCTGAGGCTGACGCACTTGTGCTTGCTGAAGCCGATGCACTCGTTGATGCGGAAGCTGATGCACTTGTTGATGCGGAAGCTGATGCACTCGTTGATGCTGAAGCTGAGGCGCTAGTACTTGCTGAAGCTGACGCACTGGTTGACG
168390 NZ_LS483523.1 Streptococcus-pneumoniae-strain-4041STDY6836169-genome-assembly Bacteria 972788-986042 13255 334 36 TCAACAAGCG TCAACAAGCGCGTCGACCTCAGCAAGCACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCAAGCACGTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGCACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACGTCCGCATCAACAAGCGCAAGTACGTCAGCAAGCACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCTTCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCAAGCACGTCAGCAAGCACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCGTCGACCTCAGCAAGCATGTCGGCATCAACAAGCGCGTCGACCTCAGCAAGCACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGCACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACGTCCGCATCAACAAGCGCAAGTACGTCAGCAAGCACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCGTCGACCTCAGCAAGCACGTCAGCTTCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCTTCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCAAGCACGTCAGCAAGTACATCGGCATCAACAAGTGCCAGCACGTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGCACGTCCGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCGTCGACCTCAGCAAGCACGTCAGCTTCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGCACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACGTCCGCATCAACAAGCGCAAGTACGTCAGCAAGCACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCGTCGACCTCAGCAAGCACGTCAGCTTCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCTTCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCAAGCACGTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGCACGTCCGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCGTCGACCTCAGCAAGCACGTCAGCTTCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCTTCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCAAGCACGTCAGCAAGTACATCGGCATCAACAAGTGCCAGCACGTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGCACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACGTCCGCATCAACAAGCGCAAGTACGTCAGCAAGCACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCGTCGACCTCAGCAAGCACGTCAGCTTCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCAAGCACGTCAGCAAGTACATCGGCATCAACAAGTGCCAGCACGTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGCACGTCCGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGCACGTCAGCATCAACAAGCGCAAGCACGTCAGCAAGTACATCGGCGTCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGTGCAAGTACGTCAGCAAGTACATCAGCATCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCTTCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCAAGCACGTCAGCAAGTACATCGGCATCAACAAGTGCCAGCACGTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGCACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACGTCCGCATCAACAAGCGCAAGTACGTCAGCAAGCACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCGTCGACCTCAGCAAGCACGTCAGCTTCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGCACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACGTCCGCATCAACAAGCGCAAGTACGTCAGCAAGCACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCGTCGACCTCAGCAAGCACGTCAGCTTCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCGTCGACCTCAGCAAGCACGTCAGCTTCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGTGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCGTCGACCTCAGCAAGCACGTCAGCTTCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGCACGTCAGCAAGCACGTCAGCTTCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGCACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACGTCCGCATCAACAAGCGCAAGTACGTCAGCAAGGACATCGGCGTCAACAAGTGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGCACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACGTCCGCATCAACAAGCGCAAGTACGTCAGCAAGCACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCGTCGACCTCAGCAAGCACGTCAGCTTCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCGTCGACCTCAGCAAGCACGTCAGCTTCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCTTCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCAAGCACGTCAGCAAGTACATCGGCATCAACAAGTGCCAGCACGTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGCACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCGTCGACCTCAGCAAGCACGTCAGCTTCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCGTCGACCTCAGCAAGCACGTCAGCTTCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGTGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCGTCGACCTCAGCAAGCACGTCAGCTTCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGTGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGCACGTCCGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGCACGTCAGCATCAACAAGCGCAAGCACGTCAGCAAGTACATCGGCGTCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGTGCAAGTACGTCAGCAAGTACATCAGCATCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCTTCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCAAGCACGTCAGCAAGTACATCGGCATCAACAAGTGCCAGCACGTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGCACGTCCGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCGTCGACCTCAGCAAGCACGTCAGCTTCAACAAGCGCAAGTACATCGGCAAGTACGTCCGCATCAACAAGCGCAAGCACGTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACGTCGGCATCAACAAGCGCAAGTACATCGGCAAGCACGTCAGCATCAACAAGTGCAAGTACGTCAGCAAGTACATCAGCATCAACAAGTGCAAGTACATCAGCAAGTACGTCAGCA
12344 NC_009648.1 Klebsiella-pneumoniae-subsp Bacteria 1130206-1137262 7057 321 18 GACAGCGACT GACAGCGACTCGGATTCTGACAGCGACTCGGACTCCGACAGCGACTCCGACTCTGACAGCGACTCTGACTCTGACAGTGACTCCGATTCGGACAGCGATTCGGATTCTGACAGCGATTCGGACTCGGACAGCGATTCCGACTCTGACAGCGACTCGGATTCGGACAGCGACTCCGACTCCGACAGCGACTCCGATTCGGACAGCGACTCTGACTCGGACAGCGATTCGGACTCTGACAGCGATTCGGATTCCGACAGCGATTCGGACTCTGACAGCGACTCCGACTCCGACAGCGACTCCGATTCGGACAGTGACTCGGATGCTGACAGTGACTCCGATTCGGACAGCGATTCGGATGCTGACAGCGACTCGGACTCCGACAGCGACTCCGACTCCGACAGCGATTCGGACTCCGACAGCGATTCGGACTCCGACAGCGACTCGGATTCGGACAGCGATTCGGATTCCGACAGCGACTCGGACTCCGACAGCGACTCCGACTCTGACAGCGATTCGGATTCCGACAGCGACTCCGATTCGGACAGCGACTCTGACTCCGACAGTGACTCGGATTCTGACAGCGATTCCGACTCCGACAGCGACTCGGATTCCGACAGCGACTCGGACTCGGACAGCGACTCCGATTCGGACAGCGACTCCGATTCTGACAGCGACTCCGATTCTGACAGCGACTCCGACTCGGACAGCGACTCGGACTCCGACAGCGACTCGGACTCCGACAGCGACTCTGACTCCGACAGCGATTCGGATTCTGACAGCGACTCTGACTCTGACAGCGATTCGGATGCTGACAGCGACTCTGACTCCGACAGCGATTCGGATTCTGACAGCGACTCTGACTCTGACAGCGATTCGGATTCTGACAGTGACTCGGACTCGGACAGCGACTCAGACTCTGACAGCGATTCGGATTCTGACAGTGACTCGGACTCGGACAGCGACTCAGACTCTGACAGCGATTCGGATTCCGACAGCGATTCGGACTCCGACAGCGATTCGGATTCTGACAGTGACTCGGATTCTGACAGTGACTCGGACTCGGACAGCGACTCAGACTCTGACAGCGATTCGGATTCCGACAGCGATTCGGACTCCGACAGCGATTCGGATTCTGACAGTGACTCGGATTCTGACAGCGATTCTGACTCGGACAGCGATTCCGATGCTGACAGCGATTCGGATTCCGACAGTGACTCCGATTCTGACAGCGACTCCGATTCTGACAGCGACTCCGACTCGGACAGCGACTCCGACTCCGACAGCGACTCGGACTCCGACAGTGACTCGGATTCGGACAGCGACTCGGATTCTGACAGCGACTCTGACTCCGACAGCGATTCCGATTCTGACAGCGACTCAGACTCGGACAGCGACTCGGATTCTGACAGCGATTCCGATTCGGACAGTGACTCGGATGCTGACAGCGACTCCGACTCCGACAGCGACTCGGACTCTGACAGCGACTCCGATTCGGACAGCGACTCTGACTCCGACAGTGACTCGGATTCTGACAGCGATTCCGACTCCGACAGCGACTCGGATTCCGACAGCGACTCGGACTCGGACAGCGACTCCGATTCGGACAGCGACTCCGATTCTGACAGCGACTCCGATTCTGACAGCGACTCCGACTCGGACAGCGACTCGGACTCCGACAGCGACTCGGACTCCGACAGCGACTCTGACTCCGACAGCGATTCGGATTCTGACAGCGACTCTGACTCTGACAGCGATTCGGATGCTGACAGCGACTCTGACTCCGACAGCGATTCGGATTCTGACAGCGACTCTGACTCTGACAGCGATTCGGATTCTGACAGTGACTCGGACTCGGACAGCGACTCAGACTCTGACAGCGATTCGGATTCTGACAGTGACTCGGACTCGGACAGCGACTCAGACTCTGACAGCGATTCGGATTCCGACAGCGATTCGGACTCCGACAGCGATTCGGATTCTGACAGTGACTCGGATTCTGACAGCGATTCTGACTCGGACAGCGATTCCGATGCTGACAGCGATTCGGATTCCGACAGTGACTCCGATTCTGACAGCGACTCCGATTCTGACAGCGACTCCGACTCGGACAGCGACTCCGACTCCGACAGCGATTCGGACTCCGACAGCGATTCGGACTCCGACAGCGACTCGGATTCGGACAGCGATTCGGATTCCGACAGCGACTCGGACTCCGACAGCGACTCCGACTCTGACAGCGATTCGGATTCCGACAGCGACTCCGATTCGGACAGCGACTCTGACTCCGACAGTGACTCGGATTCTGACAGCGATTCCGACTCCGACAGCGACTCGGATTCCGACAGCGACTCGGACTCGGACAGCGACTCCGATTCGGACAGCGACTCCGATTCTGACAGCGACTCCGATTCTGACAGCGACTCCGACTCGGACAGCGACTCGGACTCCGACAGCGACTCGGACTCCGACAGCGACTCTGACTCCGACAGCGATTCGGATTCTGACAGCGACTCTGACTCTGACAGCGATTCGGATGCTGACAGCGACTCTGACTCCGACAGCGATTCGGATTCTGACAGCGACTCTGACTCTGACAGCGATTCGGATTCTGACAGTGACTCGGACTCGGACAGCGACTCAGACTCTGACAGCGATTCGGATTCTGACAGTGACTCGGACTCGGACAGCGACTCAGACTCTGACAGCGATTCGGATTCCGACAGCGATTCGGACTCCGACAGCGATTCGGATTCTGACAGTGACTCGGATTCTGACAGCGATTCTGACTCGGACAGCGATTCCGATGCTGACAGCGATTCGGATTCCGACAGTGACTCCGATTCTGACAGCGACTCCGATTCTGACAGCGACTCCGACTCGGACAGCGACTCCGACTCCGACAGCGACTCGGACTCCGACAGTGACTCGGATTCGGACAGCGATTCGGATTCCGACAGCGATTCGGACTCTGACAGTGACTCGGATTCTGACAGCGACTCAGACTCCGACAGCGACTCGGACTCTGACAGCGATTCGGACTCTGACAGTGACTCCGATTCGGACAGCGACTCTGACTCTGACAGCGACTCCGACTCCGACAGTGACTCCGATTCGGACAGCGATTCGGACTCTGACAGTGACTCGGATTCGGACAGCGACTCGGACTCCGACAGCGACTCAGACTCCGACAGCGACTCTGACTCTGACAGCGACTCCGATTCCGACAGTGACTCGGACTCTGACAGTGACTCGGACTCTGACAGTGACTCGGATTCTGACAGCGATTCTGACTCGGACAGCGACTCGGATGCTGACAGCGATTCGGACTCTGACAGTGACTCGGATTCGGACAGCGACTCTGACTCTGACAGCGACTCCGATTCCGACAGCGATTCGGACTCTGACAGTGACTCGGATTCGGACAGCGACTCGGACTCCGACAGCGATTCGGACTCTGACAGTGACTCCGATTCGGACAGCGACTCGGACTCCGACAGCGATTCCGATTCCGACAGCGACTCGGACTCCGACAGCGACTCTGACTCGGACAGCGACTCGGATGCTGACAGCGACTCTGACTCGGACAGCGATTCGGACTCTGACAGTGACTCCGATTCGGACAGCGACTCTGACTCTGACAGCGACTCCGATTCCGACAGTGACTCGGATTCCGACAGCGACTCAGACTCTGACAGTGACTCGGATTCTGACAGCGACTCGGATTCTGACAGCGACTCGGATTCGGACAGCGACTCTGACTCTGACAGCGACTCTGACTCCGACAGCGATTCGGATTCTGACAGCGATTCGGACTCCGACAGCGACTCGGACTCTGACAGCGACTCCGATTCGGACAGCGATTCGGACTCGGACAGCGACTCTGACTCGGACAGCGATTCGGACTCTGACAGTGACTCCGATTCGGACAGCGACTCGGATTCTGACAGCGATTCGGATTCTGACAGCGACTCGGATTCTGACAGCGATTCTGACTCTGACAGTGACTCCGATTCGGACAGCGACTCTGACTCCGACAGCGACTCGGACTCTGACAGCGATTCCGACTCTGACAGCGATTCGGATTCCGACAGTGACTCGGATTCTGACAGCGATTCGGACTCGGACAGCGACTCGGATTCTGACAGTGACTCGGATTCTGACAGCGACTCGGATGCTGACAGCGATTCGGACTCTGACAGTGACTCCGATTCGGACAGCGACTCTGACTCCGACAGCGATTCGGATTCC
70841 NZ_CP014264.1 Streptococcus-sp Bacteria 308475-321039 12565 288 48 TCAGCAAGCA TCAGCAAGCACATCAGCGTCTGAGTCAGCATCAACAAGTGCAAGCCAGTCAGCCAGCACATCAGCATCTGAATCAGCGTCAACAAGTGCTAGTCAGTCAGCAAGCACATCAGCATCTGAATCAGCGTCAACAAGTGCGAGCCAATCAGCAAGCACAAGCGCGTCTGAGTCAGCATCAACAAGTGCAAGCCAGTCAGCCAGCACATCAGCATCTGAATCAGCGTCAACCAGTGCAAGCCAGTCAGCAAGCACATCGGCTTCAGAGTCAGCGTCAACAAGTGCTAGTCAATCAGCAAGCACATCGGCATCTGAATCAGCGTCAACCAGTGCGAGCCAATCAGCAAGCACATCGGCTTCAGAGTCAGCGTCAACCAGTGCAAGCCAGTCAGCAAGCACAAGCGCGTCTGAATCAGCATCAACAAGTGCAAGCCAGTCAGCAAGCACATCGGCATCAGAGTCAGCGTCAACAAGTGCGAGCCAATCAGCAAGCACAAGCGCGTCTGAATCAGCATCAACAAGTGCGAGCCAATCAGCAAGCACAAGCGCGTCTGAATCAGCGTCAACAAGTGCAAGCCAATCAGCAAGCACATCGGCATCTGAATCAGCGTCAACAAGTGCTAGTCAATCAGCAAGCACATCGGCATCTGAATCAGCATCAACAAGTGCGAGCCAATCAGCAAGCACAAGCGCGTCTGAATCAGCGTCAACAAGTGCAAGCCAATCAGCAAGCACATCGGCATCTGAATCAGCGTCAACAAGTGCTAGTCAATCAGCAAGCACATCGGCATCTGAATCAGCGTCAACCAGTGCAAGCCAATCAGCAAGCACAAGCGCGTCTGAATCAGCATCAACCAGTGCAAGCCAGTCAGCAAGCACATCAGCATCTGAATCAGCGTCAACCAGTGCGAGCCAATCAGCAAGCACATCAGCATCTGAATCAGCGTCAACCAGTGCTAGTCAGTCAGCAAGCACATCAGCATCTGAATCAGCGTCAACAAGTGCGAGCCAATCAGCAAGCACAAGCGCGTCTGAGTCAGCATCAACAAGTGCAAGCCAATCAGCAAGCACATCGGCATCTGAATCAGCGTCAACCAGTGCGAGCCAATCAGCAAGCACATCGGCTTCAGAGTCAGCGTCAACCAGTGCAAGCCAGTCAGCAAGCACAAGCGCGTCTGAATCAGCGTCAACAAGTGCTAGTCAATCAGCAAGCACATCGGCTTCAGAGTCAGCATCAACAAGTGCGAGCCAATCAGCAAGCACAAGCGCGTCTGAATCAGCATCAACAAGTGCGAGCCAATCAGCAAGCACAAGCGCGTCTGAATCAGCGTCAACAAGTGCAAGCCAATCAGCAAGCACATCGGCATCTGAATCAGCGTCAACCAGTGCGAGCCAATCAGCAAGCACATCGGCTTCAGAGTCAGCGTCAACCAGTGCAAGCCAGTCAGCAAGCACAAGCGCGTCTGAGTCAGCATCAACAAGTGCAAGCCAGTCAGCCAGCACATCAGCATCTGAATCAGCGTCAACAAGTGCAAGCCAGTCAGCAAGCACATCAGCATCTGAATCAGCGTCAACAAGTGCAAGCCAGTCAGCAAGCACAAGCGCGTCTGAATCAGCATCAACAAGTGCAAGCCAGTCAGCAAGCACATCGGCTTCTGAGTCAGCGTCAACAAGTGCAAGCCAGTCAGCAAGCACATCAGCATCTGAATCAGCGTCAACAAGTGCGAGCCAATCAGCAAGCACATCGGCTTCAGAGTCAGCGTCAACAAGTGCTAGTCAATCAGCAAGCACAAGCGCATCTGAATCAGCATCAACAAGTGCAAGCCAGTCAGCAAGCACATCGGCATCAGAGTCAGCGTCAACAAGTGCGAGCCAATCAGCAAGCACAAGCGCGTCTGAATCAGCGTCAACAAGTGCAAGCCAGTCAGCAAGCACATCGGCATCAGAGTCAGCGTCAACAAGTGCAAGCCAGTCAGCAAGCACAAGCGCATCTGAATCAGCATCAACAAGTGCAAGCCAGTCAGCAAGCACATCGGCATCAGAGTCAGCGTCAACAAGTGCGAGCCAATCAGCAAGCACATCGGCATCAGAGTCAGCGTCAACAAGTGCGAGCCAATCAGCAAGCACATCGGCTTCAGAATCAGCGTCAACAAGTGCGAGCCAATCAGCAAGCACATCAGCATCTGAATCAGCGTCAACAAGTGCTAGTCAATCAGCAAGCACATCGGCATCTGAATCAGCGTCAACAAGTGCTAGTCAATCAGCAAGCACATCGGCATCTGAATCAGCGTCAACAAGTGCAAGCCAATCAGCAAGCACATCGGCATCAGAGTCAGCGTCAACAAGTGCAAGCCAGTCAGCAAGCACATCGGCTTCAGAGTCAGCGTCAACAAGTGCGAGCCAATCAGCAAGCACAAGCGCGTCTGAGTCAGCATCAACAAGTGCGAGCCAATCAGCAAGCACATCGGCTTCAGAGTCAGCGTCAACAAGTGCGAGCCAATCAGCAAGCACATCGGCATCTGAATCAGCGTCAACAAGTGCTAGTCAATCAGCAAGCACATCGGCATCTGAATCAGCGTCAACAAGTGCAAGCCAATCAGCAAGCACATCGGCTTCAGAGTCAGCGTCAACAAGTGCAAGCCAGTCAGCAAGCACATCGGCTTCAGAGTCAGCGTCAACCAGTGCGAGCCAATCAGCAAGCACAAGCGCATCTGAATCAGCGTCAACAAGTGCGAGCCAATCAGCAAGCACATCAGCATCTGAATCAGCGTCAACCAGTGCAAGCCAATCAGCAAGCACAAGCGCGTCTGAATCAGCATCAACAAGTGCAAGCCAGTCAGCAAGCACAAGCGCGTCTGAATCAGCATCAACAAGTGCAAGCCAGTCAGCAAGCACATCAGCATCTGAATCAGCGTCAACAAGTGCGAGCCAATCAGCAAGCACATCAGCATCTGAATCAGCGTCAACCAGTGCTAGTCAGTCAGCAAGCACATCAGCATCTGAATCAGCATCAACAAGTGCAAGCCAGTCAGCAAGCACAAGCGCGTCTGAGTCAGCATCAACAAGTGCAAGCCAGTCAGCAAGCACATCAGCATCTGAATCAGCATCAACAAGTGCGAGCCAATCAGCAAGCACATCGGCTTCAGAGTCAGCGTCAACAAGTGCGAGCCAATCAGCAAGCACAAGCGCGTCTGAGTCAGCATCAACAAGTGCAAGCCAGTCAGCAAGCGCAAGCGCATCTGAATCAGCGTCAACAAGTGCGAGCCAATCAGCAAGCACAAGCGCGTCTGAATCAGCATCAACAAGTGCAAGCCAGTCAGCAAGCACATCAGCATCTGAATCAGCATCAACAAGTGCGAGCCAATCAGCAAGCACAAGCGCATCTGAATCAGCGTCAACAAGTGCGAGCCAATCAGCAAGCACAAGCGCGTCTGAATCAGCATCAACAAGTGCAAGCCAGTCAGCAAGTACATCAGCTTCAGAGTCAGCGTCAACAAGTGCAAGCCAGTCAGCAAGCACATCGGCTTCAGAGTCAGCGTCAACAAGTGCGAGCCAATCAGCAAGCACAAGCGCGTCTGAGTCAGCATCAACAAGTGCAAGCCAGTCAGCAAGCACAAGCGCATCTGAATCAGCGTCAACAAGTGCGAGCCAATCAGCAAGCACAAGCGCGTCTGAATCAGCATCAACCAGTGCAAGCCAGTCAGCAAGCACATCAGCATCTGAATCAGCATCAACCAGTGCGAGCCAATCAGCAAGCACATCGGCATCAGAGTCAGCGTCAACAAGTGCGAGCCAATCAGCAAGCACATCGGCTTCAGAGTCAGCGTCAACAAGTGCGAGCCAATCAGCAAGCACATCGGCATCAGAGTCAGCGTCAACAAGTGCGAGCCAATCAGCAAGCACAAGCGCGTCTGAGTCAGCATCAACAAGTGCAAGCCAGTCAGCAAGCACATCGGCATCAGAGTCAGCGTCAACCAGTGCGAGCCAATCAGCAAGCACAAGCGCATCTGAATCAGCGTCAACAAGTGCGAGCCAGTCAGCAAGTACATCGGCTTCTGAGTCAGCGTCAACAAGTGCAAGCCAGTCAGCAAGCACATCGGCTTCAGAGTCAGCGTCAACAAGTGCAAGCCAATCAGCAAGCACAAGCGCATCTGAATCAGCATCAACAAGTGCGAGCCAATCAGCAAGCACAAGCGCGTCTGAATCAGCGTCAACAAGTGCAAGCCAATCAGCAAGCACAAGCGCATCTGAATCAGCGTCAACAAGTGCGAGCCAATCAGCAAGCACAAGCGCGTCTGAGTCAGCATCAACAAGTGCGAGCCAATCAGCAAGCACAAGCGCATCTGAATCAGCATCAACCAGTGCAAGCCAGTCAGCAAGCACATCAGCATCTGAATCAGCATCAACCAGTGCGAGCCAATCAGCAAGCACATCGGCTTCAGAGTCAGCGTCAACAAGTGCTAGTCAATCAGCAAGCACATCGGCTTCAGAATCAGCGTCAACCAGTGCAAGCCAGTCAGCAAGCACATCGGCCTCTGAATCAGCGTCAACAAGTGCGAGCCAATCAGCAAGCACATCGGCTTCAGAGTCAGCGTCAACAAGTGCGAGCCAATCAGCAAGCACATCGGCTTCAGAATCAGCATCAACAAGTGCAAGCCAGTCAGCAAGCACATCGGCTTCAGAGTCAGCGTCAACCAGTGCGAGCCAATCAGCAAGCACATCGGCTTCAGAGTCAGCGTCAACAAGTGCGAGCCAATCAGCAAGCACATCAGCATCTGAATCAGCGTCAACCAGTGCAAGCCAGTCAGCAAGCACATCGGCTTCAGAGTCAGCGTCAACCAGTGCTAGTCAATCAGCAAGCACAAGCGCGTCTGAATCAGCATCAACAAGTGCAAGCCAGTCAGCAAGCACAAGCGCGTCTTAATCAGCATCAACAAGTGCTAGTCAATCAGCAAGCACAAGCGCGTCTGAGTCAGCGTCAACAAGTGCGAGCCAATCAGCAAGCACATCGGCTTCAGAATCAGCGTCAACCAGTGCAAGCCAGTCAGCAAGCACATCGGCCTCTGAATCAGCGTCAACCAGTGCGAGCCAATCAGCAAGCACAAGCGCATCAGAGTCAGCGTCAACCAGTGCGAGCCAGTCAGCAAGCACATCAGCGTCTGAGTCAGCATCAACAAGTGCAAGCCAGTCAGCAAGCACATCAGCATCTGAATCAGCGTCAACCAGTGCGAGCCAATCAGCAAGCACAAGCGCGTCTGAGTCAGCATCAACAAGTGCAAGCCAGTCAGCAAGCACATCAGCATCTGAATCAGCGTCAACCAGTGCGAGCCAGTCAGCAAGCACAAGCGCATCTGAATCAGCGTCAACCAGTGCAAGCCAGTCAGCAAGCACAAGCGCGTCTGAATCAGCATCAACAAGTGCAAGCCAGTCAGCAAGCACAAGCGCGTCTGAATCAGCATCAACAAGTGCGAGCCAATCAGCAAGCACATCGGCTTCTGAGTCAGCGTCAACAAGTGCAAGCCAGTCAGCAAGCACATCGGCTTCAGAGTCAGCGTCAACCAGTGCGAGCCAATCAGCAAGCACAAGCGCATCTGAATCAGCATCAACAAGTGCGAGCCAATCAGCAAGCACATCGGCTTCAGAGTCAGCGTCAACAAGTGCTAGTCAATCAGCAAGCACATCGGCTTCTGAGTCAGCGTCAACCAGTGCAAGCCAGTCAGCAAGCACATCGGCCTCTGAATCAGCGTCAACAAGTGCGAGCCAATCAGCAAGCACAAGCGCATCAGAGTCAGCGTCAACCAGTGCGAGCCAGTCAGCAAGCACATCAGCATCTGAATCAGCGTCAACCAGTGCGAGCCAATCAGCAAGCACAAGCGCGTCTGAGTCAGCATCAACAAGTGCAAGCCAGTCAGCAAGCACATCAGCATCTGAATCAGCGTCAACAAGTGCGAGCCAGTCAGCAAGCACAAGCGCGTCTGAATCAGCATCAACAAGTGCAAGCCAGTCAGCAAGCACAAGCGCGTCTGAATCAGCGTCAACCAGTGCAAGCCAGTCAGCAAGCACATCGGCTTCTGAGTCAGCGTCAACAAGTGCAAGCCAGTCAGCAAGCACATCGGCTTCAGAGTCAGCGTCAACAAGTGCGAGCCAATCAGCAAGCACAAGCGCGTCTGAATCAGCATCAACAAGTGCGAGCCAATCAGCAAGCACATCGGCATCAGAGTCAGCGTCAACAAGTGCGAGCCAATCAGCAAGCACAAGCGCGTCTGAGTCAGCATCAACAAGTGCATCAGCTTCAGCAAGCACAAGTGCGTCTGAATCTGCATCAACAAGTGCGTCAGCGTCAGCAAGCACATCAGCCTCTGAGTCAGCGTCAACAAGTGCCTCAGCTTCAGCAAGCACATCAGCGTCTGAGTCAGCCTCAACAAGTGCGTCAGTCTCAGCAAGCACATCAGCTTCTGAATCTGCATCAACAAGTGCGTCAGCGTCAGCAAGCACATCAGCCTCTGAGTCAGCCTCAACAAGTGCGTCAGTCTCAGCAAGCACATCAGCTTCTGAATCTGCATCAACAAGTGCGTCAGCGTCAGCAAGCACATCAGCCTCTGAGTCAGCGTCAACCAGTGCCTCAGCTTCAGCAAGCACATCGGCTTCTGAGTCTGCATCAACAAGTGCGTCAGCGTCAGCAAGCACATCAGCCTCTGAATCAGCGTCAACAAGTGCCTCAGCTTCAGCAAGCACATCAGCGTCTGAGTCAGCGTCAACAAGTGCGTCAGTCTCAGCAAGCACATCAGCTTCTGAATCTGCATCAACAAGTGCCTCAGCTTCAGCAAGCACATCGGCTTCTGAGTCTGCATCAACATCAGCCTCAGCGTCAGCAAGCACATCAGCCTCTGAATCAGCGTCAACAAGTGCCTCAGCTTCAGCAAGCACATCAGCATCTGAGTCAGCCTCAACAAGCGCTTCAGCGTCAGCAAGCACATCGGCTTCTGAGTCAGCGTCAACAAGTGCGTCAGTCTCAGCAAGCACATCAGCTTCTGAATCTGCATCAACAAGTGCGAGCCAATCAGCAAGCACATCGGCTTCTGAGTCTGCATCAACATCAGCATCAGCCTCAGCAAGCACATCAGCCTCTGAATCAGCGTCAACAAGTGCCTCAGCTTCAGCAAGCACAAGCGCCTCTGAATCAGCGTCAACAAGCGCGTCTGCTTCAGCAAGCACATCAGCATCTGAGTCAGCGTCAACAAGTGCCTCAGCTTCAGCAAGCACATCGGCTTCTGAGTCAGCATCAACATCAGCTTCAGCCTCAGCAAGTACAAGCGCGTCTGAATCAGCATCAACAAGTGCAAGCCAGTCAGCAAGTACAAGCGCGTCTGAATCAGCGTCAACAAGTGCGAGCCAGTCAGCAAGCACAAGCGCGTCTGAGTCAGCATCAACAAGTGCGTCAGCGTCAGCAAGCACAAGCGCGTCTGAATCAGCATCAACAAGTGCAAGTCAATCAGCAAGCACAAGCGCGTCTGAATCAGCATCAACAAGTGCAAGCCAGTCAGCAAGCCAATCAGCATCTGAATCAGCGTCAACAAGTGCGAGCCAGTCAGCAAGCACATCAGCATCTGAATCAGCATCAACAAGTGCTAGTCAATCAGCAAGCACATCGGCATCAGAGTCAGCGTCAACAAGTGCGTCAGTCTCAGCAAGCACATCAGCTTCTGAATCTGCATCAACAAGTGCCTCAGCTTCAGCAAGCACATCGGCTTCTGAGTCTGCATCAACATCAGCATCAGCGTCAGCAAGCACATCAGCCTCTGAATCAGCGTCAACAAGTGCCTCAGCTTCAGCAAGCACATCGGCTTCTGAGTCTGCATCAACATCAGCATCAGCGTCAGCAAGCACATCAGCCTCTGAATCAGCGTCAACAAGTGCCTCAGCTTCAGCAAGCACATCAGCATCTGAGTCAGCCTCAACAAGCGCTTCAGCGTCAGCAAGCACATCGGCTTCTGAGTCAGCGTCAACAAGTGCGTCAGTCTCAGCAAGCACATCAGCTTCTGAATCAGCATCAACAAGTGCGAGCCAATCAGCAAGCACATCGGCTTCTGAGTCTGCATCAACATCAGCATCAGCCTCAGCAAGCACATCAGCCTCTGAATCAGCGTCAACAAGTGCCTCAGCTTCAGCAAGCACAAGCGCCTCTGAATCAGCGTCAACAAGCGCGTCTGCTTCAGCAAGCACATCAGCATCTGAGTCAGCGTCAACAAGTGCCTCAGCTTCAGCAAGCACATCGGCTTCTGAGTCAGCATCAACATCAGCTTCAGCCTCAGCAAGTACAAGCGCGTCTGAATCAGCATCAACAAGTGCAAGCCAGTCAGCAAGTACAAGCGCGTCTGAATCAGCGTCAACAAGTGCGAGCCAATCAGCAAGCACAAGCGCGTCTGAGTCAGCATCAACAAGTGCGTCAGCGTCAGCAAGCACAAGCGCCTCTGAATCAGCGTCAACAAGTGCGAGCCAGTCAGCAAGCACAAGCGCGTCTGAATCAGCATCAACAAGTGCAAGTCAATCAGCAAGCACAAGCGCGTCTGAATCAGCATCAACAAGTGCAAGCCAGTCAGCAAGCCAATCAGCATCTGAATCAGCGTCAACAAGTGCGAGCCAGTCAGCAAGCACATCAGCATCTGAATCAGCATCAACAAGTGCTAGTCAATCAGCAAGCACATCGGCATCAGAGTCAGCGTCAACAAGTGCAAGCCAGTCAGCAAGCACAAGCGCATCTGAATCAGCATCAACAAGTGCTAGTCAATCAGCAAGCACAAGCGCGTCTGAGTCAGCATCAACAAGTGCAAGCCAGTCAGCAAGCACATCAGCATCTGAATCAGCATCAACAAGTGCAAGTCAATCAGCAAGCACATCAGCATCTGAGTCAGCGTCAACAAGTGCGTCAGTCTCAGCAAGCACATCAGCTTCTGAATCTGCATCAACAAGTGCCTCAGCTTCAGCAAGCACATCGGCTTCTGAGTCTGCATCAACATCAGCATCAGCCTCAGCAAGCACATCAGCATCAGAGTCAGCGTCAACAAGTGCGTCAGCGTCAGCAAGCACATCAGCATCTGAATCAGCGTCAACAAGTGCGTCAGCGTCAGCAAGCACATCGGCTTCTGAGTCAGCATCAACATCAGCTTCAGCCTCAGCAAGCACATCGGCTTCTGAGTCTGCATCAACATCAGCTTCAGCCTCAGCAAGCACAAGTGCGTCTGAATCAGCGTCAACAAGTGCGTCAGCGTCAGCAAGCACATCAGCATCTGAATCAGCGTCAACAAGTGCTTCAGCCTCAGCAAGCACAAGCGCCTCTGAATCAGCGTCAACAAGTGCGTCAGCGTCAGCAAGCACATCAGCATCAGAGTCAGCCTCAACAAGTGCATCAGCGTCAGCAAGCACATCGGCCTCTGAATCAGCCTCAACAAGTGCGTCAGCTTCAGCAAGCACAAGCGCTTCAGAGTCAGCATCAACAAGTGTGTCTGAATCAGCAAGCACAAGCGCATCAGAGTCAGCATCAACAAGTGCGTCTGAATCAGCAAGCACATCAGCTTCAGAATCAGCATCAACAAGTGCCTCTGAGTCAGCAAGCACAAGTGCCTCAGAGTCAGCGTCAACCAGTGCTTCAGCT
114062 NZ_CP025287.1 Ethanoligenens-harbinense-strain-B49-chromosome Bacteria 639963-658735 18773 283 67 TTTCAATCCA TTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTCCTCCTGGCAAAATTAAAACAGAATATATATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCCCGTCTGATGATGACCGGATGGCTACCGGTCGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGCCGATTCGATAGATTTAAGGCTATCCAGTTTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTCCTCCTGGCAAAATTAAAACAGAATATATATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTTGTCGATGTTTACGTCGGGTTAAGTGTCTATCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGGCACGGGATATTTATGGTCGCATTCGAGGTACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGCGCGTGGGTCTGTCAAACTGCGTAAACAGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTACGCATCAACTTACGAGATATCATGACAAGAGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATACAGGCTTGGATTTGGATAATGTCGCTTCCATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGGATCGTGGCTGACATATGGTGATATCGAGAACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTGTCTGTGGGAATACGTTGCCTTTGATGTTGGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCTGCCGAGCAGGTAGTCTGTTGATGTTTTGAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCACGTGATCGGATGGTTTTATCAGCTGTTTCCTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTGCCCTGGGCGAGATCAAAGAAAACTATGTGACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGATACCCGCCAACATACGATTGGCATTACGTTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCAACTTCCTCCTGCGCTCCGTGAGACTATCTATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACAAGCAGGTGGCGGGATATCTCAACGCCAAGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGCGCTTGGCATGTTGAGTATGCGCGCAGCACAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATATACATTTTGGCGTAGTAACATGAATGATATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCAACACACAACAACGACGACAAAATAATCATATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACCGATTGGGGTATTTTTTTGCTACTGTGTCACAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCGAGGGCCTGACCAGCAGGCCCACACCACACACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCGATCGCGCCGGGCATACTCCCGAGGATTAAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTCAAAATTCGCAATCACATTCGTATGCGTTGGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAGTTGCATAGTATTGCAACACCATTTTAGTAGACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTGGGCATCTGGTTATTTGGTTGTTCGTGCAGGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGATTTTGCCCAATCATTGTGATGTTTGACGCTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATTCTGAAGTCCTTTAGCATGAAAGTTCCCAAAGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATCAAGGTTTCCGCCAATTACCGTTGAATTTGCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATCCCGGCGCAAGGTACACAAGACATCCTGCGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTATCGGATCGCCTATTGACCTTGCCAGCGTACCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTTAATATCCGGAGTGATTTCTCCGGGCTTTGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGGCATCAGCAGCGCTTTTTCCGACGGCTTAGGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCACAGGGGCGCAGGGCTTAGGGCACCGGTGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTATTGGATTCCCCAAATCCTCTATAATTGAACTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCTGGACGCGTTGAAAGCCCGCATCGACCGTATAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATTGGACCGGATGGGTCTCTGGTAGCCTACCTCGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCATGCGTGGTGCCACGGGTATATCACCAACGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACAAAGTATGTAATAAATATAACCATGCATAACAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATTCTGCGATTACGATGTTATGTGCAGAGTTAGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCAATCCAGTCCGTTATTGCCGTATACGCTGATCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCGCACCCAGCGTCAACAGGCAAAGGCACGGTTGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGACAAGTGACATAGATATTATAAGATATCAAGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCGCTACGGCGGCAATCAGGATAACAGCTATTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAACGACAGACAGTTATCCTATGAACGACGTGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTATGACTGTTGATAATCTGAAACGTTATGCTATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTAGCCCAGCGTGCCGCAATGCTATAAAGATAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGTCGGGCACCACGACGAACCGGTGAGCGGATGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGCTACATTGGCTAATATGTATTCTACTGAAATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCACAGGGCAAGGGCAAGTCTACTGTGCTGGCCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGATGGATGCTATTAATACACCAATGGATGTAATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCATAATTTTGACTTCCTTTGCAATAATGTCATGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGATATCCCCGGAAAGCATCGCCGGGGGAATATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGTTTCAGAATTTAAAACAGAGGGGATAGAATGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAATATCAGGCAATCATAACTTCACTTAAATATAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCGGCGTTCGGATGGGTGCCACGGATGGATCGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGAGGAGGTGTGAAAGCATGAGCAATCTTCCTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCACTCTGGATACTGTTGTTGATGATGTACACAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAACGGACACAGTGGGACATGCTACCAATATACCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAGCCTTATCACTCCCGAGCACCGGTATAAGCCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTCCTTTACCGCTACTCCCTGCCGCTTGGATGGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTACACCAGTTATATCACCGAGTATGGCCTTGCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAGGGCCTCGCGGCTATCAGACAAGCTATCCAAACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAAGTATATAACTCCATCTCCGCCACTCCGGGTGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGTGCTGGTTCTTGTCGTCAAGCATATCATTTCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCACCATCTCGCCGCGCTGAGCGCGGTGTATTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCAGCGAGGGATTACAGCTCGGCAGGTGTTCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAAGGATACCGCGTTGTCGTTTACGCCGGGTATCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGACACGCGAAGTAATGACTGGTATACGGAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCAGCGAGGGATTACAGCTCGGCAGGTGTTCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCCCCTCACGCAAGCATCGGCAGAATCGCTTTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTACAGGGCGACACTGTGTTGCAAATCTCGAATTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCAGCGAGGGATTACAGCTCGGCAGGTGTTCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCAGCGAGGGATTACAGCTCGGCAGGTGTTCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGGATTTTCTTGTTTTGGTAGTTGAAGATTTGAGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGTGACCGATGGCCCCAAATGTGATACCGTTTTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGAACCCGCCATTTTCACAAGCAGAGCAATTTATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGATGGCAACCACAACATCGTTGTGCCTTTTACTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACGCAGGGCTGATTATGACCGTATCCACCGAGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTCCGGCGGGACGTTCTACCAGTCTACCACAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTCCACGACAAACCTTTTTTGTCGCAATCAAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGATGCCGGCAACTCGGACAGCGCCACACGTACACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAGCCCGCGTAAAAAAGGCATCCGAACCAGTGACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACACAAAAGATGCCCTGCAATACATCGTTGGGTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGGCAAGTAACGTTCATTTTGCAGAGCCAAAGTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTGCATAGTCCTTGTTTCGACGTGCGCGCTTGGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTCGGCCGAATCTGCAATCATCCAGCTCAAAAGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTAACCCAACGATGTATTCCAGCGCACTTCTTGTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGAGGATGTGTTCGATGGTGCGTCCACCGCTTTCTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGTTCCGTTTTTGTTTAACGCCAGCTGGAATGTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCACGATACAGTGTAAATGATATAATATAGACAGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTGATGATTGGGAAGACGACGAGTCAGAAGATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGACATCTTTTGTAGACTTATACCCAGTGATTGCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTCAACAACAGACGGTTTTACAATTATGTGAGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATTTCGTGCCGGAAAGCTTCGGTAGTGTCATAAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAGATGTCGTGCTGCCCCGCCGCTTTTGGCGGCTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATATTGGGAATCACATGCTTGGTGGTTCGACGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCAAGCTGACGATCATAGTCCACGCCGATGATGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGTCCCTCTCTGCTATACTATCCACAGGGGTGTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGCAGACAGTCCGTTGATTACAGACACGATGCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCCATTGCAGCACTCATGTCCAGCGTTCGGAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATTGCACTTGCTGCAGATGTTCCGGCTATTCTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAGAAGGGCAGATCGTCTTCTCCACTGATTTCTACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGACATCACCGGGGCAATCAAGCGCATGGCTGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAATGGCCCACCAGATTGCAATGCCCACTGAAAGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGACCTCATCAACTGCAACGTGACCGTGCTGCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGTCGGAAATGTGATCGAATAGGGGAAATTCTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGGCTCTTGGATTTTTGCCATTTATAAAGTAATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCCGCCCCATAGAGGGCGGCATTTTTATGCGAAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCACACGTGCCGCAACACATGCTCCGAAAAATGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCATAGCTTTCAGCTTTGGCGAACGGTCAAACACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGTTTACTCTGCGCATCTCAAGCACCCCTTTATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATACCCGGTGCCCTCAGACACCTTGATGAAAGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGCAGACAGTCCGTTGATTACAGACACGATGCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGCAGCGCCAGCACCAGCGCGTCAATGGCAACCGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGAAATTCCAAGAGTGCGGCGGAGTTCGATTGGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACAGACGCTCTTGTATCGCCTGCTCCATCTTATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTTGGATGACGAGGAGCTTGCCGAGGCGGTCGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTCAAAATGTGCCGCTACCCGTCATTATTTCATCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACATCATCATTTGCCCTTTGCACCGCAGATGGGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGGTCAGTGTTTGTTTTGTACGTACCAGATGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATATGTTGCTGTCGTTGCTTGACGTATAGGTGTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGAACAGCTTTCAAAGGCGACCGCGCCGATAATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAGCACCCGCCGTTATACGTTGACGGGTGCTTAAGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATTGAGCAGCACATTTACCCCGTCGTCATGCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTTTCAGTCCCTCGGCGTTCCACATTAAATTTCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTACGGGCTTATGCGAGATTGATGCATACGCGATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCGGTATCAGCACCACTGTTGATCTTAACACAGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATAATCTGTTCGCCATTTGCCTTACAAGTTTGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTGTTGAAGCGACCTATAAGGCACAGCTCGCAGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGACCGACTGGAACGTGAAAAACCGATCGAAGGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGACAGACCACAATTGCCGCGACAATCACCGCAACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAGATTGTAATGCCCACTGAAAGAAATCCTTAACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGTATGCGCGTTGTCATCGTCAAGTAATCAATCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTATCACCGCCTTATAAGATATTATTATATCATACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATATTATATCATTGACACTGTATAATGTCAATACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCAACATTCTTGACCCGAACACGGACGCGAAGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTACATGGGCCTTGGGTCTGTGTCTTTGATTAATAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAACACATACGCCCGCCGGTGGTGTCGGTTATACAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCTTGAAAACCCGCGATGGGCGAATGTTTCTTACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTCAGTGCCGCCGGTGCCGGCCCCCTTGTTCCACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAAATCGTTTCCCGTTTGCCATAACGCCGTTCATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCAGTTGATTTCCGTTCTCGCGCCGAAGGAACTGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATCAGCCAGCCGCTTCCGACGCTGGATCAAAGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCGCATATGGCGCGCAAAATTGTGGATGAAATCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATTAACAGTTTGTTCATAAATGTGGTTTGGAGGGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTGATGGAATTGTCGGACGGCGATGTGAGAAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCTACGGGCGGATTTTTTATGCCTAAAAGGAGCTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTGATGGAATTGTCGGACGGCGATGTGAGAAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTTCCCGTATAGGCTGTATTGGATGCCCTATGGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGGCATTACATGTAAGCGAAATATGCCGCATTATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGTGGGAAAAAATCATGACCGGCAGCTACAATGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTTTGCGGGCTTGAGACCGCCAGTGGCCGCATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGTCACCCAGCGACGCGTCCACCGGCTCCCGGTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGACATCTTTTGTAGACTTATACCCAGTGATTGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGATACCATTGATCGTTATAGTTGTCCGGGGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAAATCCCAGCCGTAGAACTGGTATACGCAAAGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATAAGAGATTTGAAAAGCCCGTGGTTTCGTCCATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTACCGCTTGATCGTGCGTTGTGATGTCTTCACGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTGTATATAAACCCTTTTTGACTACCATAAATCGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGTGCTGCATCCAGCAATACAGGCCCTTATGCTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAATTTTACTTTCATACGTCATACGCCGCCTTGCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCAACCGACGCGATACCTACGCCAACTGGCAGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATTGCCATATAATTATCCTCCTGTTTTTTCAGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGCGCGGTAGTATAATATAGTTACAGGGTAAGCGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTAAATCCGCACTGGATAACAAGCGGCTGGAAATCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGTTACGCCCGGTTCCGATTTAAATGCCAGCGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCAGCGGTTCCGGCGTTACGCCCGGTTCCGATTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAGCAGGTCATTGTAGCTGCTCAGTACTTCCGCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGTTGGTTGCTGTATCCATCCAGCATGCGCTCGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTCATGTAGCTCCATATTTCTTGATACACGCTATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCTTTTGGGCTAACGCATACGCCCTGTACACTAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCCCAGCCGGTGTGTTTCCAGAGCTTGCGGCCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATCGACTTCATTCACGCTGTCCAGACGGCAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCACAAGCCGTCCAGAAGCCCGTACAGGAACCCA
129951 NZ_CP030278.1 Ethanoligenens-harbinense-strain-W1-chromosome Bacteria 674794-693566 18773 283 67 TTTCAATCCA TTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTCCTCCTGGCAAAATTAAAACAGAATATATATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCCCGTCTGATGATGACCGGATGGCTACCGGTCGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGCCGATTCGATAGATTTAAGGCTATCCAGTTTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTCCTCCTGGCAAAATTAAAACAGAATATATATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTTGTCGATGTTTACGTCGGGTTAAGTGTCTATCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGGCACGGGATATTTATGGTCGCATTCGAGGTACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGCGCGTGGGTCTGTCAAACTGCGTAAACAGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTACGCATCAACTTACGAGATATCATGACAAGAGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATACAGGCTTGGATTTGGATAATGTCGCTTCCATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGGATCGTGGCTGACATATGGTGATATCGAGAACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTGTCTGTGGGAATACGTTGCCTTTGATGTTGGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCTGCCGAGCAGGTAGTCTGTTGATGTTTTGAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCACGTGATCGGATGGTTTTATCAGCTGTTTCCTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTGCCCTGGGCGAGATCAAAGAAAACTATGTGACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGATACCCGCCAACATACGATTGGCATTACGTTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCAACTTCCTCCTGCGCTCCGTGAGACTATCTATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACAAGCAGGTGGCGGGATATCTCAACGCCAAGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGCGCTTGGCATGTTGAGTATGCGCGCAGCACAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATATACATTTTGGCGTAGTAACATGAATGATATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCAACACACAACAACGACGACAAAATAATCATATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACCGATTGGGGTATTTTTTTGCTACTGTGTCACAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCGAGGGCCTGACCAGCAGGCCCACACCACACACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCGATCGCGCCGGGCATACTCCCGAGGATTAAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTCAAAATTCGCAATCACATTCGTATGCGTTGGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAGTTGCATAGTATTGCAACACCATTTTAGTAGACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTGGGCATCTGGTTATTTGGTTGTTCGTGCAGGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGATTTTGCCCAATCATTGTGATGTTTGACGCTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATTCTGAAGTCCTTTAGCATGAAAGTTCCCAAAGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATCAAGGTTTCCGCCAATTACCGTTGAATTTGCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATCCCGGCGCAAGGTACACAAGACATCCTGCGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTATCGGATCGCCTATTGACCTTGCCAGCGTACCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTTAATATCCGGAGTGATTTCTCCGGGCTTTGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGGCATCAGCAGCGCTTTTTCCGACGGCTTAGGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCACAGGGGCGCAGGGCTTAGGGCACCGGTGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTATTGGATTCCCCAAATCCTCTATAATTGAACTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCTGGACGCGTTGAAAGCCCGCATCGACCGTATAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATTGGACCGGATGGGTCTCTGGTAGCCTACCTCGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCATGCGTGGTGCCACGGGTATATCACCAACGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACAAAGTATGTAATAAATATAACCATGCATAACAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATTCTGCGATTACGATGTTATGTGCAGAGTTAGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCAATCCAGTCCGTTATTGCCGTATACGCTGATCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCGCACCCAGCGTCAACAGGCAAAGGCACGGTTGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGACAAGTGACATAGATATTATAAGATATCAAGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCGCTACGGCGGCAATCAGGATAACAGCTATTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAACGACAGACAGTTATCCTATGAACGACGTGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTATGACTGTTGATAATCTGAAACGTTATGCTATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTAGCCCAGCGTGCCGCAATGCTATAAAGATAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGTCGGGCACCACGACGAACCGGTGAGCGGATGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGCTACATTGGCTAATATGTATTCTACTGAAATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCACAGGGCAAGGGCAAGTCTACTGTGCTGGCCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGATGGATGCTATTAATACACCAATGGATGTAATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCATAATTTTGACTTCCTTTGCAATAATGTCATGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGATATCCCCGGAAAGCATCGCCGGGGGAATATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGTTTCAGAATTTAAAACAGAGGGGATAGAATGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAATATCAGGCAATCATAACTTCACTTAAATATAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCGGCGTTCGGATGGGTGCCACGGATGGATCGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGAGGAGGTGTGAAAGCATGAGCAATCTTCCTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCACTCTGGATACTGTTGTTGATGATGTACACAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAACGGACACAGTGGGACATGCTACCAATATACCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAGCCTTATCACTCCCGAGCACCGGTATAAGCCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTCCTTTACCGCTACTCCCTGCCGCTTGGATGGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTACACCAGTTATATCACCGAGTATGGCCTTGCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAGGGCCTCGCGGCTATCAGACAAGCTATCCAAACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAAGTATATAACTCCATCTCCGCCACTCCGGGTGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGTGCTGGTTCTTGTCGTCAAGCATATCATTTCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCACCATCTCGCCGCGCTGAGCGCGGTGTATTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCAGCGAGGGATTACAGCTCGGCAGGTGTTCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAAGGATACCGCGTTGTCGTTTACGCCGGGTATCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGACACGCGAAGTAATGACTGGTATACGGAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCAGCGAGGGATTACAGCTCGGCAGGTGTTCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCCCCTCACGCAAGCATCGGCAGAATCGCTTTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTACAGGGCGACACTGTGTTGCAAATCTCGAATTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCAGCGAGGGATTACAGCTCGGCAGGTGTTCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCAGCGAGGGATTACAGCTCGGCAGGTGTTCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGGATTTTCTTGTTTTGGTAGTTGAAGATTTGAGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGTGACCGATGGCCCCAAATGTGATACCGTTTTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGAACCCGCCATTTTCACAAGCAGAGCAATTTATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGATGGCAACCACAACATCGTTGTGCCTTTTACTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACGCAGGGCTGATTATGACCGTATCCACCGAGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTCCGGCGGGACGTTCTACCAGTCTACCACAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTCCACGACAAACCTTTTTTGTCGCAATCAAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGATGCCGGCAACTCGGACAGCGCCACACGTACACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAGCCCGCGTAAAAAAGGCATCCGAACCAGTGACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACACAAAAGATGCCCTGCAATACATCGTTGGGTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGGCAAGTAACGTTCATTTTGCAGAGCCAAAGTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTGCATAGTCCTTGTTTCGACGTGCGCGCTTGGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTCGGCCGAATCTGCAATCATCCAGCTCAAAAGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTAACCCAACGATGTATTCCAGCGCACTTCTTGTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGAGGATGTGTTCGATGGTGCGTCCACCGCTTTCTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGTTCCGTTTTTGTTTAACGCCAGCTGGAATGTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCACGATACAGTGTAAATGATATAATATAGACAGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTGATGATTGGGAAGACGACGAGTCAGAAGATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGACATCTTTTGTAGACTTATACCCAGTGATTGCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTCAACAACAGACGGTTTTACAATTATGTGAGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATTTCGTGCCGGAAAGCTTCGGTAGTGTCATAAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAGATGTCGTGCTGCCCCGCCGCTTTTGGCGGCTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATATTGGGAATCACATGCTTGGTGGTTCGACGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCAAGCTGACGATCATAGTCCACGCCGATGATGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGTCCCTCTCTGCTATACTATCCACAGGGGTGTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGCAGACAGTCCGTTGATTACAGACACGATGCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCCATTGCAGCACTCATGTCCAGCGTTCGGAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATTGCACTTGCTGCAGATGTTCCGGCTATTCTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAGAAGGGCAGATCGTCTTCTCCACTGATTTCTACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGACATCACCGGGGCAATCAAGCGCATGGCTGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAATGGCCCACCAGATTGCAATGCCCACTGAAAGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGACCTCATCAACTGCAACGTGACCGTGCTGCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGTCGGAAATGTGATCGAATAGGGGAAATTCTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGGCTCTTGGATTTTTGCCATTTATAAAGTAATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCCGCCCCATAGAGGGCGGCATTTTTATGCGAAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCACACGTGCCGCAACACATGCTCCGAAAAATGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCATAGCTTTCAGCTTTGGCGAACGGTCAAACACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGTTTACTCTGCGCATCTCAAGCACCCCTTTATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATACCCGGTGCCCTCAGACACCTTGATGAAAGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGCAGACAGTCCGTTGATTACAGACACGATGCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGCAGCGCCAGCACCAGCGCGTCAATGGCAACCGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGAAATTCCAAGAGTGCGGCGGAGTTCGATTGGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACAGACGCTCTTGTATCGCCTGCTCCATCTTATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTTGGATGACGAGGAGCTTGCCGAGGCGGTCGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTCAAAATGTGCCGCTACCCGTCATTATTTCATCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACATCATCATTTGCCCTTTGCACCGCAGATGGGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGGTCAGTGTTTGTTTTGTACGTACCAGATGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATATGTTGCTGTCGTTGCTTGACGTATAGGTGTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGAACAGCTTTCAAAGGCGACCGCGCCGATAATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAGCACCCGCCGTTATACGTTGACGGGTGCTTAAGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATTGAGCAGCACATTTACCCCGTCGTCATGCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTTTCAGTCCCTCGGCGTTCCACATTAAATTTCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTACGGGCTTATGCGAGATTGATGCATACGCGATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCGGTATCAGCACCACTGTTGATCTTAACACAGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATAATCTGTTCGCCATTTGCCTTACAAGTTTGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTGTTGAAGCGACCTATAAGGCACAGCTCGCAGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGACCGACTGGAACGTGAAAAACCGATCGAAGGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGACAGACCACAATTGCCGCGACAATCACCGCAACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAGATTGTAATGCCCACTGAAAGAAATCCTTAACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGTATGCGCGTTGTCATCGTCAAGTAATCAATCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTATCACCGCCTTATAAGATATTATTATATCATACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATATTATATCATTGACACTGTATAATGTCAATACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCAACATTCTTGACCCGAACACGGACGCGAAGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTACATGGGCCTTGGGTCTGTGTCTTTGATTAATAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAACACATACGCCCGCCGGTGGTGTCGGTTATACAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCTTGAAAACCCGCGATGGGCGAATGTTTCTTACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTCAGTGCCGCCGGTGCCGGCCCCCTTGTTCCACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAAATCGTTTCCCGTTTGCCATAACGCCGTTCATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCAGTTGATTTCCGTTCTCGCGCCGAAGGAACTGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATCAGCCAGCCGCTTCCGACGCTGGATCAAAGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCGCATATGGCGCGCAAAATTGTGGATGAAATCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATTAACAGTTTGTTCATAAATGTGGTTTGGAGGGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTGATGGAATTGTCGGACGGCGATGTGAGAAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCTACGGGCGGATTTTTTATGCCTAAAAGGAGCTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTGATGGAATTGTCGGACGGCGATGTGAGAAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTTCCCGTATAGGCTGTATTGGATGCCCTATGGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGGCATTACATGTAAGCGAAATATGCCGCATTATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGTGGGAAAAAATCATGACCGGCAGCTACAATGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTTTGCGGGCTTGAGACCGCCAGTGGCCGCATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGTCACCCAGCGACGCGTCCACCGGCTCCCGGTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGACATCTTTTGTAGACTTATACCCAGTGATTGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGATACCATTGATCGTTATAGTTGTCCGGGGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAAATCCCAGCCGTAGAACTGGTATACGCAAAGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATAAGAGATTTGAAAAGCCCGTGGTTTCGTCCATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTACCGCTTGATCGTGCGTTGTGATGTCTTCACGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTGTATATAAACCCTTTTTGACTACCATAAATCGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGTGCTGCATCCAGCAATACAGGCCCTTATGCTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAATTTTACTTTCATACGTCATACGCCGCCTTGCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCAACCGACGCGATACCTACGCCAACTGGCAGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATTGCCATATAATTATCCTCCTGTTTTTTCAGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGCGCGGTAGTATAATATAGTTACAGGGTAAGCGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTAAATCCGCACTGGATAACAAGCGGCTGGAAATCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGTTACGCCCGGTTCCGATTTAAATGCCAGCGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCAGCGGTTCCGGCGTTACGCCCGGTTCCGATTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAGCAGGTCATTGTAGCTGCTCAGTACTTCCGCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGTTGGTTGCTGTATCCATCCAGCATGCGCTCGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTCATGTAGCTCCATATTTCTTGATACACGCTATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCTTTTGGGCTAACGCATACGCCCTGTACACTAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCCCAGCCGGTGTGTTTCCAGAGCTTGCGGCCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATCGACTTCATTCACGCTGTCCAGACGGCAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCACAAGCCGTCCAGAAGCCCGTACAGGAACCCA
114069 NZ_CP025288.1 Ethanoligenens-harbinense-strain-X-29-chromosome Bacteria 674783-693555 18773 283 67 TTTCAATCCA TTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTCCTCCTGGCAAAATTAAAACAGAATATATATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCCCGTCTGATGATGACCGGATGGCTACCGGTCGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGCCGATTCGATAGATTTAAGGCTATCCAGTTTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTCCTCCTGGCAAAATTAAAACAGAATATATATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTTGTCGATGTTTACGTCGGGTTAAGTGTCTATCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGGCACGGGATATTTATGGTCGCATTCGAGGTACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGCGCGTGGGTCTGTCAAACTGCGTAAACAGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTACGCATCAACTTACGAGATATCATGACAAGAGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATACAGGCTTGGATTTGGATAATGTCGCTTCCATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGGATCGTGGCTGACATATGGTGATATCGAGAACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTGTCTGTGGGAATACGTTGCCTTTGATGTTGGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCTGCCGAGCAGGTAGTCTGTTGATGTTTTGAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCACGTGATCGGATGGTTTTATCAGCTGTTTCCTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTGCCCTGGGCGAGATCAAAGAAAACTATGTGACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGATACCCGCCAACATACGATTGGCATTACGTTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCAACTTCCTCCTGCGCTCCGTGAGACTATCTATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACAAGCAGGTGGCGGGATATCTCAACGCCAAGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGCGCTTGGCATGTTGAGTATGCGCGCAGCACAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATATACATTTTGGCGTAGTAACATGAATGATATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCAACACACAACAACGACGACAAAATAATCATATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACCGATTGGGGTATTTTTTTGCTACTGTGTCACAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCGAGGGCCTGACCAGCAGGCCCACACCACACACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCGATCGCGCCGGGCATACTCCCGAGGATTAAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTCAAAATTCGCAATCACATTCGTATGCGTTGGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAGTTGCATAGTATTGCAACACCATTTTAGTAGACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTGGGCATCTGGTTATTTGGTTGTTCGTGCAGGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGATTTTGCCCAATCATTGTGATGTTTGACGCTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATTCTGAAGTCCTTTAGCATGAAAGTTCCCAAAGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATCAAGGTTTCCGCCAATTACCGTTGAATTTGCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATCCCGGCGCAAGGTACACAAGACATCCTGCGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTATCGGATCGCCTATTGACCTTGCCAGCGTACCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTTAATATCCGGAGTGATTTCTCCGGGCTTTGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGGCATCAGCAGCGCTTTTTCCGACGGCTTAGGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCACAGGGGCGCAGGGCTTAGGGCACCGGTGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTATTGGATTCCCCAAATCCTCTATAATTGAACTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCTGGACGCGTTGAAAGCCCGCATCGACCGTATAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATTGGACCGGATGGGTCTCTGGTAGCCTACCTCGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCATGCGTGGTGCCACGGGTATATCACCAACGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACAAAGTATGTAATAAATATAACCATGCATAACAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATTCTGCGATTACGATGTTATGTGCAGAGTTAGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCAATCCAGTCCGTTATTGCCGTATACGCTGATCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCGCACCCAGCGTCAACAGGCAAAGGCACGGTTGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGACAAGTGACATAGATATTATAAGATATCAAGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCGCTACGGCGGCAATCAGGATAACAGCTATTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAACGACAGACAGTTATCCTATGAACGACGTGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTATGACTGTTGATAATCTGAAACGTTATGCTATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTAGCCCAGCGTGCCGCAATGCTATAAAGATAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGTCGGGCACCACGACGAACCGGTGAGCGGATGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGCTACATTGGCTAATATGTATTCTACTGAAATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCACAGGGCAAGGGCAAGTCTACTGTGCTGGCCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGATGGATGCTATTAATACACCAATGGATGTAATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCATAATTTTGACTTCCTTTGCAATAATGTCATGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGATATCCCCGGAAAGCATCGCCGGGGGAATATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGTTTCAGAATTTAAAACAGAGGGGATAGAATGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAATATCAGGCAATCATAACTTCACTTAAATATAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCGGCGTTCGGATGGGTGCCACGGATGGATCGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGAGGAGGTGTGAAAGCATGAGCAATCTTCCTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCACTCTGGATACTGTTGTTGATGATGTACACAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAACGGACACAGTGGGACATGCTACCAATATACCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAGCCTTATCACTCCCGAGCACCGGTATAAGCCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTCCTTTACCGCTACTCCCTGCCGCTTGGATGGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTACACCAGTTATATCACCGAGTATGGCCTTGCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAGGGCCTCGCGGCTATCAGACAAGCTATCCAAACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAAGTATATAACTCCATCTCCGCCACTCCGGGTGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGTGCTGGTTCTTGTCGTCAAGCATATCATTTCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCACCATCTCGCCGCGCTGAGCGCGGTGTATTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCAGCGAGGGATTACAGCTCGGCAGGTGTTCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAAGGATACCGCGTTGTCGTTTACGCCGGGTATCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGACACGCGAAGTAATGACTGGTATACGGAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCAGCGAGGGATTACAGCTCGGCAGGTGTTCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCCCCTCACGCAAGCATCGGCAGAATCGCTTTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTACAGGGCGACACTGTGTTGCAAATCTCGAATTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCAGCGAGGGATTACAGCTCGGCAGGTGTTCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCAGCGAGGGATTACAGCTCGGCAGGTGTTCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGGATTTTCTTGTTTTGGTAGTTGAAGATTTGAGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGTGACCGATGGCCCCAAATGTGATACCGTTTTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGAACCCGCCATTTTCACAAGCAGAGCAATTTATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGATGGCAACCACAACATCGTTGTGCCTTTTACTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACGCAGGGCTGATTATGACCGTATCCACCGAGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTCCGGCGGGACGTTCTACCAGTCTACCACAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTCCACGACAAACCTTTTTTGTCGCAATCAAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGATGCCGGCAACTCGGACAGCGCCACACGTACACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAGCCCGCGTAAAAAAGGCATCCGAACCAGTGACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACACAAAAGATGCCCTGCAATACATCGTTGGGTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGGCAAGTAACGTTCATTTTGCAGAGCCAAAGTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTGCATAGTCCTTGTTTCGACGTGCGCGCTTGGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTCGGCCGAATCTGCAATCATCCAGCTCAAAAGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTAACCCAACGATGTATTCCAGCGCACTTCTTGTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGAGGATGTGTTCGATGGTGCGTCCACCGCTTTCTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGTTCCGTTTTTGTTTAACGCCAGCTGGAATGTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCACGATACAGTGTAAATGATATAATATAGACAGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTGATGATTGGGAAGACGACGAGTCAGAAGATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGACATCTTTTGTAGACTTATACCCAGTGATTGCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTCAACAACAGACGGTTTTACAATTATGTGAGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATTTCGTGCCGGAAAGCTTCGGTAGTGTCATAAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAGATGTCGTGCTGCCCCGCCGCTTTTGGCGGCTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATATTGGGAATCACATGCTTGGTGGTTCGACGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCAAGCTGACGATCATAGTCCACGCCGATGATGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGTCCCTCTCTGCTATACTATCCACAGGGGTGTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGCAGACAGTCCGTTGATTACAGACACGATGCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCCATTGCAGCACTCATGTCCAGCGTTCGGAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATTGCACTTGCTGCAGATGTTCCGGCTATTCTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAGAAGGGCAGATCGTCTTCTCCACTGATTTCTACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGACATCACCGGGGCAATCAAGCGCATGGCTGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAATGGCCCACCAGATTGCAATGCCCACTGAAAGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGACCTCATCAACTGCAACGTGACCGTGCTGCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGTCGGAAATGTGATCGAATAGGGGAAATTCTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGGCTCTTGGATTTTTGCCATTTATAAAGTAATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCCGCCCCATAGAGGGCGGCATTTTTATGCGAAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCACACGTGCCGCAACACATGCTCCGAAAAATGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCATAGCTTTCAGCTTTGGCGAACGGTCAAACACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGTTTACTCTGCGCATCTCAAGCACCCCTTTATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATACCCGGTGCCCTCAGACACCTTGATGAAAGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGCAGACAGTCCGTTGATTACAGACACGATGCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGCAGCGCCAGCACCAGCGCGTCAATGGCAACCGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGAAATTCCAAGAGTGCGGCGGAGTTCGATTGGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACAGACGCTCTTGTATCGCCTGCTCCATCTTATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTTGGATGACGAGGAGCTTGCCGAGGCGGTCGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTCAAAATGTGCCGCTACCCGTCATTATTTCATCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACATCATCATTTGCCCTTTGCACCGCAGATGGGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGGTCAGTGTTTGTTTTGTACGTACCAGATGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATATGTTGCTGTCGTTGCTTGACGTATAGGTGTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGAACAGCTTTCAAAGGCGACCGCGCCGATAATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAGCACCCGCCGTTATACGTTGACGGGTGCTTAAGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATTGAGCAGCACATTTACCCCGTCGTCATGCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTTTCAGTCCCTCGGCGTTCCACATTAAATTTCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTACGGGCTTATGCGAGATTGATGCATACGCGATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCGGTATCAGCACCACTGTTGATCTTAACACAGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATAATCTGTTCGCCATTTGCCTTACAAGTTTGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTGTTGAAGCGACCTATAAGGCACAGCTCGCAGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGACCGACTGGAACGTGAAAAACCGATCGAAGGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGACAGACCACAATTGCCGCGACAATCACCGCAACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAGATTGTAATGCCCACTGAAAGAAATCCTTAACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGTATGCGCGTTGTCATCGTCAAGTAATCAATCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTATCACCGCCTTATAAGATATTATTATATCATACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATATTATATCATTGACACTGTATAATGTCAATACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCAACATTCTTGACCCGAACACGGACGCGAAGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTACATGGGCCTTGGGTCTGTGTCTTTGATTAATAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAACACATACGCCCGCCGGTGGTGTCGGTTATACAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCTTGAAAACCCGCGATGGGCGAATGTTTCTTACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTCAGTGCCGCCGGTGCCGGCCCCCTTGTTCCACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAAATCGTTTCCCGTTTGCCATAACGCCGTTCATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCAGTTGATTTCCGTTCTCGCGCCGAAGGAACTGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATCAGCCAGCCGCTTCCGACGCTGGATCAAAGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCGCATATGGCGCGCAAAATTGTGGATGAAATCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATTAACAGTTTGTTCATAAATGTGGTTTGGAGGGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTGATGGAATTGTCGGACGGCGATGTGAGAAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCTACGGGCGGATTTTTTATGCCTAAAAGGAGCTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTGATGGAATTGTCGGACGGCGATGTGAGAAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTTCCCGTATAGGCTGTATTGGATGCCCTATGGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGGCATTACATGTAAGCGAAATATGCCGCATTATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGTGGGAAAAAATCATGACCGGCAGCTACAATGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTTTGCGGGCTTGAGACCGCCAGTGGCCGCATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGTCACCCAGCGACGCGTCCACCGGCTCCCGGTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGACATCTTTTGTAGACTTATACCCAGTGATTGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGATACCATTGATCGTTATAGTTGTCCGGGGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAAATCCCAGCCGTAGAACTGGTATACGCAAAGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATAAGAGATTTGAAAAGCCCGTGGTTTCGTCCATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTACCGCTTGATCGTGCGTTGTGATGTCTTCACGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTGTATATAAACCCTTTTTGACTACCATAAATCGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGTGCTGCATCCAGCAATACAGGCCCTTATGCTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAATTTTACTTTCATACGTCATACGCCGCCTTGCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCAACCGACGCGATACCTACGCCAACTGGCAGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATTGCCATATAATTATCCTCCTGTTTTTTCAGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGCGCGGTAGTATAATATAGTTACAGGGTAAGCGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTAAATCCGCACTGGATAACAAGCGGCTGGAAATCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGTTACGCCCGGTTCCGATTTAAATGCCAGCGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCAGCGGTTCCGGCGTTACGCCCGGTTCCGATTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAGCAGGTCATTGTAGCTGCTCAGTACTTCCGCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGTTGGTTGCTGTATCCATCCAGCATGCGCTCGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTCATGTAGCTCCATATTTCTTGATACACGCTATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCTTTTGGGCTAACGCATACGCCCTGTACACTAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCCCAGCCGGTGTGTTTCCAGAGCTTGCGGCCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATCGACTTCATTCACGCTGTCCAGACGGCAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCACAAGCCGTCCAGAAGCCCGTACAGGAACCCA
19109 NC_014828.1 Ethanoligenens-harbinense-YUAN-3 Bacteria 674782-693553 18772 283 67 TTTCAATCCA TTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTCCTCCTGGCAAAATTAAAACAGAATATATATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCCCGTCTGATGATGACCGGATGGCTACCGGTCGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGCCGATTCGATAGATTTAAGGCTATCCAGTTTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTCCTCCTGGCAAAATTAAAACAGAATATATATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTTGTCGATGTTTACGTCGGGTTAAGTGTCTATCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGGCACGGGATATTTATGGTCGCATTCGAGGTACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGCGCGTGGGTCTGTCAAACTGCGTAAACAGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTACGCATCAACTTACGAGATATCATGACAAGAGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATACAGGCTTGGATTTGGATAATGTCGCTTCCATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGGATCGTGGCTGACATATGGTGATATCGAGAACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTGTCTGTGGGAATACGTTGCCTTTGATGTTGGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCTGCCGAGCAGGTAGTCTGTTGATGTTTTGAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCACGTGATCGGATGGTTTTATCAGCTGTTTCCTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTGCCCTGGGCGAGATCAAAGAAAACTATGTGACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGATACCCGCCAACATACGATTGGCATTACGTTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCAACTTCCTCCTGCGCTCCGTGAGACTATCTATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACAAGCAGGTGGCGGGATATCTCAACGCCAAGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGCGCTTGGCATGTTGAGTATGCGCGCAGCACAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATATACATTTTGGCGTAGTAACATGAATGATATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCAACACACAACAACGACGACAAAATAATCATATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACCGATTGGGGTATTTTTTTGCTACTGTGTCACAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCGAGGGCCTGACCAGCAGGCCCACACCACACACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCGATCGCGCCGGGCATACTCCCGAGGATTAAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTCAAAATTCGCAATCACATTCGTATGCGTTGGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAGTTGCATAGTATTGCAACACCATTTTAGTAGACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTGGGCATCTGGTTATTTGGTTGTTCGTGCAGGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGATTTTGCCCAATCATTGTGATGTTTGACGCTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATTCTGAAGTCCTTTAGCATGAAAGTTCCCAAAGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATCAAGGTTTCCGCCAATTACCGTTGAATTTGCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATCCCGGCGCAAGGTACACAAGACATCCTGCGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTATCGGATCGCCTATTGACCTTGCCAGCGTACCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTTAATATCCGGAGTGATTTCTCCGGGCTTTGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGGCATCAGCAGCGCTTTTTCCGACGGCTTAGGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCACAGGGGCGCAGGGCTTAGGGCACCGGTGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTATTGGATTCCCCAAATCCTCTATAATTGAACTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCTGGACGCGTTGAAAGCCCGCATCGACCGTATAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATTGGACCGGATGGGTCTCTGGTAGCCTACCTCGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCATGCGTGGTGCCACGGGTATATCACCAACGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACAAAGTATGTAATAAATATAACCATGCATAACAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATTCTGCGATTACGATGTTATGTGCAGAGTTAGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCAATCCAGTCCGTTATTGCCGTATACGCTGATCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCGCACCCAGCGTCAACAGGCAAAGGCACGGTTGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGACAAGTGACATAGATATTATAAGATATCAAGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCGCTACGGCGGCAATCAGGATAACAGCTATTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAACGACAGACAGTTATCCTATGAACGACGTGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTATGACTGTTGATAATCTGAAACGTTATGCTATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTAGCCCAGCGTGCCGCAATGCTATAAAGATAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGTCGGGCACCACGACGAACCGGTGAGCGGATGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGCTACATTGGCTAATATGTATTCTACTGAAATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCACAGGGCAAGGGCAAGTCTACTGTGCTGGCCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGATGGATGCTATTAATACACCAATGGATGTAATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCATAATTTTGACTTCCTTTGCAATAATGTCATGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGATATCCCCGGAAAGCATCGCCGGGGGAATATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGTTTCAGAATTTAAAACAGAGGGGATAGAATGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAATATCAGGCAATCATAACTTCACTTAAATATAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCGGCGTTCGGATGGGTGCCACGGATGGATCGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGAGGAGGTGTGAAAGCATGAGCAATCTTCCTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCACTCTGGATACTGTTGTTGATGATGTACACAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAACGGACACAGTGGGACATGCTACCAATATACCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAGCCTTATCACTCCCGAGCACCGGTATAAGCCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTCCTTTACCGCTACTCCCTGCCGCTTGGATGGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTACACCAGTTATATCACCGAGTATGGCCTTGCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAGGGCCTCGCGGCTATCAGACAAGCTATCCAAACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAAGTATATAACTCCATCTCCGCCACTCCGGGTGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGTGCTGGTTCTTGTCGTCAAGCATATCATTTCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCACCATCTCGCCGCGCTGAGCGCGGTGTATTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCAGCGAGGGATTACAGCTCGGCAGGTGTTCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAAGGATACCGCGTTGTCGTTTACGCCGGGTATCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGACACGCGAAGTAATGACTGGTATACGGAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCAGCGAGGGATTACAGCTCGGCAGGTGTTCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCCCCTCACGCAAGCATCGGCAGAATCGCTTTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTACAGGGCGACACTGTGTTGCAAATCTCGAATTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCAGCGAGGGATTACAGCTCGGCAGGTGTTCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCAGCGAGGGATTACAGCTCGGCAGGTGTTCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGGATTTTCTTGTTTTGGTAGTTGAAGATTTGAGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGTGACCGATGGCCCCAAATGTGATACCGTTTTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGAACCCGCCATTTTCACAAGCAGAGCAATTTATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGATGGCAACCACAACATCGTTGTGCCTTTTACTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACGCAGGGCTGATTATGACCGTATCCACCGAGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTCCGGCGGGACGTTCTACCAGTCTACCACAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTCCACGACAAACCTTTTTTGTCGCAATCAAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGATGCCGGCAACTCGGACAGCGCCACACGTACACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAGCCCGCGTAAAAAAGGCATCCGAACCAGTGACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACACAAAAGATGCCCTGCAATACATCGTTGGGTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGGCAAGTAACGTTCATTTTGCAGAGCCAAAGTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTGCATAGTCCTTGTTTCGACGTGCGCGCTTGGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTCGGCCGAATCTGCAATCATCCAGCTCAAAAGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTAACCCAACGATGTATTCCAGCGCACTTCTTGTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGAGGATGTGTTCGATGGTGCGTCCACCGCTTTCTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGTTCCGTTTTTGTTTAACGCCAGCTGGAATGTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCACGATACAGTGTAAATGATATAATATAGACAGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTGATGATTGGGAAGACGACGAGTCAGAAGATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGACATCTTTTGTAGACTTATACCCAGTGATTGCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTCAACAACAGACGGTTTTACAATTATGTGAGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATTTCGTGCCGGAAAGCTTCGGTAGTGTCATAAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAGATGTCGTGCTGCCCCGCCGCTTTTGGCGGCTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATATTGGGAATCACATGCTTGGTGGTTCGACGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCAAGCTGACGATCATAGTCCACGCCGATGATGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGTCCCTCTCTGCTATACTATCCACAGGGGTGTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGCAGACAGTCCGTTGATTACAGACACGATGCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCCATTGCAGCACTCATGTCCAGCGTTCGGAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATTGCACTTGCTGCAGATGTTCCGGCTATTCTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAGAAGGGCAGATCGTCTTCTCCACTGATTTCTACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGACATCACCGGGGCAATCAAGCGCATGGCTGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAATGGCCCACCAGATTGCAATGCCCACTGAAAGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGACCTCATCAACTGCAACGTGACCGTGCTGCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGTCGGAAATGTGATCGAATAGGGGAAATTCTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGGCTCTTGGATTTTTGCCATTTATAAAGTAATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCCGCCCCATAGAGGGCGGCATTTTTATGCGAAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCACACGTGCCGCAACACATGCTCCGAAAAATGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCATAGCTTTCAGCTTTGGCGAACGGTCAAACACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGTTTACTCTGCGCATCTCAAGCACCCCTTTATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATACCCGGTGCCCTCAGACACCTTGATGAAAGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGCAGACAGTCCGTTGATTACAGACACGATGCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGCAGCGCCAGCACCAGCGCGTCAATGGCAACCGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGAAATTCCAAGAGTGCGGCGGAGTTCGATTGGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACAGACGCTCTTGTATCGCCTGCTCCATCTTATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTTGGATGACGAGGAGCTTGCCGAGGCGGTCGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTCAAAATGTGCCGCTACCCGTCATTATTTCATCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACATCATCATTTGCCCTTTGCACCGCAGATGGGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGGTCAGTGTTTGTTTTGTACGTACCAGATGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATATGTTGCTGTCGTTGCTTGACGTATAGGTGTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGAACAGCTTTCAAAGGCGACCGCGCCGATAATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAGCACCCGCCGTTATACGTTGACGGGTGCTTAAGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATTGAGCAGCACATTTACCCCGTCGTCATGCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTTTCAGTCCCTCGGCGTTCCACATTAAATTTCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTACGGGCTTATGCGAGATTGATGCATACGCGATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCGGTATCAGCACCACTGTTGATCTTAACACAGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATAATCTGTTCGCCATTTGCCTTACAAGTTTGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTGTTGAAGCGACCTATAAGGCACAGCTCGCAGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGACCGACTGGAACGTGAAAAACCGATCGAAGGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGACAGACCACAATTGCCGCGACAATCACCGCAACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAGATTGTAATGCCCACTGAAAGAAATCCTTAACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGTATGCGCGTTGTCATCGTCAAGTAATCAATCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTATCACCGCCTTATAAGATATTATTATATCATACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATATTATATCATTGACACTGTATAATGTCAATACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCAACATTCTTGACCCGAACACGGACGCGAAGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCAACATTCTTGACCCGAACACGGACGCGAAGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTACATGGGCCTTGGGTCTGTGTCTTTGATTAATAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAACACATACGCCCGCCGGTGGTGTCGGTTATACAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCTTGAAAACCCGCGATGGGCGAATGTTTCTTACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTCAGTGCCGCCGGTGCCGGCCCCCTTGTTCCACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAAATCGTTTCCCGTTTGCCATAACGCCGTTCATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCAGTTGATTTCCGTTCTCGCGCCGAAGGAACTGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATCAGCCAGCCGCTTCCGACGCTGGATCAAAGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCGCATATGGCGCGCAAAATTGTGGATGAAATCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATTAACAGTTTGTTCATAAATGTGGTTTGGAGGGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTGATGGAATTGTCGGACGGCGATGTGAGAAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCTACGGGCGGATTTTTTATGCCTAAAAGGAGCTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTGATGGAATTGTCGGACGGCGATGTGAGAAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTTCCCGTATAGGCTGTATTGGATGCCCTATGGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGGCATTACATGTAAGCGAAATATGCCGCATTATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGTGGGAAAAAATCATGACCGGCAGCTACAATGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTTTGCGGGCTTGAGACCGCCAGTGGCCGCATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGTCACCCAGCGACGCGTCCACCGGCTCCCGGTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGACATCTTTTGTAGACTTATACCCAGTGATTGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGATACCATTGATCGTTATAGTTGTCCGGGGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAAATCCCAGCCGTAGAACTGGTATACGCAAAGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATAAGAGATTTGAAAAGCCCGTGGTTTCGTCCATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTACCGCTTGATCGTGCGTTGTGATGTCTTCACGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTGTATATAAACCCTTTTTGACTACCATAAATCGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGTGCTGCATCCAGCAATACAGGCCCTTATGCTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAATTTTACTTTCATACGTCATACGCCGCCTTGCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCAACCGACGCGATACCTACGCCAACTGGCAGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATTGCCATATAATTATCCTCCTGTTTTTTCAGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGCGCGGTAGTATAATATAGTTACAGGGTAAGCGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTAAATCCGCACTGGATAACAAGCGGCTGGAAATCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGTTACGCCCGGTTCCGATTTAAATGCCAGCGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCAGCGGTTCCGGCGTTACGCCCGGTTCCGATTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAGCAGGTCATTGTAGCTGCTCAGTACTTCCGCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGTTGGTTGCTGTATCCATCCAGCATGCGCTCGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTCATGTAGCTCCATATTTCTTGATACACGCTATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCTTTTGGGCTAACGCATACGCCCTGTACACTAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCCCAGCCGGTGTGTTTCCAGAGCTTGCGGCCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATCGACTTCATTCACGCTGTCCAGACGGCAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCACAAGCCGTCCAGAAGCCCGTACAGGAACCCA
114055 NZ_CP025286.1 Ethanoligenens-harbinense-YUAN-3-chromosome Bacteria 674795-693567 18773 283 67 TTTCAATCCA TTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTCCTCCTGGCAAAATTAAAACAGAATATATATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCCCGTCTGATGATGACCGGATGGCTACCGGTCGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGCCGATTCGATAGATTTAAGGCTATCCAGTTTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTCCTCCTGGCAAAATTAAAACAGAATATATATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTTGTCGATGTTTACGTCGGGTTAAGTGTCTATCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGGCACGGGATATTTATGGTCGCATTCGAGGTACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGCGCGTGGGTCTGTCAAACTGCGTAAACAGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTACGCATCAACTTACGAGATATCATGACAAGAGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATACAGGCTTGGATTTGGATAATGTCGCTTCCATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGGATCGTGGCTGACATATGGTGATATCGAGAACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTGTCTGTGGGAATACGTTGCCTTTGATGTTGGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCTGCCGAGCAGGTAGTCTGTTGATGTTTTGAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCACGTGATCGGATGGTTTTATCAGCTGTTTCCTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTGCCCTGGGCGAGATCAAAGAAAACTATGTGACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGATACCCGCCAACATACGATTGGCATTACGTTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCAACTTCCTCCTGCGCTCCGTGAGACTATCTATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACAAGCAGGTGGCGGGATATCTCAACGCCAAGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGCGCTTGGCATGTTGAGTATGCGCGCAGCACAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATATACATTTTGGCGTAGTAACATGAATGATATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCAACACACAACAACGACGACAAAATAATCATATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACCGATTGGGGTATTTTTTTGCTACTGTGTCACAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCGAGGGCCTGACCAGCAGGCCCACACCACACACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCGATCGCGCCGGGCATACTCCCGAGGATTAAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTCAAAATTCGCAATCACATTCGTATGCGTTGGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAGTTGCATAGTATTGCAACACCATTTTAGTAGACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTGGGCATCTGGTTATTTGGTTGTTCGTGCAGGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGATTTTGCCCAATCATTGTGATGTTTGACGCTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATTCTGAAGTCCTTTAGCATGAAAGTTCCCAAAGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATCAAGGTTTCCGCCAATTACCGTTGAATTTGCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATCCCGGCGCAAGGTACACAAGACATCCTGCGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTATCGGATCGCCTATTGACCTTGCCAGCGTACCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTTAATATCCGGAGTGATTTCTCCGGGCTTTGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGGCATCAGCAGCGCTTTTTCCGACGGCTTAGGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCACAGGGGCGCAGGGCTTAGGGCACCGGTGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTATTGGATTCCCCAAATCCTCTATAATTGAACTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCTGGACGCGTTGAAAGCCCGCATCGACCGTATAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATTGGACCGGATGGGTCTCTGGTAGCCTACCTCGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCATGCGTGGTGCCACGGGTATATCACCAACGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACAAAGTATGTAATAAATATAACCATGCATAACAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATTCTGCGATTACGATGTTATGTGCAGAGTTAGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCAATCCAGTCCGTTATTGCCGTATACGCTGATCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCGCACCCAGCGTCAACAGGCAAAGGCACGGTTGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGACAAGTGACATAGATATTATAAGATATCAAGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCGCTACGGCGGCAATCAGGATAACAGCTATTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAACGACAGACAGTTATCCTATGAACGACGTGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTATGACTGTTGATAATCTGAAACGTTATGCTATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTAGCCCAGCGTGCCGCAATGCTATAAAGATAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGTCGGGCACCACGACGAACCGGTGAGCGGATGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGCTACATTGGCTAATATGTATTCTACTGAAATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCACAGGGCAAGGGCAAGTCTACTGTGCTGGCCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGATGGATGCTATTAATACACCAATGGATGTAATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCATAATTTTGACTTCCTTTGCAATAATGTCATGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGATATCCCCGGAAAGCATCGCCGGGGGAATATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGTTTCAGAATTTAAAACAGAGGGGATAGAATGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAATATCAGGCAATCATAACTTCACTTAAATATAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCGGCGTTCGGATGGGTGCCACGGATGGATCGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGAGGAGGTGTGAAAGCATGAGCAATCTTCCTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCACTCTGGATACTGTTGTTGATGATGTACACAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAACGGACACAGTGGGACATGCTACCAATATACCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAGCCTTATCACTCCCGAGCACCGGTATAAGCCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTCCTTTACCGCTACTCCCTGCCGCTTGGATGGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTACACCAGTTATATCACCGAGTATGGCCTTGCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAGGGCCTCGCGGCTATCAGACAAGCTATCCAAACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAAGTATATAACTCCATCTCCGCCACTCCGGGTGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGTGCTGGTTCTTGTCGTCAAGCATATCATTTCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCACCATCTCGCCGCGCTGAGCGCGGTGTATTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCAGCGAGGGATTACAGCTCGGCAGGTGTTCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAAGGATACCGCGTTGTCGTTTACGCCGGGTATCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGACACGCGAAGTAATGACTGGTATACGGAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCAGCGAGGGATTACAGCTCGGCAGGTGTTCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCCCCTCACGCAAGCATCGGCAGAATCGCTTTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTACAGGGCGACACTGTGTTGCAAATCTCGAATTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCAGCGAGGGATTACAGCTCGGCAGGTGTTCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCAGCGAGGGATTACAGCTCGGCAGGTGTTCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGGATTTTCTTGTTTTGGTAGTTGAAGATTTGAGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGTGACCGATGGCCCCAAATGTGATACCGTTTTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGAACCCGCCATTTTCACAAGCAGAGCAATTTATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGATGGCAACCACAACATCGTTGTGCCTTTTACTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACGCAGGGCTGATTATGACCGTATCCACCGAGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTCCGGCGGGACGTTCTACCAGTCTACCACAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTCCACGACAAACCTTTTTTGTCGCAATCAAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGATGCCGGCAACTCGGACAGCGCCACACGTACACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAGCCCGCGTAAAAAAGGCATCCGAACCAGTGACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACACAAAAGATGCCCTGCAATACATCGTTGGGTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGGCAAGTAACGTTCATTTTGCAGAGCCAAAGTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTGCATAGTCCTTGTTTCGACGTGCGCGCTTGGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTCGGCCGAATCTGCAATCATCCAGCTCAAAAGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTAACCCAACGATGTATTCCAGCGCACTTCTTGTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGAGGATGTGTTCGATGGTGCGTCCACCGCTTTCTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGTTCCGTTTTTGTTTAACGCCAGCTGGAATGTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCACGATACAGTGTAAATGATATAATATAGACAGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTGATGATTGGGAAGACGACGAGTCAGAAGATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGACATCTTTTGTAGACTTATACCCAGTGATTGCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTCAACAACAGACGGTTTTACAATTATGTGAGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATTTCGTGCCGGAAAGCTTCGGTAGTGTCATAAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAGATGTCGTGCTGCCCCGCCGCTTTTGGCGGCTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATATTGGGAATCACATGCTTGGTGGTTCGACGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCAAGCTGACGATCATAGTCCACGCCGATGATGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGTCCCTCTCTGCTATACTATCCACAGGGGTGTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGCAGACAGTCCGTTGATTACAGACACGATGCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCCATTGCAGCACTCATGTCCAGCGTTCGGAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATTGCACTTGCTGCAGATGTTCCGGCTATTCTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAGAAGGGCAGATCGTCTTCTCCACTGATTTCTACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGACATCACCGGGGCAATCAAGCGCATGGCTGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAATGGCCCACCAGATTGCAATGCCCACTGAAAGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGACCTCATCAACTGCAACGTGACCGTGCTGCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGTCGGAAATGTGATCGAATAGGGGAAATTCTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGGCTCTTGGATTTTTGCCATTTATAAAGTAATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCCGCCCCATAGAGGGCGGCATTTTTATGCGAAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCACACGTGCCGCAACACATGCTCCGAAAAATGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCATAGCTTTCAGCTTTGGCGAACGGTCAAACACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGTTTACTCTGCGCATCTCAAGCACCCCTTTATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATACCCGGTGCCCTCAGACACCTTGATGAAAGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGCAGACAGTCCGTTGATTACAGACACGATGCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGCAGCGCCAGCACCAGCGCGTCAATGGCAACCGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGAAATTCCAAGAGTGCGGCGGAGTTCGATTGGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACAGACGCTCTTGTATCGCCTGCTCCATCTTATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTTGGATGACGAGGAGCTTGCCGAGGCGGTCGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTCAAAATGTGCCGCTACCCGTCATTATTTCATCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACATCATCATTTGCCCTTTGCACCGCAGATGGGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGGTCAGTGTTTGTTTTGTACGTACCAGATGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATATGTTGCTGTCGTTGCTTGACGTATAGGTGTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGAACAGCTTTCAAAGGCGACCGCGCCGATAATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAGCACCCGCCGTTATACGTTGACGGGTGCTTAAGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATTGAGCAGCACATTTACCCCGTCGTCATGCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTTTCAGTCCCTCGGCGTTCCACATTAAATTTCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTACGGGCTTATGCGAGATTGATGCATACGCGATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCGGTATCAGCACCACTGTTGATCTTAACACAGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATAATCTGTTCGCCATTTGCCTTACAAGTTTGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTGTTGAAGCGACCTATAAGGCACAGCTCGCAGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGACCGACTGGAACGTGAAAAACCGATCGAAGGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGACAGACCACAATTGCCGCGACAATCACCGCAACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAGATTGTAATGCCCACTGAAAGAAATCCTTAACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGTATGCGCGTTGTCATCGTCAAGTAATCAATCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTATCACCGCCTTATAAGATATTATTATATCATACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATATTATATCATTGACACTGTATAATGTCAATACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCAACATTCTTGACCCGAACACGGACGCGAAGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTACATGGGCCTTGGGTCTGTGTCTTTGATTAATAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAACACATACGCCCGCCGGTGGTGTCGGTTATACAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCTTGAAAACCCGCGATGGGCGAATGTTTCTTACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTCAGTGCCGCCGGTGCCGGCCCCCTTGTTCCACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAAATCGTTTCCCGTTTGCCATAACGCCGTTCATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCAGTTGATTTCCGTTCTCGCGCCGAAGGAACTGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATCAGCCAGCCGCTTCCGACGCTGGATCAAAGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCGCATATGGCGCGCAAAATTGTGGATGAAATCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATTAACAGTTTGTTCATAAATGTGGTTTGGAGGGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTGATGGAATTGTCGGACGGCGATGTGAGAAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCTACGGGCGGATTTTTTATGCCTAAAAGGAGCTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTGATGGAATTGTCGGACGGCGATGTGAGAAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTTCCCGTATAGGCTGTATTGGATGCCCTATGGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGGCATTACATGTAAGCGAAATATGCCGCATTATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGTGGGAAAAAATCATGACCGGCAGCTACAATGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTTTGCGGGCTTGAGACCGCCAGTGGCCGCATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGTCACCCAGCGACGCGTCCACCGGCTCCCGGTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGACATCTTTTGTAGACTTATACCCAGTGATTGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGATACCATTGATCGTTATAGTTGTCCGGGGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAAATCCCAGCCGTAGAACTGGTATACGCAAAGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATAAGAGATTTGAAAAGCCCGTGGTTTCGTCCATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTACCGCTTGATCGTGCGTTGTGATGTCTTCACGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTGTATATAAACCCTTTTTGACTACCATAAATCGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGTGCTGCATCCAGCAATACAGGCCCTTATGCTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAATTTTACTTTCATACGTCATACGCCGCCTTGCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCAACCGACGCGATACCTACGCCAACTGGCAGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATTGCCATATAATTATCCTCCTGTTTTTTCAGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGCGCGGTAGTATAATATAGTTACAGGGTAAGCGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTAAATCCGCACTGGATAACAAGCGGCTGGAAATCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGTTACGCCCGGTTCCGATTTAAATGCCAGCGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCAGCGGTTCCGGCGTTACGCCCGGTTCCGATTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAGCAGGTCATTGTAGCTGCTCAGTACTTCCGCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGTTGGTTGCTGTATCCATCCAGCATGCGCTCGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTCATGTAGCTCCATATTTCTTGATACACGCTATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCTTTTGGGCTAACGCATACGCCCTGTACACTAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCCCAGCCGGTGTGTTTCCAGAGCTTGCGGCCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATCGACTTCATTCACGCTGTCCAGACGGCAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCACAAGCCGTCCAGAAGCCCGTACAGGAACCCA
168548 NZ_LS999521.1 Acinetobacter-calcoaceticus-isolate-Acinetobacter-calcoaceticus-str Bacteria 3158966-3164822 5857 278 18 TCGCTGTCAG TCGCTGTCAGAGTCAGAATCGCTGTCAGAGTCCGAGTCGCTGTCAGAGTCCGAATCGCTGTCAGAATCAGAGTCGCTGTCAGAGTCCGAGTCACTGTCAGAGTCAGAGTCGCTGTCAGAGTCCGAATCGCTGTCAGAATCAGAGTCGCTGTCAGAGTCCGAGTCACTGTCAGAGTCAGAGTCGCTGTCCGAGTCAGAATCGCTGTCAGAGTCAGAATCGCTGTCAGAGTCCGAGTCACTGTCAGAGTCCGAATCGCTGTCAGAGTCAGAATCGCTGTCAGAGTCAGAGTCGCTGTCAGAGTCCGAATCGCTGTCAGAATCAGAGTCGCTGTCAGAATCAGAGTCGCTGTCAGAATCAGAGTCGCTGTCCGAGTCAGAATCGCTGTCAGAGTCCGAGTCACTGTCAGAGTCAGAGTCGCTGTCCGAGTCAGAATCGCTGTCAGAGTCAGAATCGCTGTCAGAGTCCGAGTCACTGTCAGAGTCCGAATCGCTGTCAGAGTCCGAGTCACTGTCAGAGTCAGAATCGCTGTCAGAGTCCGAATCGCTGTCGCTATCCGAATCGCTGTCCGAGTCCGAATCGCTGTCAGAGTCAGAATCGCTGTCCGAATCCGAATCGCTATCAGAATCCGAGTCGCTGTCCGAGTCCGAATCGCTATCAGAGTCCGAGTCGCTGTCAGAGTCAGAATCGCTGTCAGAGTCAGAATCGCTGTCGCTGTCAGAGTCACTGTCAGAATCAGAGTCGCTGTCAGAGTCCGAATCGCTGTCGCTATCCGAGTCGCTGTCAGAGTCCGAATCGCTGTCAGAATCAGAGTCGCTGTCAGAGTCAGAATCGCTGTCAGAGTCCGAGTCACTGTCAGAGTCCGAATCGCTATCAGAGTCGGAATCGCTGTCAGAATCAGAGTCGCTGTCAGAATCAGAGTCGCTGTCAGAGTCAGAATCGCTGTCAGAGTCCGAGTCACTGTCAGAGTCAGAATCGCTATCAGAGTCGGAATCGCTGTCAGAATCAGAGTCGCTGTCAGAATCAGAGTCGCTGTCCGAGTCAGAATCGCTGTCAGAGTCAGAATCGCTATCAGAGTCGGAATCGCTGTCAGAATCAGAGTCGCTGTCAGAATCAGAGTCGCTGTCCGAGTCAGAATCGCTGTCAGAGTCAGAATCGCTGTCAGAGTCAGAATCGCTGTCAGAGTCAGAATCGCTGTCAGAGTCAGAATCGCTGTCCGAATCCGAATCGCTATCAGAATCAGAGTCGCTGTCAGAGTCAGAATCGCTGTCCGAATCCGAATCGCTATCAGAATCAGAGTCGCTGTCAGAGTCAGAATCGCTGTCAGAGTCCGAATCGCTGTCAGAGTCAGAATCGCTGTCAGAGTCAGAATCGCTGTCCGAATCCGAATCACTGTCAGAGTCCGAATCGCTGTCCGAGTCCGAATCGCTGTCAGAGTCCGAGTCGCTGTCCGAGTCCGAATCGCTGTCAGAGTCAGAATCGCTGTCCGAATCCGAATCACTGTCAGAGTCCGAATCGCTGTCGCTGTCAGAGTCACTGTCAGAATCAGAGTCGCTGTCAGAGTCCGAATCGCTGTCGCTATCCGAGTCGCTGTCAGAGTCCGAATCGCTGTCAGAATCAGAGTCGCTGTCAGAGTCCGAGTCACTGTCAGAGTCAGAGTCGCTGTCCGAGTCCGAATCGCTGTCAGAGTCAGAATCGCTGTCAGAGTCCGAGTCACTGTCAGAGTCAGAATCGCTGTCAGAGTCCGAATCGCTGTCAGAGTCCGAATCGCTGTCGCTGTCAGAGTCACTGTCAGAATCAGAGTCGCTATCAGAGTCGGAATCGCTGTCAGAATCAGAGTCGCTGTCAGAGTCAGAATCGCTGTCAGAGTCCGAGTCGCTGTCAGAGTCAGAATCGCTGTCAGAGTCCGAGTCACTGTCAGAGTCCGAATCGCTGTCAGAATCAGAGTCGCTGTCAGAGTCAGAATCGCTGTCAGAGTCCGAGTCACTGTCAGAGTCCGAATCGCTATCAGAGTCGGAATCGCTGTCAGAATCAGAGTCACTGTCAGAATCAGAGTCGCTGTCCGAGTCAGAATCGCTGTCAGAGTCAGAATCGCTGTCAGAGTCAGAATCGCTGTCAGAGTCCGAGTCACTGTCAGAGTCAGAATCGCTGTCAGAGTCCGAGTCACTGTCAGAGTCAGAATCGCTGTCGCTGTCAGAGTCACTGTCAGAATCAGAGTCGCTGTCAGAGTCAGAATCGCTGTCGCTATCCGAGTCGCTATCAGAGTCAGAGTCGCTGTCCGAGTCCGAATCGCTGTCCGAATCAGAATCGCTGTCCGAGTCAGAATCGCTGTCCGAATCAGAATCGCTGTCCGAATCAGAATCGCTGTCAGAGTCAGAATCACTGTCAGAATCCGAATCGCTGTCCGAGTCAGAATCACTGTCAGAGTCAGAATCACTGTCAGAGTCAGAATCGCTGTCCGAGTCCGAATCGCTATCAGAGTCCGAATCGCTGTCCGAGTCCGAATCACTGTCAGAGTCCGAGTCGCTGTCCGAATCAGAATCACTGTCAGAATCCGAATCGCTGTCGCTATCCGAGTCACTGTCAGAATCCGAATCGCTGTCAGAGTCAGAATCACTGTCAGAATCAGAGTCGCTGTCAGAATCCGAATCGCTGTCAGAGTCAGAATCGCTGTCAGAGTCAGAATCACTGTCAGAATCAGAGTCACTGTCAGAATCCGAATCGCTGTCGCTATCCGAGTCACTGTCAGAATCCGAGTCGCTGTCCGAATCCGAGTCACTGTCAGAATCCGAATCGCTGTCGCTATCCGAGTCACTGTCAGAATCCGAGTCGCTGTCAGAGTCAGAATCGCTGTCGCTATCCGAGTCGCTGTCAGAGTCCGAATCGCTGTCCGAATCAGAATCGCTGTCGGAGTCAGAATCGCTGTCGCTATCCGAGTCGCTGTCAGAATCAGAGTCGCTGTCAGAATCAGAGTCACTGTCAGAGTCAGAATCGCTGTCAGAGTCCGAGTCACTGTCAGAGTCCGAATCGCTGTCGCTATCCGAGTCGCTGTCCGAATCAGAATCGCTGTCAGAGTCAGAATCGCTGTCAGAGTCCGAATCGCTGTCGCTGTCAGAATCGCTGTCAGAGTCCGAGTCGCTGTCAGAGTCAGAATCGCTGTCAGAGTCCGAGTCACTGTCAGAGTCCGAATCGCTGTCGCTGTCAGAGTCGCTGTCCGAATCAGAATCGCTGTCCGAATCAGAATCGCTGTCAGAGTCAGAATCGCTATCAGAGTCCGAATCGCTGTCAGAGTCAGAATCACTGTCAGAATCAGAGTCACTGTCAGAATCAGAATCACTGTCAGAGTCCGAGTCGCTGTCCGAATCAGAATCGCTATCAGAGTCCGAATCGCTGTCAGAGTCAGAATCACTGTCAGAATCAGAGTCACTGTCAGAATCCGAGTCGCTGTCCGAATCCGAGTCGCTGTCAGAGTCAGAATCACTGTCAGAGTCCGAGTCGCTGTCCGAATCAGAATCGCTGTCCGAATCAGAATCGCTGTCCGAATCAGAATCGCTGTCAGAGTCAGAATCACTGTCAGAGTCCGAGTCGCTGTCCGAATCCGAATCGCTGTCCGAGTCAGAATCGCTGTCAGAGTCCGAGTCACTGTCAGAGTCAGAATCGCTGTCGCTGTCAGAGTCGCTGTCCGAATCCGAATCGCTGTCCGAGTCAGAATCGCTGTCCGAATCCGAGTCACTGTCAGAGTCCGAA
73117 NZ_CP015120.1 Klebsiella-pneumoniae-strain-kp757 Bacteria 3307498-3313330 5833 273 18 GAGTCGCTGT GAGTCGCTGTCGGAGTCGGAATCGCTGTCAGAGTCCGAGTCGCTGTCAGAATCCGAGTCGCTGTCGGAATCCGAGTCGCTGTCAGAATCCGAGTCACTGTCCGAATCGGAGTCGCTGTCAGAGTCAGAGTCGCTGTCAGAATCCGAATCGCTGTCCGAGTCAGAGTCACTGTCGGAATCCGAATCGCTGTCGGAGTCAGAGTCACTGTCAGAGTCGGAATCGCTGTCAGAGTCCGAATCGCTGTCAGCATCCGAATCGCTGTCGGAGTCGGAGTCGCTGTCGGAGTCGGAATCGCTGTCCGAGTCAGAGTCGCTGTCAGAATCGGAGTCGCTGTCAGAGTCCGAGTCGCTGTCGGAGTCCGAATCGCTGTCAGAGTCCGAGTCGCTGTCCGAATCCGAGTCACTGTCAGAGTCCGAATCGCTGTCAGAATCCGAATCGCTGTCCGAGTCAGAGTCGCTGTCGGAATCCGAGTCACTGTCGGAATCGGAGTCGCTGTCAGAGTCAGAGTCGCTGTCCGAATCGGAATCGCTGTCCGAATCGGAGTCACTGTCAGAATCCGAATCGCTGTCAGAATCCGAGTCGCTGTCAGAATCCGAGTCGCTGTCCGAATCCGAGTCACTGTCAGAGTCCGAATCGCTGTCAGAATCCGAATCGCTGTCCGAGTCAGAGTCGCTGTCGGAGTCGGAATCGCTGTCGGAGTCGGAATCGCTGTCGGAGTCGGAATCGCTGTCCGAGTCCGAGTCGCTGTCGGAATCCGAATCGCTGTCAGAGTCAGAGTCGCTGTCAGAGTCAGAATCGCTGTCCGAATCGGAGTCGCTGTCAGAGTCCGAATCGCTGTCGGAATCCGAATCGCTGTCGGAGTCAGAATCGCTGTCCGAGTCAGAGTCGCTGTCGGAATCCGAATCGCTGTCAGAGTCAGAGTCGCTGTCAGAGTCAGAGTCGCTGTCAGAGTCAGAATCGCTGTCCGAATCGGAGTCGCTGTCAGAGTCCGAATCGCTGTCAGCATCCGAGTCGCTGTCAGAGTCCGAGTCACTGTCAGAGTCGGAATCGCTGTCAGCATCCGAGTCGCTGTCAGAATCCGAGTCACTGTCAGAATCCGAGTCGCTGTCAGAGTCAGAATCGCTGTCAGAATCGGAGTCGCTGTCCGAATCCGAGTCGCTGTCGGAGTCCGAGTCGCTGTCGGAATCGGAGTCGCTGTCAGAGTCAGAGTCGCTGTCGGAGTCCGAATCGCTGTCCGAATCGGAGTCACTGTCAGCATCCGAGTCGCTGTCGGAGTCCGAATCGCTGTCCGAATCGGAGTCGCTGTCGGAGTCCGAGTCGCTGTCGGAATCGGAGTCGCTGTCGGAATCCGAGTCGCTGTCAGAATCCGAGTCGCTGTCCGAGTCAGAGTCGCTGTCGGAGTCGGAGTCGCTGTCAGAGTCCGAATCGCTGTCAGAGTCGGAGTCGCTGTCAGAGTCAGAGTCGCTGTCGGAGTCCGAGTCGCTGTCCGAATCGGAGTCACTGTCAGAATCCGAGTCGCTGTCCGAGTCAGAGTCGCTGTCGGAATCCGAATCGCTGTCCGAGTCAGAATCGCTGTCGGAATCGGAGTCGCTGTCAGAATCCGAATCGCTGTCAGAGTCGGAGTCGCTGTCCGAGTCCGAGTCGCTGTCAGAATCCGAGTCACTGTCAGAGTCCGAATCGCTGTCAGAATCCGAATCGCTGTCCGAGTCAGAGTCGCTGTCAGAGTCAGAATCGCTGTCAGAATCGGAATCGCTGTCGGAATCCGAGTCGCTGTCGGAGTCCGAGTCGCTGTCCGAGTCGGAGTCGCTGTCAGAGTCCGAATCGCTGTCCGAGTCGGAGTCACTGTCGGAATCCGAGTCGCTGTCAGAATCGGAGTCGCTGTCGGAGTCGGAGTCGCTGTCGGAGTCGGAATCGCTGTCCGAGTCGGAGTCGCTGTCAGAATCCGAATCGCTGTCGGAGTCCGAGTCGCTGTCCGAGTCTGAGTCGCTGTCGGAGTCAGAGTCGCTGTCGGAGTCCGAGTCACTGTCAGAGTCAGAGTCGCTGTCAGAATCCGAGTCGCTGTCGGAGTCCGAATCGCTGTCAGAATCCGAGTCGCTGTCGGAATCCGAATCGCTGTCGGAGTCAGAGTCACTGTCAGCATCCGAATCGCTGTCCGAGTCAGAGTCGCTGTCGGAATCCGAATCGCTGTCAGAGTCAGAGTCACTGTCAGAGTCAGAATCGCTGTCGGAATCGGAGTCGCTGTCCGAGTCCGAGTCGCTGTCAGAATCCGAGTCACTGTCAGAATCGGAATCGCTGTCAGAATCCGAGTCACTGTCAGAGTCCGAGTCGCTGTCGCTGTCGGAATCGCTGTCAGAGTCGGAATCGCTGTCAGAATCCGAGTCGCTGTCGGAATCCGAATCGCTGTCGGAGTCAGAGTCACTGTCAGCATCCGAATCGCTGTCCGAGTCAGAGTCGCTGTCGGAATCCGAATCGCTGTCAGAGTCAGAGTCACTGTCAGAGTCAGAATCGCTGTCGGAATCGGAGTCGCTGTCCGAGTCCGAGTCGCTGTCAGAATCCGAGTCACTGTCAGAGTCCGAATCGCTGTCAGAATCCGAATCGCTGTCCGAGTCAGAGTCGCTGTCAGAGTCAGAATCGCTGTCAGAATCGGAATCGCTGTCGGAATCCGAGTCGCTGTCGGAGTCCGAGTCGCTGTCCGAGTCGGAGTCGCTGTCAGAGTCCGAATCGCTGTCCGAGTCGGAGTCACTGTCGGAATCCGAGTCGCTGTCAGAATCGGAGTCGCTGTCGGAGTCGGAGTCGCTGTCGGAGTCGGAATCGCTGTCCGAGTCGGAGTCGCTGTCAGAATCCGAATCGCTGTCGGAGTCCGAGTCGCTGTCCGAGTCTGAGTCGCTGTCGGAGTCAGAGTCGCTGTCGGAGTCCGAGTCACTGTCAGAGTCAGAGTCGCTGTCAGAATCCGAGTCGCTGTCGGAGTCCGAATCGCTGTCAGAATCCGAGTCGCTGTCGGAATCCGAATCGCTGTCGGAGTCAGAGTCACTGTCAGCATCCGAATCGCTGTCCGAGTCAGAGTCGCTGTCGGAATCCGAATCGCTGTCAGAGTCAGAGTCACTGTCAGAGTCAGAATCGCTGTCGGAATCGGAGTCGCTGTCCGAGTCCGAGTCGCTGTCAGAATCCGAGTCACTGTCAGAATCGGAATCGCTGTCAGAATCCGAGTCACTGTCAGAGTCCGAGTCGCTGTCGCTGTCGGAATCGCTGTCAGAGTCGGAATCGCTGTCAGAATCCGAGTCGCTGTCGGAATCCGAATCGCTGTCGGAGTCAGAGTCACTGTCAGCATCCGAATCGCTGTCCGAGTCAGAGTCGCTGTCGGAATCCGAATCGCTGTCAGAGTCAGAGTCACTGTCAGAGTCAGAATCGCTGTCGGAATCGGAGTCGCTGTCCGAGTCCGAGTCGCTGTCAGAATCCGAGTCACTGTCAGAATCGGAATCGCTGTCAGAATCCGAGTCACTGTCAGAGTCCGAGTCGCTGTCGCTGTCGGAGTCGCTGTCCGAATCCGAGTCGCTGTCGGAGTCCGAGTCGCTGTCGGAGTCCGAGTCGCTGTCAGAATCC
84578 NZ_CP017705.1 Brevibacillus-laterosporus-DSM-25 Bacteria 4396011-4401087 5077 269 18 CCAGTAGCGC CCAGTAGCGCCGGTGTCTCCAGTAGCACCAGTGTCACCAGTAGCGCCGGTATCACCAGTAGGGCCAGTGTCTCCAGTAGCACCAGTGTCTCCGGTAGCGCCAGTATCTCCAGTAGCGCCGGTATCACCAGTAGGGCCAGTGTCACCAGTAGCGCCGGTGTCTCCGGTAGCGCCGGTGTCACCAGTAGCGCCGGTGTCCCCAGTAGCGCCGGTGTCCCCAGTAGCGCCGGTGTCTCCAGTAGCGCCGGTGTCACCAGTAGCACCAGTGTCTCCGGTAGCGCCGGTGTCACCAGTAGGGCCAGTGTCTCCGGTAGCGCCGGTGTCTCCAGTAGCGCCGGTGTCCCCAGTAGCGCCGGTGTTCCCAGTAGGGCCAGTGTCACCGGTAGCGCCAGTAGCACCAGTAGGGCCGGTGTCTCCAGTAGCGCCGGTGTCTCCAGTAGCCCCAGTGTCACCAGTAGCACCGGTGTCCCCAGTAGGGCCAGTGTCACCAGTAGCGCCGGTGTCTCCGGTAGCGCCGGTGTCACCAGTAGCGCCGGTGTCCCCAGTAGCGCCGGTGTCCCCAGTAGCGCCGGTGTCTCCAGTAGCGCCGGTGTCACCAGTAGCACCAGTGTCTCCGGTAGCGCCGGTGTCACCAGTAGGGCCAGTGTCTCCGGTAGCGCCGGTGTCTCCAGTAGCGCCGGTGTCCCCAGTAGCGCCGGTGTTCCCAGTAGGGCCAGTGTCACCGGTAGCGCCAGTAGCACCAGTAGCGCCGGTGTCACCAGTAGCCCCAGTGTCACCAGTAGCACCGGTGTCACCAGTAGGGCCAGTGTCTCCGGTAGCGCCGGTGTTCCCAGTAGGGCCAGTGTCTCCGGTAGCGCCGGTGTCTCCAGTAGCGCCGGTATCACCAGTAGGGCCAGTGTCTCCGGTAGCGCCGGTGTCACCAGTAGCACCAGTGTCTCCGGTAGCGCCAGTATCTCCAGTAGCGCCGGTATCACCAGTAGGGCCAGTGTCTCCAGTAGCACCAGTGTCACCGGTAGCGCCAGTATCTCCAGTAGCGCCGGTATCACCAGTAGGGCCAGTGTCTCCAGTAGCACCAGTGTCACCGGTAGCGCCAGTATCTCCAGTAGCGCCGGTATCACCAGTAGGGCCAGTGTCTCCAGTAGCACCAGTGTCACCAGTAGCGCCGGTGTTTCCAGTAGCGCCGGTGTCACCAGTAGCACCAGTGTCTCCGGTAGCGCCGGTGTCTCCAGTAGCGCCGGTGTCTCCGGTAGCGCCGGTGTCACCAGTAGGGCCAGTGTCTCCGGTAGCGCCGGTGTCTCCAGTAGCGCCGGTGTCCCCAGTAGCGCCGGTGTTCCCAGTAGGGCCAGTGTCACCGGTAGCGCCAGTAGCACCAGTAGCGCCGGTGTCACCAGTAGCCCCAGTGTCTCCAGTAGCACCGGTGTCCCCAGTAGCGCCGGTGTCCCCAGTAGCGCCGGTGTCTCCAGTAGCGCCGGTGTCACCAGTAGCACCAGTGTCTCCGGTAGCGCCGGTGTCCCCAGTAGGGCCAGTGTCTCCGGTAGCGCCGGTGTCTCCAGTAGCGCCGGTGTCACCAGTAGCACCAGTGTCACCAGTAGCACCGGTGTCTCCAGTAGCGCCGGTGTCTCCAGTAGGGCCAGTGTCTCCGGTAGCGCCGGTGTCACCAGTAGCACCAGTGTCTCCGGTAGCGCCAGTGTCCCCAGTAGCGCCAGTGTCTCCGGTAGCGCCAGTGTCTCCGGTAGCGCCGGTATCACCAGTAGGGCCAGTGTCTCCGGTAGCGCCGGTGTCACCAGTAGCACCAGTGTCTCCGGTAGCGCCAGTGTCCCCAGTAGCGCCAGTGTCTCCGGTAGCGCCAGTGTCTCCGGTAGCGCCAGTATCTCCAGTAGCGCCGGTATCACCGGTAGCGCCAGTATCTCCAGTAGCGCCGGTATCACCGGTAGCGCCGGTGTCACCGGTAGCGCCAGTATCTCCAGTAGCGCCGGTATCACCAGTAGGGCCAGTGTCACCAGTAGCACCAGTGTCACCAGTAGGGCCGGTGTTCCCAGTAGGGCCAGTGTCACCGGTAGCGCCAGTAGCACCAGTAGCGCCGGTGTCCCCAGTAGCGCCGGTGTCCCCAGTAGCGCCGGTGTCCCCAGTAGCGCCGGTGTCTCCAGTAGCACCGGTGTCCCCGGTAGCGCCAGTGTCACCAGTAGGGCCAGTGTCTCCGGTAGCGCCGGTGTCTCCAGTAGCGCCGGTATCACCAGTAGGGCCAGTGTCTCCGGTAGCGCCGGTGTCACCAGTAGCACCAGTGTCTCCAGTAGGGCCAGTGTCTCCGGTAGCGCCAGTGTCTCCGGTAGCGCCAGTATCTCCAGTAGCGCCGGTATCTCCAGTAGCGCCGGTGTCTCCAGTAGCGCCGGTGTCTCCAGTAGCGCCGGTGTCTCCAGTAGCGCCGGTGTCACCAGTAGCACCAGTGTCTCCGGTAGCGCCGGTGTCTCCAGTAGCACCAGTAGCACCAGTAGCACCAGTAGCACCAGTAGCACCAGTAGCACCAGTAGCACCAGTGTCTCCAGTAGCACCAGTGTCTCCGGTAGCGCCGGTGTCCCCAGTAGGGCCAGTGTCTCCGGTAGCGCCGGTGTCTCCAGTAGCGCCGGTGTCTCCAGTAGCGCCGGTGTCTCCAGTAGCGCCGGTGTCTCCAGTAGCACCGGTGTCTCCGGTAGCGCCAGTGTCTCCAGTAGCGCCGGTATCACCAGTAGCGCCGGTATCACCAGTAGGGCCAGTGTCTCCAGTAGGGCCAGTGTCTCCAGTAGCACCAGTGTCTCCAGTAGGGCCGGTGTCTCCGGTAGCGCCGGTGTCCCCAGTAGGGCCGGTGTCTCCAGTAGCGCCGGTGTCTCCAGTAGCGCCGGTGTTCCCAGTAGCGCCAGTGTCACCGGTAGCGCCAGTAGCCCCAGTAGCGCCGGTGTCTCCAGTAGCGCCGGTGTCCCCAGTAGCGCCAGTGTCACCAGTAGGGCCGGTGTCCCCAGTAGCGCCGGTGTCCCCAGTAGCGCCGGTGTCTCCAGTAGCACCAGTGTCACCAGTAGCACCGGTGTCTCCAGTAGGGCCGGTGTCCCCAGTAGCACCAGTAGGGCCAGTAGCGCCAGTAGCA
81251 NZ_CP017107.1 Lactobacillus-salivarius-strain-CICC-23174-chromosome Bacteria 156400-166152 9753 266 36 ATGTACTCAA ATGTACTCAAGCTTTCACTTAAGGAACTTGATGTGGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTCAAGCTTTCGCTTAAGGAACTTGAAGTTGATGTACTCAAGCTTTCACTCAATGAACCTGAAGTTGATGTACTCAAGCTTTCACTCAAGGAACTTGAAGTTGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTCAAGCTTTCACTTAAGGAACTTGATGTGGATGTACTTAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTTAAGCTTTCGCTTAAGGAACTTGATGTGGATGTACTCAAGCTTTCACTCAAGGAACCTGAAGTTGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTCGATGTACTCAAGCTTTCACTTAAGGAACTTGATGTGGATGTACTCAAGCTTTCACTCAAGGAACTTGATGTGGATGTACTTAAGCTTTCACTTAAGGAACTTGATGTGGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTTAAGCTTTCGCTCAAGGAACTTGATGTGGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTCAAGCTTTCACTTAAGGAACTTGATGTGGATGTACTCAAGCTTTCACTTAAGCTGCTTGATGTGGATATACTCAAGCTTTCACTTAAGGAACTTGATGTGGATGTACTTAAGCTTTCACTTAAGGAACTTGATGTTGATGTACTCAAGCTTTCGCTCAAGGAACTTGATGTGGATGTACTCAAACTTTCACTCAAGGAACTTGATGTGGATGTACCCAAGCTTTCACTTAAGCTGCTTGATGTGGATGTACTTAAGCTTTCACTTAAGGAACTTGATGTTGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTAGATGTACTCAAGCTTTCGCTCAAGGAACTTGATGTGGATGTACTCAAGCTTTCACTCAAGGAACTTGATGTTGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTCAAACTTTCACTCAAGGAACTTGATGTTGATGTACTTAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTTAAGCTTTCACTTAAGGAACTTGAAGTTGATGTACTCAAGCTTTCACTTAAGGAACCTGAAGTTGATGTACTCAAGCTTTCACTTAAGGAACCTGAAGTTGATGTACTCAAGCTTTCACTTAAGGAACCTGAAGTTGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTTAAGCTTTCGCTCAAGGAACTTGATGTGGATGTACTCAAGCTTTCACTTAAGGAACTTGATGTGGATGTACTTAAGCTTTCACTCAAGGAACTTGATGTGGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTCAAGCTTTCGCTCAAGGAACTTGATGTTGATGTACTCAAACTTTCACTCAAGGAACTTGATGTGGATGTACTTAAGCTTTCACTCAAACTGCTTGATGTCGATGTACTTAAGCTTTCACTTAAGCTGCTTGATGTGGATGTACTCAAGCTTTCACTCAAGGAACTTGAAGTTGATGTACTCAAGCTTTCACTCAAGGAACTTGATGTGGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTCGATGTACTTAAGCTTTCGCTTAAGGAACTTGATGTTGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTCAAACTTTCACTTAAGGAACTTGAAGTTGATATACTCAAGCTTTCACTCAAGGAACTTGAAGTTGATGTACTCAAACTTTCACTTAAGGAACTTGATGTTGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTCAAGCTTTCGCTCAAGGAACTTGAAGTTGATGTACTCAAGCTTTCACTCAAGGAACTTGATGTTGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTCGATGTACTTAAGCTTTCGCTTAAGGAACTTGAAGTTGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTCAAACTTTCACTTAAGGAACTTGAAGTTGATATACTCAAGCTTTCACTCAAGGAACTTGAAGTTGATGTACTCAAACTTTCACTTAAGGAACTTGATGTTGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTCAAGCTTTCGCTCAAGGAACTTGATGTGGATGTACTCAAACTTTCACTCAAGGAACTTGAAGTTGATGTACTCAAGCTTTCACTTAAGGAACTTGAAGTTGATGTACTTAAGCTTTCGCTCAAGGAACTTGATGTTGATGTACTTAAGCTTTCGCTCAAGGAACTTGATGTTGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTCGATGTACTCAAGCTTTCACTTAAGGAACTTGAAGTTGATGTACTCAAACTTTCACTCAAACTGCTTGATGTCGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTCGATGTACTTAAGCTTTCGCTCAAGGAACTTGATGTTGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTTAAGCTTTCGCTTAAGGAACTTGAAGTTGATGTACTTAAGCTTTCGCTCAAGGAACTTGATGTTGATGTACTTAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTCAAGCTTTCACTTAAGGAACTTGAAGTTGATGTACTTAAGCTTTCGCTCAAGGAACTTGAAGTGGATGTACTCAAGCTTTCACTTAAGGAACTTGAAGTTGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTCAAGCTTTCACTTAAGGAACTTGATGTTGATGTACTCAAACTTTCACTCAAGGAACTTGAAGTTGATGTACTCAAACTTTCACTTAAGGAACTTGAAGTTGATGTACTTAAGCTTTCGCTCAAGGAACTTGAAGTTGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTCAAGCTTTCACTTAAGGAACTTGAAGTTGATGTACTCAAACTTTCACTCAAGGAACTTGAAGTTGATGTACTTAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTTAAGCTTTCGCTTAAGGAACTTGATGTTGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTCGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTCGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTCGATGTACTCAAGCTTTCACTTAAGGAACTTGATGTTGATGTACTCAAGCTTTCACTTAAGCTGCTTGATGTGGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTCGATGTACTCAAGCTTTCACTTAAGCTGCTTGATGTGGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTCGATGTACTCAAGCTTTCACTTAAGGAACTTGAAGTTGATGTACTTAAGCTTTCACTCAAACTACTTGATGTGGATGTACTTAAGCTTTCGCTCAAGGAACTTGATGTTGATGTACTCAAGCTTTCACTTAAGCTGCTTGATGTCGATGTACTCAAGCTTTCACTTAAGGAACTTGATGTTGATGTACTTAAGCTTTCACTCAAACTACTTGATGTGGATGTACTTAAGCTTTCACTTAAGGAACTTGAAGTTGATGTACTCAAGCTTTCACTCAAGGAACTTGATGTTGATGTACTCAAACTTTCACTTAAGGAACTTGAAGTTGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTCAAGCTTTCGCTCAAGGAACTTGAAGTTGATGTACTCAAACTTTCACTCAAGGAACTTGAAGTTGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTTAAGCTTTCGCTCAAGGAACTTGATGTTGATGTACTTAAGCTTTCGCTCAAGGAACTTGAAGTTGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTCAAGCTTTCACTTAAGGAACTTGATGTGGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTCAAGCTTTCACTTAAGGAACTTGATGTGGATGTACTCAAACTTTCACTCAAACTGCTTGATGTGGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTTAAGCTTTCGCTCAAGGAACTTGATGTGGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTTAAGCTTTCGCTCAAGGAACTTGATGTTGATGTACTTAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTCAAGCTTTCACTTAAGCTGCTTGATGTGGATGTACTTAAGCTTTCGCTTAAGGAACTTGAAGTTGATGTACTTAAGCTTTCGCTCAAGGAACTTGATGTTGATGTACTCAAGCTTTCACTTAAGCTGCTTGATGTGGATGTACTCAAGCTTTCACTTAAGGAACTTGAAGTTGATGTACTTAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTTAAGCTTTCGCTCAAGGAACTTGAAGTTGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTCAAGCTTTCACTTAAGGAACTTGAAGTTGATGTACTTAAGCTTTCGCTCAAGGAACTTGAAGTTGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTTAAGCTTTCACTTAAGGAACTTGAAGTTGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTCAAGCTTTCACTCAAACTGCTTGAGGTGGATGTACTCAAGCTTTCACTTAAGGAACTTGAAGTTGATGTACTTAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTTAAGCTTTCGCTCAAGGAACTTGAAGTGGATGTACTTAAGCTTTCGCTCAAGGAACTTGAAGTTGATGTACTCAAACTTTCACTTAAGGAACTTGAAGTTGATGTACTCAAACTTTCACTCAAACTGCTTGATGTGGATGTACTCAAACTTTCACTCAAGGAACTTGAAGTTGATGTACTCAAGCTTTCACTTAAGGAACTTGATGTGGATGTACTTAAGCTTTCGCTCAAGGAACTTGAAGTTGATGTACTTAAGCTTTCGCTCAAGGAACTTGAAGTTGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTCAAGCTTTCACTTAAGGAACTTGATGTGGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTCAAGCTTTCACTTAAGGAACTTGATGTGGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTTAAGCTTTCGCTCAAGGAACTTGATGTTGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTTAAGCTTTCACTCAAGGAACTTGATGTTGATGTACTCAAACTTTCACTCAAGGAACTTGATGTGGATGTACTCAAGCTTTCACTCAAGGAACTTGATGTTGATGTACTTAAGCTTTCACTCAAGGAACTTGATGTTGATGTACTTAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTCAAGCTTTCACTTAAGGAACTTGATGTTGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTTGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTCAAGCTTTCACTTAAGGAACTTGATGTTGATGTACTCAAGCTTTCGCTCAAGGAACTTGAAGTTGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTCAAGCTTTCGCTTAAGGAACTTGATGTGGATGTACTCAAGCTTTCGCTTAAGGAACTTGAAGTTGATGTACTTAAGCTTTCACTCAAGGAACTTGATGTGGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTCAAGCTTTCACTTAAGGAACTTGATGTGGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTCAAGCTTTCACTTAAGGAACTTGATGTGGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTCAAGCTTTCACTTAAGGAACTTGATGTGGATGTACTCAAGCTTTCGCTCAAACTGCTTGATGTAGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTCAAGCTTTCGCTCAAACTGCTTGATGTTGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTCAAGCTTTCACTTAAGGAACTTGAAGTTGATGTACTCAAGCTTTCACTCAAGGAACTTGATGTTGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTCAAGCTTTCGCTTAAGGAACTTGATGTGGATGTACTCAAGCTTTCGCTCAAGGAACTTGAAGTTGATGTACTCAAGCTTTCGCTTAAGGAACTTGAAGTTGATGTACTTAAGCTTTCACTCAAGGAACTTGATGTGGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTCAAGCTTTCACTTAAGGAACTTGAAGTTGATGTACTTAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTCAAGCTTTCACTTAAGGAACTTGATGTTGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTCAAGCTTTCACTTAAGGAACTTGATGTTGATGTACTTAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTTAAGCTTTCGCTTAAGGAACTTGATGTTGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTCAAGCTTTCACTTAAGGAACTTGATGTGGATGTACTCAAGCTTTCGCTCAAACTGCTTGATGTGGATGTACTTAAACTTTCACTCAAACTGCTTGAGGTGGATGTACTCAAGCTTTCACTTAAGCTGCTTGAGGTTGATGTACTTAAGCTTTCACTCAAACTGCTTGAGGTGGATGTACTCAAGCTTTCACTCAAGGAACTTGATGTGGATGTACTTAAGCTTTCACTCAAGGAACTTGATGTTGATGTACTCAAGCTTTCACTCAAGGAACTTGATGTTGATGTACTTAAGCTTTCACTCAAACTGCTTGAGGTGGATGTACTTAAGCTTTCGCTTAAGGAACTTGAAGTTGATGTACTCAAGCTTTCACTTAAGCTGCTTGATGTGGATGTACTCAAACTTTCACTCAAACTGCTTGATGTGGATGTACTCAAACTTTCACTCAAGGAACTTGATGTGGATGTACTTAAGCTTTCACTTAAGCTGCTTGATGTGGATGTACTCAAGCTTTCACTCAAGGAACTTGATGTGGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTTAAGCTTTCGCTTAAGGAACTTGAAGTTGATGTACTCAAGCTTTCACTTAAGCTGCTTGATGTGGATGTACTCAAACTTTCACTCAAACTGCTTGATGTGGATGTACTCAAACTTTCACTCAAACTGCTTGATGTGGATGTACTCAAGCTTTCACTTAAGGAACTTGATGTTGATGTACTCAAGCTTTCGCTCAAGGAACTTGAAGTTGATGTACTCAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTCAAGCTTTCACTTAAGGAACTTGAAGTTGATGTACTCAAGCTTTCACTTAAGCTGCTTGATGTGGATGTACTCAAACTTTCACTCAAACTGCTTGATGTGGATGTACTTAAGCTTTCACTCAAACTGCTTGATGTGGATGTACTTAAGCTTTCACTTAAGGAACTTGAAGTTGATGTACTCAAGCTTTCACTTAAGGAACTTGAAGTTGATGTACTTAAGCTTTCGCTCAAGGAACTTGATGTGGATGTACTTAAGCTTTCGCTCAAACTGCTTGATGTGGATGTACTCAAGCTTTCACTTAAGCTGCTTGATGTAGATGTACTTAAGCTTTCACTCAAGGAACTTGATGTCGATGTACTCAAGCTTTCACTCAAGGAACTTGATGTGGATGTACTTAAGCTTTCACTTAAGGAACTTGATGTGGATGTACTCAAGCTTTCACTTAAGGAACTTGATGTTAATGTACTCAAGCTTTCGCTCAAGGAACTTGATGTCGATGTACTCAAACTTTCACTTAAGGAACTTGATGTGGATGTACTCAAGCTTTCACTCAAGGAACTTGATGTGGATGTACTTAAGCTTTCGCTCAAACTGCTTGATGTCAATCTACTCAAGCTTTCGCTCAAACTGCTTGATGTCAATCTACTCAAGCTTTCACTTAAGGAACTTGAAGTTA
165330 NZ_LR134393.1 Pseudomonas-taetrolens-strain-NCTC8067-genome-assembly Bacteria 4942425-4946859 4435 261 12 TCGGCATCGG TCGGCATCGGCATCGGCGTCGGCGTCGGCGTCGGCGTCAGCATCGGCATCGGCATCGGCATCCGCATCGGCGTCGGCATCAGCGTCGGCATCGGCATCGGCGTCGGCGTCCGCATCGGCATCGGCATCGGCGTCGGCATCGGCGTCCGCATCGGCATCAGCATCGGCGTCCGCATCGGCATCGGCATCAGCATCGGCGTCGGCATCGGCATCGGCGTCGGCGTCGGCATCCGCATCGGCATCCGCATCGGCATCCGCATCGGCATCGGCATCGGCATCGGCGTCGGCATCGGCGTCGGCATCGGCATCCGCGTCGGCGTCGGCGTCGGCATCCGCATCGGCATCGGCATCGGCATCGGCATCGGCATCAGCGTCCGCATCGGCGTCGGCATCGGCATCGGCATCGGCATCAGCATCGGCATCCGCATCGGCATCGGCATCGGCGTCGGCGTCGGCGTCGGCATCAGCGTCGGCATCAGCATCGGCGTCGGCATCGGCATCGGCATCGGCATCGGCGTCGGCGTCGGCGTCGGCGTCGGCGTCGGCATCGGCATCCGCATCGGCATCGGCATCGGCATCAGCATCGGCGTCCGCATCGGCATCGGCGTCGGCATCGGCATCGGCGTCGGCATCGGCGTCGGCATCGGCGTCCGCATCGGCATCCGCATCGGCATCCGCATCGGCATCCGCATCGGCATCGGCATCGGCGTCCGCATCGGCGTCGGCATCGGCGTCCGCATCGGCATCCGCATCGGCATCGGCATCCGCGTCGGCGTCGGCGTCCGCATCGGCATCCGCATCGGCGTCCGCATCGGCATCGGCATCGGCGTCCGCATCGGCATCGGCATCCGCGTCGGCGTCGGCGTCGGCGTCGGCGTCCGCATCGGCATCCGCATCGGCGTCGGCGTCGGCGTCGGCGTCGGCGTCGGCATCGGCATCGGCGTCGGCATCGGCATCCGCGTCCGCATCGGCGTCAGCATCGGCGTCAGCATCGGCATCGGCATCGGCATCGGCATCAGCGTCGGCATCAGCGTCGGCATCGGCATCGGCATCGGCGTCGGCATCGGCATCGGCATCCGCGTCGGCATCAGCGTCCGCATCGGCGTCAGCATCGGCATCGGCATCGGCGTCCGCATCGGCATCGGCATCGGCGTCGGCGTCGGCGTCGGCATCAGCGTCGGCATCAGCATCGGCATCGGCATCGGCATCGGCATCGGCGTCGGCGTCGGCGTCGGCATCGGCATCGGCGTCGGCATCGGCGTCCGCATCGGCATCGGCATCGGCATCAGCATCGGCGTCCGCATCGGCATCGGCATCGGCGTCGGCATCAGCATCGGCGTCGGCATCGGCATCGGCGTCGGCGTCGGCATCGGCGTCGGCATCGGCATCGGCATCGGCATCGGCGTCGGCGTCGGCGTCGGCATCGGCATCCGCATCGGCATCGGCATCGGCATCAGCATCGGCGTCCGCATCGGCATCGGCATCGGCGTCGGCGTCGGCGTCGGCATCAGCGTCGGCATCAGCATCGGCGTCGGCATCGGCATCGGCGTCGGCGTCGGCATCCGCATCGGCATCCGCATCGGCATCCGCATCGGCATCGGCATCGGCATCGGCGTCGGCATCGGCGTCGGCATCGGCATCCGCGTCGGCGTCGGCGTCGGCATCCGCATCGGCATCGGCATCGGCATCGGCGTCGGCGTCGGCGTCCGCATCGGCGTCGGCATCGGCATCAGCATCGGCATCGGCATCGGCATCCGCATCGGCATCGGCATCGGCATCGGCGTCGGCGTCGGCATCAGCATCGGCGTCGGCATCGGCATCGGCGTCGGCGTCGGCGTCGGCGTCGGCATCGGCATCGGCGTCGGCATCGGCGTCCGCATCGGCATCGGCATCGGCATCAGCATCGGCGTCCGCATCGGCATCGGCATCGGCATCGGCGTCGGCGTCGGCATCAGCATCGGCGTCGGCATCGGCATCGGCGTCGGCGTCGGCGTCGGCATCGGCGTCGGCATCGGCGTCCGCATCGGCATCGGCATCGGCATCGGCGTCGGCATCGGCATCCGCGTCCGCATCGGCGTCAGCATCGGCGTCAGCATCGGCATCGGCATCGGCATCGGCATCGGCATCGGCATCGGCATCGGCATCAGCGTCCGCATCGGCGTCGGCGTCGGCGTCCGCATCGGCGTCGGCATCGGCATCGGCATCGGCATCGGCATCGGCATCGGCATCGGCATCCGCATCGGCG
167612 NZ_LS483370.1 Pseudomonas-taetrolens-strain-NCTC10697-genome-assembly Bacteria 4724809-4729243 4435 261 12 TCGGCATCGG TCGGCATCGGCATCGGCGTCGGCGTCGGCGTCGGCGTCAGCATCGGCATCGGCATCGGCATCCGCATCGGCGTCGGCATCAGCGTCGGCATCGGCATCGGCGTCGGCGTCCGCATCGGCATCGGCATCGGCGTCGGCATCGGCGTCCGCATCGGCATCAGCATCGGCGTCCGCATCGGCATCGGCATCAGCATCGGCGTCGGCATCGGCATCGGCGTCGGCGTCGGCATCCGCATCGGCATCCGCATCGGCATCCGCATCGGCATCGGCATCGGCATCGGCGTCGGCATCGGCGTCGGCATCGGCATCCGCGTCGGCGTCGGCGTCGGCATCCGCATCGGCATCGGCATCGGCATCGGCATCGGCATCAGCGTCCGCATCGGCGTCGGCATCGGCATCGGCATCGGCATCAGCATCGGCATCCGCATCGGCATCGGCATCGGCGTCGGCGTCGGCGTCGGCATCAGCGTCGGCATCAGCATCGGCGTCGGCATCGGCATCGGCATCGGCATCGGCGTCGGCGTCGGCGTCGGCGTCGGCGTCGGCATCGGCATCCGCATCGGCATCGGCATCGGCATCAGCATCGGCGTCCGCATCGGCATCGGCGTCGGCATCGGCATCGGCGTCGGCATCGGCGTCGGCATCGGCGTCCGCATCGGCATCCGCATCGGCATCCGCATCGGCATCCGCATCGGCATCGGCATCGGCGTCCGCATCGGCGTCGGCATCGGCGTCCGCATCGGCATCCGCATCGGCATCGGCATCCGCGTCGGCGTCGGCGTCCGCATCGGCATCCGCATCGGCGTCCGCATCGGCATCGGCATCGGCGTCCGCATCGGCATCGGCATCCGCGTCGGCGTCGGCGTCGGCGTCGGCGTCCGCATCGGCATCCGCATCGGCGTCGGCGTCGGCGTCGGCGTCGGCGTCGGCATCGGCATCGGCGTCGGCATCGGCATCCGCGTCCGCATCGGCGTCAGCATCGGCGTCAGCATCGGCATCGGCATCGGCATCGGCATCAGCGTCGGCATCAGCGTCGGCATCGGCATCGGCATCGGCGTCGGCATCGGCATCGGCATCCGCGTCGGCATCAGCGTCCGCATCGGCGTCAGCATCGGCATCGGCATCGGCGTCCGCATCGGCATCGGCATCGGCGTCGGCGTCGGCGTCGGCATCAGCGTCGGCATCAGCATCGGCATCGGCATCGGCATCGGCATCGGCGTCGGCGTCGGCGTCGGCATCGGCATCGGCGTCGGCATCGGCGTCCGCATCGGCATCGGCATCGGCATCAGCATCGGCGTCCGCATCGGCATCGGCATCGGCGTCGGCATCAGCATCGGCGTCGGCATCGGCATCGGCGTCGGCGTCGGCATCGGCGTCGGCATCGGCATCGGCATCGGCATCGGCGTCGGCGTCGGCGTCGGCATCGGCATCCGCATCGGCATCGGCATCGGCATCAGCATCGGCGTCCGCATCGGCATCGGCATCGGCGTCGGCGTCGGCGTCGGCATCAGCGTCGGCATCAGCATCGGCGTCGGCATCGGCATCGGCGTCGGCGTCGGCATCCGCATCGGCATCCGCATCGGCATCCGCATCGGCATCGGCATCGGCATCGGCGTCGGCATCGGCGTCGGCATCGGCATCCGCGTCGGCGTCGGCGTCGGCATCCGCATCGGCATCGGCATCGGCATCGGCGTCGGCGTCGGCGTCCGCATCGGCGTCGGCATCGGCATCAGCATCGGCATCGGCATCGGCATCCGCATCGGCATCGGCATCGGCATCGGCGTCGGCGTCGGCATCAGCATCGGCGTCGGCATCGGCATCGGCGTCGGCGTCGGCGTCGGCGTCGGCATCGGCATCGGCGTCGGCATCGGCGTCCGCATCGGCATCGGCATCGGCATCAGCATCGGCGTCCGCATCGGCATCGGCATCGGCATCGGCGTCGGCGTCGGCATCAGCATCGGCGTCGGCATCGGCATCGGCGTCGGCGTCGGCGTCGGCATCGGCGTCGGCATCGGCGTCCGCATCGGCATCGGCATCGGCATCGGCGTCGGCATCGGCATCCGCGTCCGCATCGGCGTCAGCATCGGCGTCAGCATCGGCATCGGCATCGGCATCGGCATCGGCATCGGCATCGGCATCGGCATCAGCGTCCGCATCGGCGTCGGCGTCGGCGTCCGCATCGGCGTCGGCATCGGCATCGGCATCGGCATCGGCATCGGCATCGGCATCGGCATCCGCATCGGCG
139005 NZ_CP033817.1 Klebsiella-aerogenes-strain-FDAARGOS_513-chromosome Bacteria 4510334-4515560 5227 261 18 GAATCGCTGT GAATCGCTGTCGGAGTCCGAATCGCTGTCGGAATCCGAATCGCTGTCGGAATCGGAATCGCTGTCGGAGTCCGAATCGCTGTCAGAGTCGGAATCGCTGTCAGAATCGGAGTCGCTGTCGGAGTCCGAATCGCTGTCAGAATCGGAGTCGCTGTCGGAATCGGAATCACTGTCGGAGTCCGAATCGCTGTCCGAATCCGAATCGCTGTCAGAGTCTGAATCACTGTCAGAGTCCGAGTCGCTGTCAGAGTCCGAGTCGCTGTCAGAGTCCGAGTCGCTGTCAGAGTCCGAGTCGCTGTCACTATCCGAATCACTGTCAGAGTCGGAATCGCTGTCGGAATCCGAGTCGCTGTCAGAGTCCGAATCACTGTCAGAGTCGGAATCGCTGTCGGAGTCCGAATCGCTGTCACTATCCGAATCGCTGTCGGAGTCGGAATCGCTGTCCGAATCCGAGTCGCTGTCAGAATCGGAGTCGCTGTCGGAGTCCGAATCGCTGTCGGAATCCGAGTCGCTGTCAGAGTCGGAATCACTGTCAGAGTCCGAATCGCTGTCGGAGTCCGAGTCGCTGTCAGAGTCCGAATCGCTGTCGGAGTCCGAATCGCTGTCACTATCCGAATCGCTGTCGGAGTCGGAATCGCTGTCCGAATCCGAATCGCTGTCCGAATCCGAATCGCTGTCCGAATCCGAGTCGCTGTCAGAATCGGAGTCGCTGTCGGAGTCCGAATCGCTGTCGGAATCCGAGTCGCTGTCCGAATCCGAATCGCTGTCCGAATCCGAGTCGCTGTCGGAATCCGAATCGCTGTCGGAGTCCGAGTCGCTGTCGGAGTCGGAGTCGCTGTCAGAGTCCGAATCGCTGTCAGAGTCGGAATCACTGTCAGAATCGGAATCGCTGTCAGAGTCTGAATCACTGTCAGAGTCTGAATCACTGTCAGAGTCCGAATCACTGTCGGAATCGGAATCACTGTCAGAGTCGGAATCACTGTCAGAGTCCGAATCGCTGTCGGAGTCCGAGTCGCTGTCAGAGTCCGAGTCGCTGTCAGAGTCCGAGTCGCTGTCAGAGTCCGAATCGCTGTCAGAATCGGAGTCGCTGTCGGAGTCCGAGTCGCTGTCAGAGTCGGAATCGCTGTCGGAATCCGAGTCGCTGTCAGAGTCGGAATCACTGTCAGAGTCCGAATCGCTGTCGGAGTCCGAGTCGCTGTCAGAGTCCGAGTCGCTGTCAGAGTCCGAATCGCTGTCGGAATCCGAGTCGCTGTCCGAATCCGAATCGCTGTCCGAATCCGAGTCGCTGTCGGAATCCGAATCGCTGTCGGAGTCCGAGTCGCTGTCGGAGTCGGAGTCGCTGTCAGAGTCCGAGTCGCTGTCAGAATCCGAATCACTGTCAGAATCCGAATCGCTGTCGGAATCAGAGTCGCTGTCAGAGTCCGAATCGCTGTCAGAATCGGAGTCGCTGTCGGAATCCGAATCGCTGTCGGAGTCGGAATCACTGTCAGAATCGGAGTCGCTGTCGGAGTCCGAGTCGCTGTCAGAATCGGAGTCGCTGTCGGAGTCCGAATCGCTGTCGGAGTCCGAATCGCTGTCAGAGTCGGAATCGCTGTCAGAATCGGAGTCGCTGTCGGAGTCCGAGTCGCTGTCGGAGTCCGAATCGCTGTCGGAGTCCGAATCGCTGTCAGAGTCGGAATCGCTGTCGGAGTCCGAATCGCTGTCAGAGTCGGAATCGCTGTCAGAATCGGAGTCGCTGTCGGAGTCCGAATCGCTGTCGGAGTCCGAATCGCTGTCAGAGTCGGAATCACTGTCAGAGTCCGAGTCGCTGTCGGAATCGGAATCACTGTCGGAGTCCGAGTCGCTGTCGGAATCCGAGTCGCTGTCGGAGTCGGAATCGCTGTCGGAGTCCGAATCGCTGTCGGAATCCGAATCGCTGTCGGAATCGGAATCGCTGTCGGAGTCCGAATCGCTGTCGGAGTCCGAATCGCTGTCAGAGTCGGAATCGCTGTCAGAGTCCGAATCACTGTCAGAGTCGGAATCGCTGTCGGAGTCCGAATCGCTGTCACTATCCGAATCGCTGTCGGAGTCGGAATCGCTGTCCGAATCCGAGTCGCTGTCCGAATCCGAGTCGCTGTCGGAATCCGAATCGCTGTCGGAGTCCGAGTCGCTGTCGGAGTCGGAGTCGCTGTCAGAGTCCGAGTCGCTGTCAGAATCCGAATCACTGTCAGAATCCGAATCGCTGTCGGAATCAGAGTCGCTGTCAGAGTCCGAATCGCTGTCAGAATCGGAGTCGCTGTCGGAATCCGAATCGCTGTCGGAGTCGGAATCACTGTCAGAATCGGAGTCGCTGTCGGAGTCCGAGTCGCTGTCAGAATCGGAGTCGCTGTCGGAGTCCGAATCGCTGTCGGAGTCCGAATCGCTGTCAGAGTCGGAATCGCTGTCAGAATCGGAGTCGCTGTCGGAGTCCGAGTCGCTGTCGGAGTCCGAATCGCTGTCGGAGTCCGAATCGCTGTCAGAGTCGGAATCGCTGTCAGAATCGGAGTCGCTGTCGGAGTCCGAATCGCTGTCAGAATCCGAATCGCTGTCGGAGTCGGAATCGCTGTCGGAATCCGAGTCGCTGTCAGAGTCGGAATCACTGTCAGAGTCCGAATCGCTGTCGGAGTCCGAGTCGCTGTCGGAGTCCGAGTCGCTGTCAGAGTCCGAGTCGCTGTCAGAGTCCGAATCGCTGTCAGAATCGGAGTCGCTGTCGGAGTCCGAGTCGCTGTCGGAATCGGAATCGCTGTCGGAGTCCGAATCGCTGTCGGAGTCCGAATCGCTGTCAGAGTCGGAATCGCTGTCAGAATCGGAATCGCTGTCAGAATCGGAGTCGCTGTCGGAGTCCGAGTCGCTGTCGGAGTCCGAATCGCTGTCAGAATCCGAATCGCTGTCGGAGTCCGAATCGCTGTCAGAATCGGAGTCGCTGTCGGAGTCCGAGTCGCTGTCGGAATCGGAATCGCTGTCAGAGTCCGAGTCGCTGTCAGAGTCCGAATCGCTGTCAGAATCGGAGTCGCTGTCGGAGTCGGAATCGCTGTCACTATCCGAATCACTGTCCGAATCCGAGTCGCTGTCAGAGTCCGAGTCGCTGTCCGAATCCGAGTCGCTGTCAGAGTCCGAGTCGCTGTCAGAGTCCGAGTCGCTGTCCGAATCCGAATCGCTGTCAGAGTCCGAATCGCTGTCGGAATCCGAGTCGCTGTCAGAGTCCGAATCGCTGTCGGAGTCGGAATCGCTGTCACTATCCGAATCACTGTCAGAGTCGGAATCGCTGTCGGAATCCGAGTCGCTGTCAGAGTCCGAATCGCTGTCACTATCCGAATCGCTGTCGGAGTCCGAGTCGCTGTCGGAATCCGAGTCGCTGTCCGAATCCGAATCGCTGTCCGAATCCGAATCGCTGTCAGAGTCCGAATCGCTGTCGGAGTCCGAATCGCTGTCAGAGTCCGAATCGCTGTCAGAGTCCGAATCGCTGTCGGAGTCCGAATCGCTGTCAGAGTCCGAGTCGCTGTCAGAGTCCGAATCGCTGTCAGAGTCCGAATCGCTGTCGCTATCCGAGTCGCTGTCAGAGTCGGAATCGCTGTCGCTATCCGAGTCGCTGTCAGAGTCGGAGTCGCTGTCGGAGTCCGAATCACTGTCAGAGTCCGAATCACTGTCAGAATCGGAATCACTGTCGGAATCTGAATCGCTGTCAGAGTCCGAATCACTGTCAGAATCGGAATCACTGTCGGAATCTGAATCGCTGTCAGAGTCCGAATCACTGTCAGAATCGGAGTCGCTGTCGGAGTCCGAATCGCTGTCGGAGTCCGAATCACTGTCAGAGTCCGAATCGCTGTCGGAGTCCGAATCGCTGTCAGAATCGGAATCGCTGTCGGAGTCCGAATCGCTGTCAGAGTCGGAATCGCTGTCGGAGTCCGAATCACTGTCGGAGTCCGAATCGCTGTCGGAATCCGAATCGCTGTCAGAGTCAGAATCACTGTCAGAGTCCGAGTCGCTGTCAGAGTCGGAGTCGCTGTCCGAATCC
127576 NZ_CP029614.1 Lactobacillus-johnsonii-strain-Byun-jo-01-chromosome Bacteria 888329-901055 12727 258 30 CTTACTGAGT CTTACTGAGTTACTTAAGCTTTCGCTCATGCTTACTGAGTTACTCAAGCTCTCACTCATGCTTACTGAGTTACTTAAGCTCTCACTCATGCTTACTGAGTTACTCAAGCTCTCACTCATGCTTACTGAATTGCTTAAGCTTTCACTCATGCTTACTGAGTTGCTCAAGCTTTCACTCATACTTACTGAGTTACTTAAGCTCTCGCTCATACTTACTGAGTTACTCAAACTCTCGCTCATACTTACTGAGTTACTCAAACTCTCGCTCATACTTACTGAGTTAGACAAACTTTCACTCATGCTTACTGAGTTGCTTAAGCTTTCGCTCATACTTACTGAGTTACTTAAGCTTTCACTCATACTTACTGAGTTGCTCAAACTCTCACTCATGCTTACTGAGTTACTCAAGCTCTCACTCATACTTACTGAGTTGCTTAAGCTCTCACTCATGCTTACTGAGTTACTTAAACTCTCGCTCATGCTTACTGAGTTACTTAGGCTCTCACTCATGCTTACTGAGTTGCTTAGGCTTTCACTCATGCTTACTGAGTTACTTAAGCTCTCACTCATACTTACTGAGTTGCTCAAGCTCTCACTCATACTTACTGAGTTACTCAAACTCTCACTCATGCTTACTGAGTTACTTAAGCTCTCGCTCATACTTACTGAGTTGCTTAAACTTTCGCTCATACTTACTGAGTTAGATAAGCTTTCACTCATACTTACTGAGTTGCTCATGCTTTCGCTCATACTTACTGAGTTAGATAAGCTTTCACTCATACTTACTGAGTTACTTAAGCTCTCGCTCATGCTTACTGAGTTGCTCATGCTTTCGCTCATGCTTACTGAGTTGCTCAAACTATCACTCATGCTTACTGAGTTACTTAAGCTTTCACTCATGCTTACTGAGTTACTCAAACTCTCACTCATGCTTACTAAGTTGCTCAAGCTATCACTCATGCTTACTGAGTTGCTTAGGCTATCACTCATGCTTACTGAGTTACTTAAGCTTTCACTCATGCTTACTGAGTTACTTAAACTTTCACTCATGCTTACTGAGTTACTCAAACTCTCACTCATGCTTACTGAGTTACTTAAGCTCTCGCTCATACTTACTGAGTTGCTTAAACTTTCGCTCATACTTACTGAGTTAGATAAGCTTTCACTCATACTTACTGAGTTGCTCATGCTTTCGCTCATACTTACTGAGTTAGATAAGCTTTCACTCATACTTACTGAGTTACTTAAGCTCTCGCTCATGCTTACTGAGTTGCTCATGCTTTCGCTCATGCTTACTGAGTTGCTCAAACTATCACTCATGCTTACTGAGTTACTTAAGCTTTCACTCATGCTTACTGAGTTACTCAAACTCTCACTCATGCTTACTAAGTTGCTCAAGCTATCACTCATGCTTACTGAGTTGCTTAGGCTATCACTCATGCTTACTGAGTTACTTAAGCTTTCACTCATGCTTACTGAGTTACTTAAACTTTCACTCATGCTTACTGAGTTACTCAAACTCTCACTCATGCTTACTGAGTTACTTAAGCTCTCGCTCATACTTACTGAGTTGCTTAAACTTTCGCTCATACTTACTGAGTTGCTTAAACTTTCGCTCATACTTACTGAGTTGCTTAAACTTTCGCTCATACTTACTGAGTTGCTTAAACTTTCGCTCATACTTACTGAGTTAGATAAGCTTTCACTCATACTTACTGAGTTGCTCATGCTTTCGCTCATACTTACTGAGTTAGATAAGCTTTCACTCATACTTACTGAGTTACTTAAGCTCTCGCTCATGCTTACTGAGTTGCTCATGCTTTCGCTCATGCTTACTGAGTTGCTCAAACTATCACTCATGCTTACTGAGTTACTTAAGCTTTCACTCATGCTTACTGAGTTACTCAAACTCTCACTCATGCTTACTAAGTTGCTCAAGCTATCACTCATGCTTACTGAGTTGCTTAGGCTATCACTCATGCTTACTGAGTTACTTAAGCTTTCACTCATGCTTACTGAGTTACTTAAACTTTCACTCATGCTTACTGAGTTACTTAGACTTTCACTCATGCTTACTGAGTTAGATAAGCTTTCACTCATGCTTACTGAGTTGCTTAAGCTTTCGCTCATACTTACTGAGTTGCTTAAGCTCTCACTCATACTTACTGAGTTACTCAAACTTTCACTCATGCTTACTGAGTTGCTTAAGCTTTCACTCATGCTTACTGAGTTACTTAAGCTTTCACTCATGCTTACTGAGTTACTCAAACTTTCACTCATGCTTACTGAGTTGCTCAAGCTCTCACTCATGCTTACTGAATTACTTAAGCTTTCGCTCATGCTTACTGAGTTACTCAAACTTTCGCTTATACTTACTGAGTTACTCAAACTCTCACTCATACTTACTGAGTTACTCAAGCTTTCACTCATGCTTACTGAGTTAGACAAACTTTCGCTCATACTTACTGAATTGCTTAAGCTCTCACTCATACTTACTGAGTCGCTTAAGCTCTCACTCATGCTTACTGAGTTGCTCAAACTCTCACTCATGCTTACTGAGTTACTTAAGCTTTCACTCATACTTACTGAGTTAGATAAGCTTTCACTCATGCTTACCGAGTTGCTCAAGCTTTCACTCATGCTTACTGAGTTGCTCAAACTTTCACTCATGCTTACTGAGTTACTTAAGCTTTCACTCATACTTACTGAGTTAGACAAGCTTTCGCTCATGCTTACTGAGTTACTTAAGCTTTCGCTCATGCTTACTGAGTTACTCAAACTCTCGCTCATACTTACTGAGTTGCTCAAACTCTCACTCATGCTTACTGAGTTGCTCATGCTTTCGCTCATGCTTACCGAGTTACTTAAGCTCTCACTCATGCTTACTGAATTACTCAAGCTCTCGCTCATGCTTACTGAGTTACTCAAGCTCTCACTCATGCTTACTGAGTTACTCAAGCTCTCACTCATGCTTACTGAGTTACTCAAGCTTTCGCTCATGCTTACTGAGTTGCTCATGCTCTCACTCATACTTACTGAGTTACTCAAGCTTTCGCTCATGCTTACTGAGTTACTTAAGCTTTCACTCATGCTTACTGAGTTACTTAAGCTTTCACTCATGCTTACTGAGTTACTCAAGCTTTCGCTCATGCTTACCGAGTTACTTAAACTTTCACTCATGCTTACTGAGTTGCTCAAGCTCTCGCTCATACTTATTGAGTTACTCAAGCTCTCACTCATGCTTACTGAGTTGCTTAAGCTCTCGCTCATACTTACTGAGTTAGATAAGCTTTCGCTCATACTTACTGAGTTACTCAAACTTTCACTCATGCTTACCGAGTTGCTTAGGCTCTCACTCATACTTACTGAGTTACTCAAACTCTCGCTCATGCTTACTGAGTTGCTTAAGCTTTCACTCATGCTTACTGAGTTACTCAAACTTTCACTCATGCTTACTGAGTTGCTCAAGCTCTCACTCATGCTTACTGAATTACTTAAGCTTTCGCTCATGCTTACTGAGTTACTCAAACTTTCGCTTATACTTACTGAGTTACTCAAACTCTCACTCATACTTACTGAGTTACTCAAGCTTTCACTCATGCTTACTGAGTTAGACAAACTTTCGCTCATACTTACTGAATTGCTTAAGCTCTCACTCATACTTACTGAGTCGCTTAAGCTCTCACTCATGCTTACTGAGTTGCTCAAACTCTCACTCATGCTTACTGAGTTACTTAAGCTTTCACTCATACTTACTGAGTTAGATAAGCTTTCACTCATGCTTACTGAGTTACTTAAGCTCTCACTCATACTTACTGAGTTAGATAAGCTTTCACTCATGCTTACCGAGTTGCTCAAGCTTTCACTCATGCTTACTGAGTTGCTCAAACTTTCACTCATGCTTACTGAGTTACTTAAGCTTTCACTCATACTTACTGAGTTAGACAAGCTTTCGCTCATGCTTACTGAGTTACTTAAGCTTTCGCTCATGCTTACTGAGTTACTCAAACTCTCGCTCATACTTACTGAGTTGCTCAAACTCTCACTCATGCTTACTGAGTTGCTCATGCTTTCGCTCATGCTTACCGAGTTACTTAAGCTCTCACTCATGCTTACTGAATTACTCAAGCTCTCGCTCATGCTTACTGAGTTACTCAAGCTCTCACTCATGCTTACTGAGTTACTCAAGCTCTCACTCATGCTTACTGAGTTACTCAAGCTTTCGCTCATGCTTACTGAGTTGCTCATGCTCTCACTCATACTTACTGAGTTACTCAAGCTTTCGCTCATGCTTACTGAGTTACTTAAGCTTTCACTCATGCTTACTGAGTTACTTAAGCTTTCACTCATGCTTACTGAGTTACTCAAGCTTTCGCTCATGCTTACCGAGTTACTTAAACTTTCACTCATGCTTACTGAGTTGCTCAAGCTCTCGCTCATGCTTACTGAGTTGCTTAAGCTCTCGCTCATACTTACTGAGTTAGATAAGCTTTCGCTCATACTTATTGAGTTACTCAAGCTCTCACTCATGCTTACTGAGTTGCTTAAGCTCTCGCTCATACTTACTGAGTTAGATAAGCTTTCGCTCATACTTACTGAGTTACTCAAACTTTCACTCATGCTTACCGAGTTGCTTAGGCTCTCACTCATACTTACTGAGTTACTCAAACTCTCGCTCATGCTTACTGAGTTGCTTAAGCTTTCACTCATGCTTACTGAGTTACTCAAGCTTTCGCTCATGCTTACTGAGTTACTCAGGCTTTCACTCATACTTACTGAGTTTGATAAGCTTTCACTCATG
65363 NZ_CP013118.1 Salinivirga-cyanobacteriivorans-strain-L21-Spi-D4-chromosome Bacteria 4177909-4196880 18972 256 66 CCGCACCAAA CCGCACCAAAATGGAATTGAAATGTCGTATCAATTGATACAGCATTTTGCCCGTAAAAGCTTCCAACCGCACCAAAATGGAATTGAAATCAATTTACTAAGACGTGCTTGGCTCTTAACCATACGCTTCCAACCGCACCAAAATGGAATTGAAATATTGTTGCGAGAGTTAACTTAATGACGTCTTTCCACCTTCCAACCGCACCAAAATGGAATTGAAATTTAAACAGCAATTAAAACGCGATCTCGAGAAATGGGCTTCCAACCGCACCAAAATGGAATTGAAATAAAATTGATACAATTACAGGAATTAAAGCACCGACACTTCCAACCGCACCAAAATGGAATTGAAATCACAAATACAGGGCAGTAACGATGGAACTTTTTGGACTTCCAACCGCACCAAAATGGAATTGAAATATACCCCGTCAATGATACTAGCTTTTTTTATCAGTACTTCCAACCGCACCAAAATGGAATTGAAATCTTATAGTCCGAGGATTCTTATCGTTTACTTTTATTCTTCCAACCGCACCAAAATGGAATTGAAATACCACCAACTATCCATGAATCATATTTTAATTTTAACTTCCAACCGCACCAAAATGGAATTGAAATAAAAATATTATCTCTCAACAAATATAACTCCATCAACTTCCAACCGCACCAAAATGGAATTGAAATACGAAGGCGAAACTGTTCTTGATAATACAATGGGTACTTCCAACCGCACCAAAATGGAATTGAAATCAGTTTTTTTTGTCCCTTCGCTGGCTTCGCTCAATCCTTCCAACCGCACCAAAATGGAATTGAAATATCGTCAAAAATTCAGAAGGGTACGGCTATAATTACCTTCCAACCGCACCAAAATGGAATTGAAATTCCGCCAGTTAGTAGGATAGTCTTATATCGGGCAACCTTCCAACCGCACCAAAATGGAATTGAAATAATTGTATCACTCTATATTGAAGGAAATGGAAAATGCTTCCAACCGCACCAAAATGGAATTGAAATTACATATCCATCATGCTTTCCCGTATCAATCCCATACTTCCAACCGCACCAAAATGGAATTGAAATTAAGAAGCCCCACCGCCACAACAGTATAAATCAAGCCTTCCAACCGCACCAAAATGGAATTGAAATGAGAAAGTGGATGAATTGATTGCGCATAAGGCAACTCTTCCAACCGCACCAAAATGGAATTGAAATTTGAAATTGAATACAATAGTAGTGAAAATGATGGTGCTTCCAACCGCACCAAAATGGAATTGAAATATATAATTTTTCAGGCACTTATGATGGAAATGAGTTCTTCCAACCGCACCAAAATGGAATTGAAATTGAGCAGGATGACAAGATAAAGGATTTACAGATCAACTTCCAACCGCACCAAAATGGAATTGAAATACCTGAGAGCTTTGAGTCGCCCAGCTTTGTAGTATCCTTCCAACCGCACCAAAATGGAATTGAAATGTTGTTGAATTTAAAATTTAAAAATATGAAAACTACCTTCCAACCGCACCAAAATGGAATTGAAATTACACATCATGAAAAATTTAACAAAAATTATCGATTCTTCCAACCGCACCAAAATGGAATTGAAATGGTTTACTGTACACTAAAACACGTGAATTATGGCAACTTCCAACCGCACCAAAATGGAATTGAAATATGATGGGAATTCTGAATACTATCAACGGAGCTACGCTTCCAACCGCACCAAAATGGAATTGAAATCCAGAATGTTGGCCGGTTTTAGGGCTTATGCAGAACCTTCCAACCGCACCAAAATGGAATTGAAATTACCTTCCAAATCCTCAGATTTGAATTCTTCATTACCTTCCAACCGCACCAAAATGGAATTGAAATATGCTAACGGACCTAATGCGGCAGTCAATCCTCCTACTTCCAACCGCACCAAAATGGAATTGAAATATGTCATCAATTGCCATAAATTGCATATCAGGATCACTTCCAACCGCACCAAAATGGAATTGAAATATGCAGGCACATCTTAGCGCCTTTGTACATCCATGGCTTCCAACCGCACCAAAATGGAATTGAAATTCAAAATAATGATCCATGTTTTCATGCATCACTGCTCTTCCAACCGCACCAAAATGGAATTGAAATGAACAAGTTTTAGGCAGGCATTATTTTTTATGGCTTCTTCCAACCGCACCAAAATGGAATTGAAATATGCTAATCGAACAATTACTTCATACAATTCATAATCTTCCAACCGCACCAAAATGGAATTGAAATATGTAAGCAACTTATTGTTTACTTTAAGATATGATGCTTCCAACCGCACCAAAATGGAATTGAAATAAAATAGTATCATCGGCCATTTCTTCCTTTCTACTACTTCCAACCGCACCAAAATGGAATTGAAATCAATTAAAAGGGCAAAAGTTAAACGATAAGTTTTCCCTTCCAACCGCACCAAAATGGAATTGAAATTACACATCATGAAAAATTTAACAAAAATTATCGATTCTTCCAACCGCACCAAAATGGAATTGAAATCTTATAGTCCGAGGATTCTTATCGTTTACTTTTATTCTTCCAACCGCACCAAAATGGAATTGAAATGAGCCATGAGCCAATAAGCTCAACCGTGATATTTTTCTTCCAACCGCACCAAAATGGAATTGAAATCGAATTAATGATGATTAAAAGGAAAATTGATTAGTTCTTCCAACCGCACCAAAATGGAATTGAAATATGTCATCAATTTCCATAAATTGCATATCAGGATCACTTCCAACCGCACCAAAATGGAATTGAAATTAGATAAAAAATTTAGACCTTCGGCAGCTTCTGTGGCTTCCAACCGCACCAAAATGGAATTGAAATTAGTTTATTATTACTATCTCCCCCTATACTATATTACTTCCAACCGCACCAAAATGGAATTGAAATTTACATCAGCGTTTGAGATATTAAATAAATCTTTGTCTTCCAACCGCACCAAAATGGAATTGAAATATGTTTAACGAATTTATACAATACATGGGACATTTTCTTCCAACCGCACCAAAATGGAATTGAAATTGAATGGTTTATTCAGTGCGTTTGGGCAGCGTTTTGCTTCCAACCGCACCAAAATGGAATTGAAATCGAAAATGGCTTGGTTGAAGGCGCTAACGAAATGCGCTTCCAACCGCACCAAAATGGAATTGAAATAAAAACAAGCTAAAACAGCCGTTAACAGATTAAATCCTTCCAACCGCACCAAAATGGAATTGAAATACATTAAAATAATTTAAAAATTATACATTATGAGAACTTCCAACCGCACCAAAATGGAATTGAAATTAATTAGCAAGGTGCTTTCTTCGATAGCTGTTTTCCCTTCCAACCGCACCAAAATGGAATTGAAATATAGTCGTTACGTGAGTAACGGCTTTGGTGTGAGTGCTTCCAACCGCACCAAAATGGAATTGAAATTTAATATCGGGGTTTTCCCTGAATTTACAAGGATTACTTCCAACCGCACCAAAATGGAATTGAAATTAGGGCGCATTTTATCTCCTGCGCTCCGTCGCAGGACTTCCAACCGCACCAAAATGGAATTGAAATTGTAGATGAAACAGAATACATTTTAAAGTTACCTGACTTCCAACCGCACCAAAATGGAATTGAAATCAATGTGTTTGAGGAGTACACGGCGGCCGGGGCAATCTTCCAACCGCACCAAAATGGAATTGAAATTAATTACCTCCTTTGTATTTCTAAATTAAATATAAACTTCCAACCGCACCAAAATGGAATTGAAATTTAATATCGGGGTTTTCCCTGAATTTACAAGGATTACTTCCAACCGCACCAAAATGGAATTGAAATTAGGGCGCATTTTATCTCCTGCGCTCCGTCGCAGGACTTCCAACCGCACCAAAATGGAATTGAAATTGTAGATGAAACAGAATACATTTTAAAGTTACCTGACTTCCAACCGCACCAAAATGGAATTGAAATCAATGTGTTTGAGGAGTACACGGCGGCCGGGGCAATCTTCCAACCGCACCAAAATGGAATTGAAATTAATTACCTCCTTTGTATTTCTAAATTAAATATAAACTTCCAACCGCACCAAAATGGAATTGAAATTTGTTTTCGCTTCCTTTGTTGTAGTTTCCCACGTTGCTTCCAACCGCACCAAAATGGAATTGAAATTATTTACACGGGGCATACTTTGTAATGTCTGGTTTCCTTCCAACCGCACCAAAATGGAATTGAAATTACTATCAGGATCGCCCGTTTCTGAGCGTGCCACAACTTCCAACCGCACCAAAATGGAATTGAAATTTCTCATAACAGGTGCGGCACGCTCAGGAACTAGTACTTCCAACCGCACCAAAATGGAATTGAAATGGAAGATTAACTCCTAGAGAACTGAAAATATCTGTGCTTCCAACCGCACCAAAATGGAATTGAAATATATACTACGTGCTCATTTTCTTTGAATATTTCCGGCTTCCAACCGCACCAAAATGGAATTGAAATGGAAAAAACATAAAACAATTAACAAGTAGAATTAATCTTCCAACCGCACCAAAATGGAATTGAAATTCGAAAAAAAGGTAGAAGAACTTCCAATACATGAACCTTCCAACCGCACCAAAATGGAATTGAAATAACTCTCATATTGACACAATTTTATCAAGAAGGCCACTTCCAACCGCACCAAAATGGAATTGAAATATAGTACCTGATTCCATAAACCATGTAACATCATTACTTCCAACCGCACCAAAATGGAATTGAAATTCATACCCAATAATATCAATCCATTCTTCCCCTTGACTTCCAACCGCACCAAAATGGAATTGAAATAAGAATGGGCGTACAAAATGAAAGGGAAATGTATAGCTTCCAACCGCACCAAAATGGAATTGAAATATACTGGACCATTCCGTACGGGTTTTGCATAATTTGCTTCCAACCGCACCAAAATGGAATTGAAATGCAGCCAAGACGCGGATCAATGGAACGCTTTTATTACTTCCAACCGCACCAAAATGGAATTGAAATTGGTTGATTTTCTTTTAATCCTTGCCGTTTCATTATCTTCCAACCGCACCAAAATGGAATTGAAATGCCAGCACTGAAGAACAGGATGATGTTCAAGATATACTTCCAACCGCACCAAAATGGAATTGAAATCTTCCATTGCTTTCCAGCAAATCCCCCTGTAAAATGCTTCCAACCGCACCAAAATGGAATTGAAATGCACCAGAATGGGCTTGAACTTTACCCGCGCTGGTGCTTCCAACCGCACCAAAATGGAATTGAAATCTAGGAACATTGGTTTACCTGTCTGCGAATAGTATTCTTCCAACCGCACCAAAATGGAATTGAAATTATCCTGTCTAATATAACGTGCAAAATAATCCCTGACTTCCAACCGCACCAAAATGGAATTGAAATTTATATGATTTGAAAAATTATGCCCTTTTTTCGTAACTTCCAACCGCACCAAAATGGAATTGAAATCTTAGAGACGCAAGAATTTAAAACGAAGATATTATGCTTCCAACCGCACCAAAATGGAATTGAAATTTTCTATTCAACTTAAAAAAGGAGATAGTATAGAGGCTTCCAACCGCACCAAAATGGAATTGAAATTTGTACCTTTTTGCAATAATGTAAGTAGAGCGGGCCCTTCCAACCGCACCAAAATGGAATTGAAATACGGTAATTTTTTCCATTTGAATTTCATTGACGGCTCTTCCAACCGCACCAAAATGGAATTGAAATGTGGATGTTTCAGGCGTGAAGATTAGAAAAGGTGAGCTTCCAACCGCACCAAAATGGAATTGAAATAATACGCTACAAACAACAAGGAGATAAAGATGCTGGCTTCCAACCGCACCAAAATGGAATTGAAATACGGAAGATTTTGAGGCACAATGGCACGCATTTAAGCTTCCAACCGCACCAAAATGGAATTGAAATGAAATTTACTCAGCACAGTACTGCTGATTATCGGAGCTTCCAACCGCACCAAAATGGAATTGAAATAATCAAACTTCAAGGTTATTAAGAGGGAATATCACACTTCCAACCGCACCAAAATGGAATTGAAATACGAAGGCGAAACTGTTCTTGATAATACAATGGGTACTTCCAACCGCACCAAAATGGAATTGAAATACATAAAAGAAAACCTAAAAGAAATTCCAGAGGTTTCTTCCAACCGCACCAAAATGGAATTGAAATATCGCTGCATGTCCTCAAAATACCGTCCGTATGGTTCTTCCAACCGCACCAAAATGGAATTGAAATCAATTATTTAATCCAGCAACCTTAATATAAACCTGTCTTCCAACCGCACCAAAATGGAATTGAAATAAGGAAACAATAAAAATATTGAAAATGATATTAATACTTCCAACCGCACCAAAATGGAATTGAAATATGCAATTGCATTAATACCATCAATTGCATTTAAAGCTTCCAACCGCACCAAAATGGAATTGAAATATGAAAGACTTTATTTTGCCCGCAGCATTGACAAGGCTTCCAACCGCACCAAAATGGAATTGAAATTGCGATGTACTTCATTATATCGCAATTCTCAATTTTCTTCCAACCGCACCAAAATGGAATTGAAATCAGTTACTTGGTGGGAAATAGCGCGCGGGATAGTGGCTTCCAACCGCACCAAAATGGAATTGAAATTCAGACAAAGTTGCAAAAGTCTTTATTCCAGTATCACTTCCAACCGCACCAAAATGGAATTGAAATTTATCTCTCAGGTAATAGCTATCATCTTCCGGCTCTCTTCCAACCGCACCAAAATGGAATTGAAATTAATTAAGGTATGTGTCGGGGTCGTAGCTCACAAACCTTCCAACCGCACCAAAATGGAATTGAAATTTGGGCGGCGTTATTAATGGGATAAAAGGGATGACCCTTCCAACCGCACCAAAATGGAATTGAAATTATTATAGACCCAATTAGATATGCAGTAAGATTTTACTTCCAACCGCACCAAAATGGAATTGAAATATTTCAGGCCCTTGTGATATTTCGGTAAAGTAATCACTTCCAACCGCACCAAAATGGAATTGAAATAAATGTCGTAATAAGTCCACCTTATCCCGGTGTGTTCTTCCAACCGCACCAAAATGGAATTGAAATAGGGCAAAAAAGGCTTAGTACCCAAAGCCCTAACTACTTCCAACCGCACCAAAATGGAATTGAAATAACTTACAGGCAAACAACACAAACATGTTTTAGTTGCTTCCAACCGCACCAAAATGGAATTGAAATATGCCAAGCAAATAAGTTTGTTTTAACTATTGTAGCCTTCCAACCGCACCAAAATGGAATTGAAATTCGTACATTGTTGTACGAATATCATAAGTGGATGCGCTTCCAACCGCACCAAAATGGAATTGAAATATATAATTTGATATTGCGTATGCAAATCGAAAATTACTTCCAACCGCACCAAAATGGAATTGAAATCATTAAGCGGGTTTTTTTCTTACTATATATAAAATTCTTCCAACCGCACCAAAATGGAATTGAAATATTTTTGTTCATCATTCTTTTTCATAATTTTATATCCTTCCAACCGCACCAAAATGGAATTGAAATATATAATCTTTTATGCTAAATGGATTATATTCTCTACTTCCAACCGCACCAAAATGGAATTGAAATAATACGCTACAAACAACAAGGAGATAAAGATGCTGGCTTCCAACCGCACCAAAATGGAATTGAAATAACGCAAAACCATTTTGCAAAAATGGTAAGTAGGCTCTTCCAACCGCACCAAAATGGAATTGAAATAATATCGAAATACTCGATAAACTTGCGGTCTTCGCTCTTCCAACCGCACCAAAATGGAATTGAAATGAAATTTACTCAGCACAGTACTGCTGATTATCGGAGCTTCCAACCGCACCAAAATGGAATTGAAATTTAGAATTAAAAAACTTTGTAAAGGCTAACCGCCTGCTTCCAACCGCACCAAAATGGAATTGAAATCAGCTAAAGCCATGTTAATATATGCCATTTTAAGCTCTTCCAACCGCACCAAAATGGAATTGAAATAATCAAACTTCAAGGTTATTAAGAGGGAATATCACACTTCCAACCGCACCAAAATGGAATTGAAATACGAAGGCGAAACTGTTCTTGATAATACAATGGGTACTTCCAACCGCACCAAAATGGAATTGAAATTTCCTTTAACATTCAATGCATCACGCTCACCACTGGCTTCCAACCGCACCAAAATGGAATTGAAATATCAGTATTGCTAAGAAGCGATAATGAACAGGCAGCCTTCCAACCGCACCAAAATGGAATTGAAATTCGGGAATGCTTTTGCCGTAAGATTCATTGCAGATACTTCCAACCGCACCAAAATGGAATTGAAATCCTTCTGATTCCCACTCAATATTCTGAATAGGCATGCTTCCAACCGCACCAAAATGGAATTGAAATATTCTAAATGAATGATTGACAGCAATTACTTTCTTCCTTCCAACCGCACCAAAATGGAATTGAAATACAACGTCTTACTGAATTGCGGAAGGAGGGTGCGCACTTCCAACCGCACCAAAATGGAATTGAAATTACTTTCCAAATCCTCAGGTTTGAATTCTTCATTACCTTCCAACCGCACCAAAATGGAATTGAAATAACGAATCTATTGATCTTTCGATTTATTCTCCGCCCCTTCCAACCGCACCAAAATGGAATTGAAATATCCTAATAAACTATTTGTTACTAGTAAATCCTTTACTTCCAACCGCACCAAAATGGAATTGAAATTTCCTTTAACATTCAATGCATCACGCTCACCACTGGCTTCCAACCGCACCAAAATGGAATTGAAATATCAGTATTGCTAAGAAGCGATAATGAACAGGCAGCCTTCCAACCGCACCAAAATGGAATTGAAATTCGGGAATGCTTTTGCCGTAAGATTCATTGCAGATACTTCCAACCGCACCAAAATGGAATTGAAATCCTTCTGATTCCCACTCAATATTCTGAATAGGCATGCTTCCAACCGCACCAAAATGGAATTGAAATATTCTAAATGAATGATTGACAGCAATTACTTTCTTCCTTCCAACCGCACCAAAATGGAATTGAAATACAACGTCTTACTGAATTGCGGAAGGAGGGTGCGCACTTCCAACCGCACCAAAATGGAATTGAAATTACTTTCCAAATCCTCAGGTTTGAATTCTTCATTACCTTCCAACCGCACCAAAATGGAATTGAAATAACGAATCTATTGATCTTTCGATTTATTCTCCGCCCCTTCCAACCGCACCAAAATGGAATTGAAATATCCTAATAAACTATTTGTTACTAGTAAATCCTTTACTTCCAACCGCACCAAAATGGAATTGAAATATGATCCGACTTTTCCAACCTTCAGAAAAAATCATTCTTCCAACCGCACCAAAATGGAATTGAAATATAAAATTACTATGCCAAATGCACAAGTCCAGTAATCTTCCAACCGCACCAAAATGGAATTGAAATTAACAGAATTAATTGCGGTTGGTATTGTTGCACATACTTCCAACCGCACCAAAATGGAATTGAAATTATTTTCGCCCTGCCTGCGTTTATTTCGATAGTTTCCTTCCAACCGCACCAAAATGGAATTGAAATATTCTAAATGAATGATTGACAGCAATTACTTTCTTCCTTCCAACCGCACCAAAATGGAATTGAAATTCGAAATAAGGCGGGTCAACTACTGCTAAGTCAAAACTTCCAACCGCACCAAAATGGAATTGAAATCTGATTAAAGCCTATTCCCTGGGCATTCATAACATACTTCCAACCGCACCAAAATGGAATTGAAATATACGTTTAAAGCCTTCGTATGTGACAACTGTAATGCTTCCAACCGCACCAAAATGGAATTGAAATATGATATTACCAAAATTTATTGTTATTGCAATTCTTCTTCCAACCGCACCAAAATGGAATTGAAATATCCTTGTCGCCCTCAGTGAATTTAGTTGCCTTATGCTTCCAACCGCACCAAAATGGAATTGAAATAAACAATTGCTGAATCACTAGGAGATATAAAAATTGCTTCCAACCGCACCAAAATGGAATTGAAATTATATAGTGTAGAATTTTGCGGGCAATTGTTTTATTCTTCCAACCGCACCAAAATGGAATTGAAATATTAGTGTCTAATTACGATATAATTGCATTAGAGGACTTCCAACCGCACCAAAATGGAATTGAAATACTGGAAGCGGCAAAACGGTTATTTTCAGTTACATTCTTCCAACCGCACCAAAATGGAATTGAAATGACCAAAGGGATGCAACAACAATTTCATTTAATGCACTTCCAACCGCACCAAAATGGAATTGAAATGATCTAATGTTAAATTCATTGAGTGCGTCAAATCGGCTTCCAACCGCACCAAAATGGAATTGAAATATCGGATTAATTTTTCATCTGTCATGACCCTTTGGTCTTCCAACCGCACCAAAATGGAATTGAAATGTACTTCGGTACTGATGGGTGGGAACCCAACGTTGACTTCCAACCGCACCAAAATGGAATTGAAATACCTTACCCACTTATTGAAATTGATGTGATTAAAAACTTCCAACCGCACCAAAATGGAATTGAAATAACTTGAAACACGGAACCTGAAACCTGAAACATGGACTTCCAACCGCACCAAAATGGAATTGAAATCCACATTAGATTTAGCTGCCGCGGGTAATATGAAGTCTTCCAACCGCACCAAAATGGAATTGAAATTAGTGAGCTGTTTCAAATTGCGGATAGTTTTAATAACTTCCAACCGCACCAAAATGGAATTGAAATTTGGATGTGAGTGTAGGGGTGTTCACGGATGAGGAACTTCCAACCGCACCAAAATGGAATTGAAATGCTCTCGATGGATGGAAAGGTACGTGGGCAGAATGACTTCCAACCGCACCAAAATGGAATTGAAATTTTGAGAGCGCATCTCATCTGGTAGCATTTTCATGACTTCCAACCGCACCAAAATGGAATTGAAATAGAGGTGTTACACCTTTGGATACTTCTGTAAGAAAACTTCCAACCGCACCAAAATGGAATTGAAATCTCACAAATAAATTGCGGCGGGTTGAATGTTGATAGCTTCCAACCGCACCAAAATGGAATTGAAATATACATGTAAGTCAAACTAGAAGGCAAGTCGGCAACCTTCCAACCGCACCAAAATGGAATTGAAATAAAAATATGATAAAATTAAGACCTTACCAAGAAAGACTTCCAACCGCACCAAAATGGAATTGAAATTTCTTTACTTTTCTTCAATGCATAATCAGCAGCGGCCTTCCAACCGCACCAAAATGGAATTGAAATGTCGTATCAATTGATACAGCATTTTGCCCGTAAAAGCTTCCAACCGCACCAAAATGGAATTGAAATCAATTTACTAAGACGTGCTTGGCTCTTAACCATACGCTTCCAACCGCACCAAAATGGAATTGAAATATTATCAAATTCGTAGAAAGTGTATGCGTTCAAACCCTTCCAACCGCACCAAAATGGAATTGAAATCCACCAAAGTCATTCCTAAAAATGAAAATACGTTCACTTCCAACCGCACCAAAATGGAATTGAAATCTTGTTGGTGCCATGTTCCTTTATACCAGCTTACTTCTTCCAACCGCACCAAAATGGAATTGAAATGGCTTTCTTTTTTCGGGCAAATTTAAAACCTAGCGACTTCCAACCGCACCAAAATGGAATTGAAATATTGTTGCGAGAGTTAACTTAATGACGTCTTTCCACCTTCCAACCGCACCAAAATGGAATTGAAATTTAAACAGCAATTAAAACGCGATCTCGAGAAATGGGCTTCCAACCGCACCAAAATGGAATTGAAATATTGATTGGAATTGTCGTTGCAGGGTTAAACGAGTTCTTCCAA
166397 NZ_LR594038.1 Klebsiella-oxytoca-strain-NCTC9146-genome-assembly Bacteria 3691669-3696949 5281 256 18 GAGTCGCTGT GAGTCGCTGTCAGAGTCCGAGTCGCTGTCCGAGTCAGAATCGCTGTCAGAGTCCGAGTCGCTGTCGGAATCGGAGTCGCTGTCTGAATCCGAATCGCTGTCTGAATCCGAGTCGCTGTCAGAGTCAGAATCGCTGTCAGAATCCGAATCGCTGTCGGAATCCGAATCGCTGTCGCTATCCGAGTCGCTGTCCGAATCCGAGTCGCTGTCGGAGTCTGAGTCACTGTCGGAATCCGAATCGCTGTCGGAATCCGAGTCGCTGTCGGAATCCGAGTCGCTGTCCGAATCCGAGTCGCTGTCCGAGTCAGAATCGCTGTCGGAATCGGAGTCACTGTCGGAATCCGAGTCACTGTCGGAATCCGAGTCGCTGTCAGAGTCGGAATCGCTGTCAGAGTCCGAGTCGCTGTCAGAATCGGAGTCACTGTCTGCATCGGAATCGCTGTCGGAGTCAGAGTCGCTGTCAGAATCGGAGTCACTGTCGGAGTCGGAGTCGCTGTCAGAGTCTGAGTCGCTGTCGCTATCAGAGTCGCTGTCAGAATCGGAGTCGCTGTCAGAGTCTGAGTCGCTGTCGCTATCAGAATCGCTGTCAGAATCCGAGTCACTGTCAGAATCCGAGTCGCTGTCAGAATCCGAATCGCTGTCAGAGTCTGAATCGCTGTCAGAGTCGGAGTCGCTGTCAGAGTCAGAATCGCTGTCGGAATCCGAGTCACTGTCAGAATCGGAGTCGCTGTCGCTATCCGAGTCGCTGTCAGAATCGGAGTCGCTGTCGGAATCCGAGTCGCTGTCCGAGTCAGAATCGCTGTCGGAATCGGAGTCACTGTCGGAATCCGAGTCGCTGTCCGAGTCAGAATCGCTGTCGGAATCGGAGTCACTGTCGGAATCCGAGTCACTGTCGGAATCCGAATCGCTGTCCGAATCCGAGTCACTGTCCGAATCCGAGTCACTGTCCGAATCCGAGTCGCTGTCAGAGTCGGAGTCGCTGTCCGAATCCGAGTCACTGTCAGAATCCGAATCGCTGTCAGAGTCGGAGTCGCTGTCGGAATCCGAATCGCTGTCGCTATCAGAATCGCTGTCCGAGTCCGAGTCGCTGTCGGAATCCGAGTCGCTGTCCGAGTCGGAGTCGCTGTCAGAATCGGAGTCGCTGTCAGAATCGGAGTCGCTGTCAGAGTCTGAATCGCTGTCGGAGTCAGAGTCGCTGTCGGAGTCAGAGTCGCTGTCCGAATCCGAGTCACTGTCAGAATCCGAATCGCTGTCAGAGTCGGAGTCGCTGTCGGAATCCGAATCGCTGTCGCTATCAGAATCGCTGTCCGAGTCCGAGTCGCTGTCGGAATCCGAGTCGCTGTCCGAGTCGGAGTCGCTGTCAGAATCCGAGTCGCTGTCCGAATCCGAGTCACTGTCAGAATCCGAATCGCTGTCAGAGTCGGAGTCGCTGTCGGAATCCGAATCGCTGTCAGAGTCAGAATCGCTGTCGCTATCCGAGTCGCTGTCCGAATCCGAGTCGCTGTCAGAGTCCGAATCGCTGTCGGAATCCGAGTCACTGTCCGAATCCGAGTCGCTGTCGGAATCCGAGTCACTGTCCGAATCCGAGTCGCTGTCGGAATCCGAATCGCTGTCAGAATCCGAATCGCTGTCGGAGTCAGAGTCGCTGTCGGAATCCGAATCGCTGTCCGAATCCGAGTCACTGTCCGAATCAGAATCGCTGTCTGAATCCGAATCGCTGTCGCTATCAGAGTCGCTGTCAGAGTCGGAGTCGCTGTCGGAGTCAGAGTCGCTGTCCGAATCCGAGTCGCTGTCAGAGTCTGAGTCGCTGTCAGAATCCGAGTCGCTGTCAGAGTCCGAATCGCTGTCGGAGTCAGAGTCGCTGTCGGAATCCGAATCGCTGTCCGAATCCGAGTCACTGTCCGAATCCGAATCGCTGTCAGAGTCAGAATCGCTGTCAGAATCCGAGTCACTGTCGGAATCGGAGTCGCTATCGGAATCCGAGTCGCTGTCCGAATCCGAGTCGCTGTCAGAGTCGGAATCGCTGTCAGAGTCCGAGTCGCTGTCAGAATCCGAGTCACTGTCGGAGTCTGAATCGCTGTCAGAGTCGGAATCGCTGTCTGAATCCGAGTCACTGTCCGAATCCGAGTCACTGTCCGAATCCGAGTCGCTGTCCGAATCCGAGTCGCTGTCGGAGTCAGAGTCGCTGTCAGAATCCGAATCGCTGTCAGAATCCGAATCGCTGTCGGAATCCGAATCGCTGTCGGAATCCGAGTCGCTGTCAGAGTCAGAATCGCTGTCCGAGTCCGAATCGCTGTCGGAATCTGAGTCGCTGTCGGAATCCGAATCGCTGTCAGAATCCGAATCGCTGTCGCTATCAGAGTCGCTGTCGGAATCGGAATCGCTGTCCGAATCCGAATCGCTGTCAGAGTCCGAGTCGCTGTCGGAATCCGAGTCACTGTCCGAATCCGAGTCGCTGTCAGAGTCTGAGTCGCTGTCAGAGTCCGAATCGCTGTCGGAATCCGAGTCGCTGTCAGAGTCTGAATCGCTGTCCGAATCCGAGTCACTGTCCGAATCCGAGTCACTGTCGGAATCCGAATCGCTGTCAGAGTCCGAGTCGCTGTCAGAATCGGAGTCACTGTCTGCATCGGAATCGCTGTCGCTATCAGAGTCGCTGTCGGAGTCGGAATCGCTGTCGGAATCAGAATCGCTGTCGGAGTCAGAGTCGCTGTCAGAATCGGAGTCGCTGTCAGAGTCTGAGTCGCTGTCCGAGTCAGAATCGCTGTCGGAATCCGAGTCACTGTCGGAATCCGAGTCACTGTCCGAATCCGAGTCGCTGTCGGAATCGGAATCGCTGTCCGAATCCGAATCGCTGTCAGAGTCTGAATCGCTGTCCGAATCCGAGTCACTGTCCGAATCCGAGTCGCTGTCGGAATCGGAATCGCTGTCCGAATCCGAATCGCTGTCAGAGTCTGAATCGCTGTCCGAATCCGAGTCACTGTCGGAATCGGAGTCACTGTCGGAGTCGGAATCGCTGTCGGAATCCGAGTCACTGTCAGAGTCGGAGTCGCTGTCAGAATCCGAGTCACTGTCCGAGTCAGAATCGCTGTCGGAATCCGAGTCACTGTCCGAATCCGAGTCGCTGTCAGAATCCGAGTCGCTGTCGCTATCCGAATCGCTGTCAGAGTCGGAATCGCTGTCAGAGTCAGAATCGCTGTCGGAATCCGAGTCACTGTCAGAATCCGAATCGCTGTCCGAGTCAGAATCGCTGTCGGAATCCGAATCGCTGTCAGAGTCAGAATCGCTGTCAGAATCCGAGTCGCTGTCGCTATCAGAATCGCTGTCAGAATCCGAGTCACTGTCAGAATCCGAGTCGCTGTCAGAATCCGAATCGCTGTCAGAGTCTGAATCGCTGTCAGAGTCGGAGTCGCTGTCAGAGTCAGAATCGCTGTCGGAATCCGAGTCACTGTCAGAATCGGAGTCGCTGTCGCTATCCGAGTCGCTGTCAGAATCGGAGTCGCTGTCGGAATCCGAGTCGCTGTCCGAGTCAGAATCGCTGTCGGAATCGGAGTCACTGTCGGAATCCGAGTCGCTGTCCGAGTCAGAATCGCTGTCGGAATCGGAGTCACTGTCGGAATCCGAGTCACTGTCGGAATCCGAATCGCTGTCCGAATCCGAGTCACTGTCCGAATCCGAATCGCTGTCAGAATCCGAATCGCTGTCAGAGTCC
154178 NZ_CP041515.1 Klebsiella-michiganensis-strain-KNU07-chromosome Bacteria 1931749-1937239 5491 252 18 GACAGCGACT GACAGCGACTCGGATTCAGACAGTGACTCCGACTCTGACAGTGACTCGGATTCAGACAGCGATTCGGACTCTGACAGCGACTCGGATTCCGACAGCGATTCGGACTCTGACAGCGACTCGGACTCTGACAGCGACTCGGATTCCGACAGCGACTCCGACTCTGACAGCGACTCGGATTCCGACAGCGACTCCGACTCTGACAGCGACTCGGATTCAGACAGCGATTCTGACTCGGACAGCGACTCGGATTCCGACAGCGACTCTGATTCCGACAGCGATTCCGACTCCGACAGCGATTCCGACTCCGACAGCGACTCTGACTCTGACAGTGACTCGGATTCTGACAGCGATTCGGATTCGGACAGCGACTCGGACTCCGACAGCGATTCGGATTCGGACAGCGATTCGGACTCGGACAGCGACTCGGACTCTGACAGCGATGCTGACTCTGACAGCGACTCGGACTCTGACAGCGATTCTGACTCCGACAGTGACTCGGATTCTGACAGTGACTCCGATTCAGACAGCGATTCGGACTCTGACAGCGACTCGGATTCAGACAGCGATTCGGACTCTGACAGCGATGCCGATTCAGACAGCGATTCGGATTCGGACAGCGACTCCGATTCCGACAGCGATTCGGATTCGGACAGCGACTCGGACTCTGACAGCGATGCTGACTCTGACAGCGACTCGGACTCCGACAGCGATTCGGATTCGGACAGCGACTCGGACTCCGACAGCGATTCGGACTCTGACAGCGACTCGGATTCAGACAGCGATTCGGACTCTGACAGCGATGCCGATTCAGACAGTGACTCGGATTCAGACAGCGACTCCGATTCCGACAGCGATTCCGACTCTGACAGCGACTCGGATTCCGACAGCGACTCCGACTCTGACAGCGACTCTGATTCCGACAGCGATTCCGACTCCGACAGCGACTCCGATTCCGACAGCGACTCTGATTCCGACAGCGATTCCGATTCTGACAGTGACTCCGATTCCGACAGTGACTCCGACTCTGACAGCGATTCCGACTCTGACAGCGACTCGGATTCTGACAGCGACTCGGATTCTGACAGCGATTCCGATTCTGACAGTGACTCCGATTCCGACAGCGATTCCGATTCTGACAGTGACTCCGATTCCGACAGCGATTCCGACTCTGACAGCGACTCGGACTCTGACAGCGACTCCGATTCCGACAGCGATTCTGATTCGGACAGCGACTCCGACTCTGACAGCGATGCCGATTCCGACAGCGATGCCGATTCCGACAGCGATGCTGACTCTGACAGCGACTCGGATTCCGACAGCGACTCCGACTCCGACAGCGACTCGGATTCCGACAGCGATTCCGACTCTGATAGCGACTCGGATTCGGACAGCGATGCTGACTCTGACAGCGATTCGGATTCCGACAGCGACTCGGATTCTGACAGCGACTCCGACTCGGACAGCGACTCCGATTCCGACAGCGATTCGGACTCTGACAGCGACTCGGACTCCGACAGCGATTCCGACTCTGACAGCGATTCGGATTCCGACAGCGACTCGGACTCTGACAGCGACTCGGATTCCGACAGCGACTCCGACTCTGACAGCGACTCTGATTCCGACAGCGACTCGGACTCCGACAGCGATTCCGACTCCGACAGTGACTCAGACTCTGACAGCGATTCCGACTCTGACAGCGATTCGGACTCCGACAGTGACTCCGACTCGGACAGCGATGCTGACTCTGACAGCGATTCCGACTCCGACAGCGACTCGGATTCAGACAGCGACTCGGATTCAGACAGCGATTCGGACTCTGACAGCGATGCCGATTCCGACAGTGACTCGGATTCTGACAGCGACTCCGACTCTGACAGCGATTCTGACTCTGACAGCGATTCGGATTCTGACAGTGACTCGGATTCTGACAGTGACTCCGATTCAGACAGCGATTCGGACTCTGACAGCGACTCCGATTCCGACAGCGATGCCGATTCAGACAGCGATGCTGACTCTGACAGCGACTCCGATTCCGACAGCGACTCTGACTCTGACAGCGATTCGGACTCTGACAGCGACTCGGACTCCGACAGCGATTCTGACTCCGACAGTGACTCGGATTCAGACAGCGATTCTGACTCCGACAGTGACTCAGACTCTGACAGCGATTCGGATTCCGACAGTGACTCGGATTCTGACAGCGATTCTGACTCGGACAGCGATTCCGACTCCGACAGCGACTCCGATTCCGACAGCGATGCCGATTCCGACAGCGATTCGGACTCCGACAGCGACTCTGATTCCGACAGCGATTCCGATTCTGACAGCGACTCGGATTCTGACAGTGACTCGGATTCCGACAGCGATTCGGACTCGGACAGTGACTCGGATTCTGACAGCGACTCGGACTCCGACAGTGACTCCGATTCTGACAGCGACTCTGACTCTGACAGCGACTCCGATTCTGATAGCGACTCCGATTCTGACAGTGACTCGGATTCCGACAGCGACTCGGATTCTGACAGCGATTCTGATTCGGACAGCGACTCGGACTCTGACAGTGACTCCGACTCTGACAGCGACTCGGATTCCGACAGCGATGCCGACTCTGACAGCGATTCGGATTCTGACAGCGATTCCGACTCTGACAGCGATTCGGATTCCGACAGCGATTCGGACTCCGACAGCGACTCGGACTCTGACAGCGATTCGGACTCCGACAGCGACTCGGATTCGGACAGCGATTCGGATTCCGACAGCGATTCTGACTCGGACAGCGATTCGGACTCTGACAGCGATTCGGACGCTGACAGTGACTCGGATTCAGACAGCGATTCGGACTCGGACAGTGACTCGGACTCCGACAGTGACTCGGATTCTGACAGCGACTCGGACTCCGACAGTGACTCCGATTCTGACAGCGACTCTGACTCTGACAGCGATTCCGACTCTGACAGCGATCCCGACTCTGACAGCGATTCGGACTCTGACAGCGACTCCGACTCTGACAGCGATTCGGATTCTGACAGCGACTCGGACTCTGACAGCGATGCTGACTCCGACAGCGACTCCGATTCCGACAGCGACTCGGATTCCGACAGCGATTCGGACTCGGACAGCGACTCTGACTCTGACAGCGACTCGGACTCCGACAGCGATTCGGACTCTGACAGCGATTCGGACTCCGACAGTGACTCGGATTCTGACAGTGACTCCGATTCAGACAGCGACTCCGATTCAGACAGCGATTCGGATTCGGACAGCGACTCCGATTCAGACAGCGATTCGGATTCGGACAGCGATTCGGACTCTGACAGCGATGCCGATTCCGACAGCGATTCGGATTCGGACAGCGATTCGGACTCTGACAGCGATGCCGATTCGGACAGCGACTCGGACTCTGACAGCGACTCGGACTCCGACAGCGACTCGGATTCAGACAGCGACTCGGATTCCGATAGCGACTCCGATTCTGACAGCGACTCGGATTCTGACAGCGATTCTGATTCGGACAGCGACTCGGACTCTGACAGTGACTCCGACTCTGACAGCGACTCGGATTCCGACAGCGATTCGGACTCTGACAGCGACTCCGATTCC
123990 NZ_CP028561.1 Acinetobacter-sp Bacteria 2710932-2726000 15069 251 60 TTCTAAGCTG TTCTAAGCTGCCTATACGGCAGTGGACGGCATGTCTCAATCAGCATTAGCAAAAAAGGCTTTCTAAGCTGCCTATATGGCAGTGAACTTGTTGGTGTGTTATCAGGTGGAATAGTATCATTTCTAAGCTGCCTGTATGGCAGTGAACCTATACACCAGTAGAAACGTATTATTCAGCATTTTCTAAGCTGCCTGTATGGCAGTGAACACAAAGCTGAGTTTAATTTTTCAGTATCAACTTTTCTAAGCTGCCTGTATGGCAGTGAACACTCACCATCTTTATGGAAGCCTGCAAACACATTTCTAAGCTGCCTGTATGGCAGTGAACTCAAAGAGCTTGCAAACTCGATCTGGTCGCAATTTCTAAGCTGCCTGTATGGCAGTGAACTTGGAAGCGATTGGGCATTACTTGTTGGGTAATTTCTAAGCTGCCTGTATGGCAGTGAACGATCAACCCATGTGCCATCTTCTAATTTTGTTTTTCTAAGCTGCCTGTATGGCAGTGAACAAGGTCTCGAAGTTGGGGTAGGGTGAGTTCTTTTTCTAAGCTGCCTGTATGGCAGTGAACTGATGTTCGCAGTTTTCGGATTGCTATTTATCTTTCTAAGCTGCCTGTATGGCAGTGAACGAAAAGCATTTGCAGCTGAAACCAAAGCACGTTTTCTAAGCTGCCTGTATGGCAGTGAACTTTTAGTTTCAAGCCCTGATTTAACAGCAACATTTCTAAGCTGCCTGTATGGCAGTGAACCAGTTAATGCATATTTAGAGAATATTCGTTACTTTCTAAGCTGCCTGTATGGCAGTGAACACAACAGCCCGATAATTGGTATGGACCAGTGATTTCTAAGCTGCCTGTATGGCAGTGAACTGTTGCATTTGATTACTGGTACACCTGGTGCATTTCTAAGCTGCCTGTATGGCAGTGAACGGCTTTTTGCTGCATTAGAGCGACGATATTCATTTCTAAGCTGCCTGTATGGCAGTGAACAAATACTTTTTACAATCGGAACATATTTATTATTTCTAAGCTGCCTGTATGGCAGTGAACTTTACGAAAAAGATGGGAAGAAATTCGATATTTTTCTAAGCTGCCTGTATGGCAGTGAACGTTTAAGACAATATTTAACACGAAATTTGTAATTTCTAAGCTGCCTGTATGGCAGTGAACAAGCTGAACATATCCGCGACCATAATATAAATTTTCTAAGCTGCCTGTATGGCAGTGAACAAAATGTGCGTCAATCTACACATGGATGAATTTTTCTAAGCTGCCTGTATGGCAGTGAACATGGCGCGTCAGTTTATCCGAATTGGTCAACATTTCTAAGCTGCCTGTATGGCAGTGAACCTGCTTTGCTTACAATTGTTTGTACTTTTTTATTTCTAAGCTGCCTGTATGGCAGTGAACACTGGCGAACCAAGCCGCGGCGATGCGTAAGTTTTCTAAGCTGCCTGTATGGCAGTGAACGGCTTTAAAAAACTTGCATCATTAATCAAATATTTCTAAGCTGCCTGTATGGCAGTGAACACAACAAAATACGTATTTAATGCGATGGAAACTTTCTAAGCTGCCTGTATGGCAGTGAACAACCAGCACCACAGCCGATCCGCACAATCAATTTTCTAAGCTGCCTGTATGGCAGTGAACATTTAGTTTTTCGTGGACCATCTTTAGACAAATTTCTAAGCTGCCTGTATGGCAGTGAACGCGACTTTAACAAGGCTATTGGAAAGCTTGGTTTTCTAAGCTGCCTGTATGGCAGTGAACTGTATGGTCTTTCAGGTGGTTCAGGTTTTTTGTTTCTAAGCTGCCTGTATGGCAGTGAACCTGACCGTGAACTCGCCGTCGCCACTGGTCCCTTTCTAAGCTGCCTGTATGGCAGTGAACTATTATTCCAATCAATAGAGCCATTTTCAATTTTTCTAAGCTGCCTGTATGGCAGTGAACTGCTCTAAATCGCTCTAGCTGCTTAATTGTAGTTTCTAAGCTGCCTGTATGGCAGTGAACGGATGCTCTAATTCTCCCGTTTATAATCATACTTTCTAAGCTGCCTGTATGGCAGTGAACCAGATATATCTTTAAGCTTCCCTGCTTTCTGTTTTCTAAGCTGCCTGTATGGCAGTGAACTCAAGCCAGCAATTATTGCATCTGCATATATTTTTCTAAGCTGCCTGTATGGCAGTGAATACCCAACTTATCTAGGCTTGTTAAGTATCTCATTTCTAAGCTGCCTGTATGGCAGTGAACTAATCCCTTTTTCTAGCTCCAATGTTTACATGTTTCTAAGCTGCCTGTATGGCAGTGAACATTTGTTGTGTAATTGTCCAACCGCCTAAAGATTTCTAAGCTGCCTGTATGGCAGTGAACATTAAAAACCTCAAAAAGTGCTCGGATGACGATTTCTAAGCTGCCTGTATGGCAGTGAACCCCCAAGGATCGGAGTCGTTACACGGCCATGCTTTCTAAGCTGCCTGTATGGCAGTGAACGTGGCTTTGACATAGCTTTTAGTATTGTTTTATTTCTAAGCTGCCTGTATGGCAGTGAACAAGCAAGTACCGATACAATGACAAGCTTTTTTTTTCTAAGCTGCCTGTATGGCAGTGAACATCGAGCCACAAAAAATCATAATCACTGATGATTTCTAAGCTGCCTGTATGGCAGTGAACACGCTAGCAGCTTGTGAACCTACAACTTGATTTTTCTAAGCTGCCTGTATGGCAGTGAACTGGCTGGAGTTTTAGGCGGTGCAGCAATTACATTTCTAAGCTGCCTGTATGGCAGTGAACTGAAATTATGTCAGATTCACGACTGATCAACTTTTCTAAGCTGCCTGTATGGCAGTGAACTATTAGGAAATAGGGTATGAGATCAATGGTTATTTCTAAGCTGCCTGTATGGCAGTGAACGGGTAGAACAACTCACTATAAATGATTTGTTCTTTCTAAGCTGCCTGTATGGCAGTGAACAACAACCTCCCTCGCCTTATCAATACCATGCTTTTCTAAGCTGCCTGTATGGCAGTGAACAGTTGTTACCAGGTCGTAACGGTATTGATGAATTTCTAAGCTGCCTGTATGGCAGTGAACGTTGATTTTGGGATTGAGCAAAATAGTTAAACTTTCTAAGCTGCCTGTATGGCAGTGAACTATATCAAATCACTTTTACGACTGACGATGATTTTCTAAGCTGCCTGTATGGCAGTGAACTAAGTATTATGCATACACTCAACAAGGTACTATTTCTAAGCTGCCTGTATGGCAGTGAACTAAGACTTAGCAAAGCTACTTTAAGACAATATTTTCTAAGCTGCCTGTATGGCAGTGAACAATCAGGTGCATTAAAAGCAGCAGCTCGTTTTTTTCTAAGCTGCCTGTATGGCAGTGAACTTTGTGATCGAAATGTTGCTCATGATATTCAATTTCTAAGCTGCCTGTATGGCAGTGAACTGCAGCCCAAGTCATTAGTTGCTGACCTGCATTTTCTAAGCTGCCTGTATGGCAGTGAACGGTCAGGTTTGCTTAGGGTGAATTGATAACCATTTCTAAGCTGCCTGTATGGCAGTGAACATTTGATGTAGGTGAATCAACATTGATTGTTGTTTCTAAGCTGCCTGTATGGCAGTGAACGATCAATCGATATGATGTCGTAAAACTGACTTTTTCTAAGCTGCCTGTATGGCAGTGAACCAACATATGCAGGAAGTACAGCAACAGTTTTTTTTCTAAGCTGCCTGTATGGCAGTGAACGCTATGAAGCAAGAGACGACTACACACCCTTCTTTCTAAGCTGCCTGTATGGCAGTGAACATAAACAACCGCTAAAAACACGATGATTGACATTTCTAAGCTGCCTGTATGGCAGTGAACCCACCATATACATCTAGTCAATATTTTTGGTTTTTCTAAGCTGCCTGTATGGCAGTGAACCACAAACTTTGAAAGCCCATTCACAGAAGACATTTCTAAGCTGCCTGTATGGCAGTGAACCTGCTTCAAATTCGATTGCACCAATACCTAAATTTCTAAGCTGCCTGTATGGCAGTGAACTACTTCGTAATCTTCCCGTAAATTACTTGATATTTCTAAGCTGCCTGTATGGCAGTGAACTAGCAGACTCGTAGTATTGATACAGTCGTTTATTTCTAAGCTGCCTGTATGGCAGTGAACGGTTTTGAGCAAATGTTGTTTTACCCATTGATTTTCTAAGCTGCCTGTATGGCAGTGAACGATAAACAACAACTTGATACTTATCTTCCAGATTTCTAAGCTGCCTGTATGGCAGTGAACCTTCTTTTGGACAAGCAGTTGGGGAAACATTATTTCTAAGCTGCCTGTATGGCAGTGAACTTATTCCAAGTGATAAAGCCAAGCATTGGAAGTTTCTAAGCTGCCTGTATGGCAGTGAACTCATAGAACAAATAGATATAGGTAATCAGAGATTTCTAAGCTGCCTGTATGGCAGTGAACTGTTTGTTGCCGTTGGTGACGATTTCCATATCTTTCTAAGCTGCCTGTATGGCAGTGAACTTTAACCCTTTCAACGTAACCAATGTCGACAATTTCTAAGCTGCCTGTATGGCAGTGAACCAGCAGAAACGTTAGCAATATCCTGTCCCCAATTTCTAAGCTGCCTGTATGGCAGTGAACGCCTACATGGGTGATGAATATGCTAGCTATTTTTTCTAAGCTGCCTGTATGGCAGTGAACGGAAATAATTTATTTAATAAAATATCCAAAAATTTCTAAGCTGCCTGTATGGCAGTGAACAGATGTTGCGTTCTACTGGAGTCATTTCAATTTTTCTAAGCTGCCTGTATGGCAGTGAACAAGAAAGCTGCTTTGACCCACTTAAAGACAACTTTCTAAGCTGCCTGTATGGCAGTGAACCATAGGGATCAGTTTTATCACATTTAGGAGGATTTCTAAGCTGCCTGTATGGCAGTGAACACCTTCGCATCTATGAAGACATTGCACCTATATTTCTAAGCTGCCTGTATGGCAGTGAACCATCCTCAGTTTATTGGGGTTCAACATTTAAATTTCTAAGCTGCCTGTATGGCAGTGAACGTGTGCGCTGAATTTTGACATCCTCAATTTGATTTCTAAGCTGCCTGTATGGCAGTGAACTGCCTGCAACACGTTCTTGGTGGTCATTTAAATTTCTAAGCTGCCTGTATGGCAGTGAACTTGCCAAGCATGCCAACTGAACTTTTTATAAATTTCTAAGCTGCCTGTATGGCAGTGAACTCAATGCCAACGGTGAAAAAAAGATGATGTATTTTCTAAGCTGCCTGTATGGCAGTGAACACACCGTGGTTAAACTGGTCGAGTATTTTAAGTTTCTAAGCTGCCTGTATGGCAGTGAACCGTTTCGGTCGTGTTAATTCTGTTGCTCGTTGTTTCTAAGCTGCCTGTATGGCAGTGAACAATAATCGGGCTGTAACCCTCCAACATATACATTTCTAAGCTGCCTGTATGGCAGTGAACGGCAACGAAACCGACTGCATTTTAATTTGTGATTTCTAAGCTGCCTGTATGGCAGTGAACTATATGACACTAACCAAAAACGTGCTTATGAATTTCTAAGCTGCCTGTATGGCAGTGAACCATTTTAGTTTTTACAAGTTTTTTAGCGCTCATTTCTAAGCTGCCTGTATGGCAGTGAACCGAGTGCGTCTACAGGCTTGAAATCAATCACTTTTCTAAGCTGCCTGTATGGCAGTGAACTTAATATTATTCAGCAGAAGCCTAAAGGCACTTTTCTAAGCTGCCTGTATGGCAGTGAACTACCTTAGCCATTTCAGGCGCAATACGGTCTATTTCTAAGCTGCCTGTATGGCAGTGAACAAAGCGATATTGCGGTACTCAATAAAGATCATTTTCTAAGCTGCCTGTATGGCAGTGAACGATAAATATCTAAGATGAGCCGATCCATTTGATTTCTAAGCTGCCTGTATGGCAGTGAACTGCTAACTCAATATTTAAGAGATTTTTTCGGGTTTCTAAGCTGCCTGTATGGCAGTGAACCTACAGATGGCACAACCGCAATTACTGCTGTTTTTCTAAGCTGCCTGTATGGCAGTGAACTCTTTGGTTTTGCATCCCCAAGCATAGACATATTTCTAAGCTGCCTGTATGGCAGTGAACATATTGATGTAGTCGCTATACAAAAAGAATTATTTCTAAGCTGCCTGTATGGCAGTGAACTTGAAGCATACGAAAAAGTTGCATTGGTTGAATTTCTAAGCTGCCTGTATGGCAGTGAACCAGGATTGGTATCACTCCTTCCATTCGTGAATTTTCTAAGCTGCCTGTATGGCAGTGAACAGCCCAACGTCCCGCAGTTCCGCTACCGTTCGTTTCTAAGCTGCCTGTATGGCAGTGAACTGACGACCTTATTTATTTTTATGCTAGATCATTTTCTAAGCTGCCTGTATGGCAGTGAACCCGATGCTTCGTTCACAAACGAAAGGTTTTTATTTCTAAGCTGCCTGTATGGCAGTGAACTACCACCTAAGCGAATGGATTGCATGGTGATTTTTCTAAGCTGCCTGTATGGCAGTGAACACCGTGCTACCAATACAAGTGCTGCTATTGCATTTCTAAGCTGCCTGTATGGCAGTGAACATTTCATCATCAAATGGTTTATTAGGGTTATATTTCTAAGCTGCCTGTATGGCAGTGAACCCTAACTTATGAAGTAACAGCAAAGCCAGTTTTTTCTAAGCTGCCTGTATGGCAGTGAACATAAAGACATAGAACAAAAAACCGATGAAGAATTTCTAAGCTGCCTGTATGGCAGTGAACAATAAAGTATCTATAGGAAAGGCGCAGTAATGTTTCTAAGCTGCCTGTATGGCAGTGAACAAGTACAGCTTTTCAGAGGTGAGGGCGGTGTCTTTCTAAGCTGCCTGTATGGCAGTGAACATATTCAATATTCGGGGCACGATTGCCACACTTTTCTAAGCTGCCTGTATGGCAGTGAACCCTGATTAGGCTGCTGTCTGAAGTAGTCAAATTTTCTAAGCTGCCTGTATGGCAGTGAACCCTGATTAGGCTGCTGTCTGAAGTAGTCAAATTTTCTAAGCTGCCTGTATGGCAGTGAACATTCAATATCCATCCTCCCCTCCGTTGTGGTCTTTCTAAGCTGCCTGTATGGCAGTGAACTACAGTGATAAGGCAAGGGATACAAATAAAGATTTCTAAGCTGCCTGTATGGCAGTGAACCCGCTCTTGAAAGGTTAATGTGTTCGATCCTATTTCTAAGCTGCCTGTATGGCAGTGAACCTTCGCAAGTTGCAAAAGTTCTTGCTCGTGGTTTTCTAAGCTGCCTGTATGGCAGTGAACTCTCTCTATAACATTTCCTATTTTCTGTAATTTTTCTAAGCTGCCTGTATGGCAGTGAACGGTAAACGCTTTTTGTGGGTATCAATAGTTGTTTTCTAAGCTGCCTGTATGGCAGTGAACTATGAAATTGGTTCAGGTCACGAATTAAAAACTTTCTAAGCTGCCTGTATGGCAGTGAACTAAGTGCAAACTTGCAAGCAGGCGCTCAAGTATTTCTAAGCTGCCTGTATGGCAGTGAACTTGCATCAATTGATGAAGCAGCATTAGCCATTTTTCTAAGCTGCCTGTATGGCAGTGAACCCATTTGAAACTCCAAAAACTAAGCCCCGTCATTTCTAAGCTGCCTGTATGGCAGTGAACTTTCAAAAACTACTGCTCAGAGCATCCCGAATTTTCTAAGCTGCCTGTATGGCAGTGAACTACAGTGATAAGGCAAGGGATACAAATAAAGATTTCTAAGCTGCCTGTATGGCAGTGAACCCGCTCTTGAAAGGTTAATGTGTTCGATCCTATTTCTAAGCTGCCTGTATGGCAGTGAACTTTGCAGAAGTATTCGATGCTGAACTAGATAATTTCTAAGCTGCCTGTATGGCAGTGAACTTGTGAAGTCTGTAGCAGCTGCTGGCCAATCATTTCTAAGCTGCCTGTATGGCAGTGAACGGTAGTACGGTTGAACCGCATGGGGGTAGTACTTTCTAAGCTGCCTGTATGGCAGTGAACGATAGAGGTTTTTCCTGTTGATTAAACTTGTGTTTCTAAGCTGCCTGTATGGCAGTGAACATTCTGAAAAAGAAAAAGAACAGGGCGCTATTTTTCTAAGCTGCCTGTATGGCAGTGAACGAGATCTGAACGACTGATTCACCGTTTACAACTTTCTAAGCTGCCTGTATGGCAGTGAACGTGTAACAAGAGAATCTCGAATGTATGAACTATTTCTAAGCTGCCTGTATGGCAGTGAACCCAATATTCGTGGACATTCTGAATTAACAGATTTTCTAAGCTGCCTGTATGGCAGTGAACTGCTGATTTAATCTTCATGCTTCGTAACAACGTTTCTAAGCTGCCTGTATGGCAGTGAACAATTTGAAATCGGGGAGTCCACGCTTTCTAATTTTCTAAGCTGCCTGTATGGCAGTGAACGTTGATAAACCTGATGGATAAGTCCGCATAACTTTCTAAGCTGCCTGTATGGCAGTGAACAGATTTATTTCATGCACTTCAACAAGTGTAAATTTCTAAGCTGCCTGTATGGCAGTGAACCACCTTTGAAAGCTTTTGCTCTTTGAAGTAGTTTTCTAAGCTGCCTGTATGGCAGTGAACATTAGGACTGGTGTAATCTTCGGGATAGTCTATTTCTAAGCTGCCTGTATGGCAGTGAACACTGCCCCTCATATACAGGCGTTGCAGCAATATTTCTAAGCTGCCTGTATGGCAGTGAACTAAGATCCTAGCAGAGCAATATAACTTGATTATTTCTAAGCTGCCTGTATGGCAGTGAACTTGAGCGTCGTACAGATCAACGATTTGCAAGTTTTCTAAGCTGCCTGTATGGCAGTGAACAAGTGGAAAGGTGAATACTTTTGCATTCGCACTTTCTAAGCTGCCTGTATGGCAGTGAACCATCGGTGCAGCTGAACGCTTGGATGCTATGTTTTCTAAGCTGCCTGTATGGCAGTGAACAGGAAGAGGCTTTTAGAAGCGCATCTACAGTATTTCTAAGCTGCCTGTATGGCAGTGAACGAGCAATTGATGGGACTTTGATCGTTCAGCAATTTCTAAGCTGCCTGTATGGCAGTGAACACGACCTGTACTTGGATTTCAGCTATCAGTACTTTCTAAGCTGCCTGTATGGCAGTGAACCAATGGCGGTTTTTTTATGTCTGGAGAAAATATTTCTAAGCTGCCTGTATGGCAGTGAACATTCTGAAGTAATTAAAAAGCCCTCTGAGTGATTTCTAAGCTGCCTGTATGGCAGTGAACATGTTCACAAAAGCAACAGGGCTAAAAATTGATTTCTAAGCTGCCTGTATGGCAGTGAACGTCTTTTCTTGACTATGAAGATCGAGATTTATTTTCTAAGCTGCCTGTATGGCAGTGAACGTTACATTAATTCTCAAGTAATATCTCAAATGTTTCTAAGCTGCCTGTATGGCAGTGAACACGAAAACATACTTGCGAAATCACTGATAATGTTTCTAAGCTGCCTGTATGGCAGTGAACAGTGATCAATATCAATCCTGATAATCGTGGATTTTCTAAGCTGCCTGTATGGCAGTGAACAAGCCGCAGATCCATAATTGAACCTGTCATAATTTCTAAGCTGCCTGTATGGCAGTGAACCCTTACGTTGGACCATACCTTGCACCCGTTATTTTCTAAGCTGCCTGTATGGCAGTGAACGCAGGGTTGAAGCAAATGGAATGGCTGATGCTTTTCTAAGCTGCCTGTATGGCAGTGAACATGAAAATGGCGATCCTGTTTTAAATGAAAATTTTCTAAGCTGCCTGTATGGCAGTGAACTTTAAGAAAATTACACGTCATCACGACTATTTTTTCTAAGCTGCCTGTATGGCAGTGAACCTCCGCCAGCGAATGTTGTAGTTACTGCTAGATTTCTAAGCTGCCTGTATGGCAGTGAACGTTGTTTTGCCTGAAATGAAAGCAGATATGGATTTCTAAGCTGCCTGTATGGCAGTGAACGAAACATTCGGCAAATGATGTTTAACAAAGATTTTCTAAGCTGCCTGTATGGCAGTGAACGTAAAACAGCTAGTGTTCAGACCGAGACAAATTTTCTAAGCTGCCTGTATGGCAGTGAACCTTTACTAGGTAAAGTGGTTAGCGCTTTACTATTTCTAAGCTGCCTGTATGGCAGTGAACTATTTAAAATTGCATATTCAGTGACATTTATTTTTCTAAGCTGCCTGTATGGCAGTGAACGCATTTCTTCAGTTGTTGAAGTAACCGAAATATTTCTAAGCTGCCTGTATGGCAGTGAACTTCTGTTTTGTAGGCGTTGTAGGCGTCTAATATTTCTAAGCTGCCTGTATGGCAGTGAACGGCATACTCACTTTATGATCTGATCATTTGTATTTCTAAGCTGCCTGTATGGCAGTGAACATAATAACTGTTGCTTTGCCGATGGATAGCTTTTTCTAAGCTGCCTGTATGGCAGTGAACGGGTCGCATAGATTACCTTTTCTTTTTCTGTTTTTCTAAGCTGCCTGTATGGCAGTGAACATTTGGTGAATATAAGATTTTCATGTGGTACATTTCTAAGCTGCCTGTATGGCAGTGAACGTTTTAATTAATTTTTTGACTGCTTTGTACTATTTCTAAGCTGCCTGTATGGCAGTGAACCCAGAGTGATAAATCACAAAGGTTTTTAAATCTTTCTAAGCTGCCTGTATGGCAGTGAACTAATTACTCGCATTGCGAAGTGGTTAGAGCAATTTCTAAGCTGCCTGTATGGCAGTGAACGTTCAATCCATAATCCGTGAATCAAGCCGTTTTTTCTAAGCTGCCTGTATGGCAGTGAACAGCATGAGCAATGACAGGGTTTGGATTGATTTTTTCTAAGCTGCCTGTATGGCAGTGAACATCGATCAATTTTATGTCACGCCATTCTACTATTTCTAAGCTGCCTGTATGGCAGTGAACTGAAATTATTTTATCTCTATATTTCCCGTTCATTTCTAAGCTGCCTGTATGGCAGTGAACAGCAACATCAAACGATTGTTGATGGCGAAATATTTCTAAGCTGCCTGTATGGCAGTGAACTCTTTTCTCCAGATAATAAAAAACCGCCAAAATTTCTAAGCTGCCTGTATGGCAGTGAACCTGCATACGCCGCAGCATTTGCGATTCAAAAATTTCTAAGCTGCCTGTATGGCAGTGAACCGCAGAAGATTATCTGATGAGTATGGTCGGGATTTCTAAGCTGCCTGTATGGCAGTGAACGTTGAATTATATAGTGGAGGATTTTGCCCATTTTTCTAAGCTGCCTGTATGGCAGTGAACGAATAAATCTGCGCAATTTATCCAAAAAGTAATTTCTAAGCTGCCTGTATGGCAGTGAACTCATTACCCTTTCGGCTGTTCTCACTAACAATTTTCTAAGCTGCCTGTATGGCAGTGAACATCAATAAGATAGAAGTCTTCATCATTAACTATTTCTAAGCTGCCTGTATGGCAGTGAACTTAGTTTTTTGGATTATGTCGACGATTACACTTTTCTAAGCTGCCTGTATGGCAGTGAACCTTTAACTGTTCAACTTTTGAAAGTGCTTTAATTTCTAAGCTGCCTGTATGGCAGTGAACTACCCATCTAATATAGCAGCTATAGTAAAGGATTTCTAAGCTGCCTGTATGGCAGTGAACTTATTGCAGCATCAATAGCACGTTTTTGGTATTTTCTAAGCTGCCTGTATGGCAGTGAACTTCTTTCATCATTCCTGACATCGAAACAATCTTTTCTAAGCTGCCTGTATGGCAGTGAACGGTTCACAAGAGTTTACAGTTCCATACATCATTTTCTAAGCTGCCTGTATGGCAGTGAACTAAGCCGTTGATTGCTGCAAATGTATCAACTGTTTCTAAGCTGCCTGTATGGCAGTGAACCAGGATTGAAAGCAAAACTTGATGAACTTCTTTTTCTAAGCTGCCTGTATGGCAGTGAACTGTAACCAAATGCATTGATAAAAGTTTGAAGTTTTCTAAGCTGCCTGTATGGCAGTGAACTAATAAATGGGATAACTTGAGAGCATCTAATATTTCTAAGCTGCCTGTATGGCAGTGAACTTATTTTGTTTTGGTGTCTATCTAGCCATAAATTTCTAAGCTGCCTGTATGGCAGTGAACGAGAAACGCAAGAATCTCAAATCTGCATCAATTTTCTAAGCTGCCTGTATGGCAGTGAACAATAACTATTGTTAATCTTGATGTTCGCAGGCTTTCTAAGCTGCCTGTATGGCAGTGAACTTTTAAGCTTGGTAAAATCAATGCCGTCCGTTTTTCTAAGCTGCCTGTATGGCAGTGAACAGCTGAACAGCTTAAAGACAATGCAACACAATTTTCTAAGCTGCCTGTATGGCAGTGAACTGAAGCACATCATGTTGCAGACCAAAACATGTTTTCTAAGCTGCCTGTATGGCAGTGAACTTAAAGATATTTTTCCTAATGCTCGTTTTATTTTTCTAAGCTGCCTGTATGGCAGTGAACTCAATGAAAACTGCCTTTTCTCCGTTCGGCTTTTTCTAAGCTGCCTGTATGGCAGTGAACAATGAAAACTGCCTTTTCTCCGTTCGGCTTTGTTTCTAAGCTGCCTGTATGGCAGTGAACAGGGTAAAACTGATTTTACAATCGACTCACTTTTTCTAAGCTGCCTGTATGGCAGTGAACGGTGCGGCGGATCAGTTTCCGCGATGGAATAATTTCTAAGCTGCCTGTATGGCAGTGAACGAAGAAGCTAGAAGTGCGGCGGATGAGTGGGATTTCTAAGCTGCCTGTATGGCAGTGAACTGATCGAGTGAATAGTGACATTGTGCTGAATTTTTCTAAGCTGCCTGTATGGCAGTGAACCCACTGAAACAAAATTAGCTGTCATTTATGGATTTCTAAGCTGCCTGTATGGCAGTGAACAAGGAAGCTGCAAAGGCTTCAATTGATGAAATTTTCTAAGCTGCCTGTATGGCAGTGAACTCAAGCATGTTACAGATACCACATATTTATGTTTTCTAAGCTGCCTGTATGGCAGTGAACTTTTCACCACAACTGGCATCACTTTTTGCAGATTTCTAAGCTGCCTGTATGGCAGTGAACTTTATACCGTTACGCCTGAACAAATTGGAACATTTCTAAGCTGCCTGTATGGCAGTGAACACTTTTAAGAATAAGAATACCTATTCTGCATATTTCTAAGCTGCCTGTATGGCAGTGAACTATTCCTTACCAATGACCGCAACGGCGATACTTTTCTAAGCTGCCTGTATGGCAGTGAACCATAATAAAAATAATAATAAAGAGGTCAGTATTTTCTAAGCTGCCTGTATGGCAGTGAACACTGTGACTCTTCTATAGCAGAGATCTATATATTTCTAAGCTGCCTGTATGGCAGTGAACCCCTTATGTCATGGGCGCATCGTGTGAAGTTTTTTCTAAGCTGCCTGTATGGCAGTGAACTAAAACAACAGATAGTTACGACTCGAACAACTTTTCTAAGCTGCCTGTATGGCAGTGAACTTCCAGAGGAAGGGAGCTGGTGGCTCGATAAATTTCTAAGCTGCCTGTATGGCAGTGAACACCATTTTCCCCCGCGCCCGCTGCCGCTAAATTTTCTAAGCTGCCTGTATGGCAGTGAACAAAAGTTTTAAGTTTGCTTTAAATTGCGCTTCTTTCTAAGCTGCCTGTATGGCAGTGAACGTTAATTGAATGAGCTGTGCAACCCGATAAGATTTCTAAGCTGCCTGTATGGCAGTGAACGCACTGTACCCGAAGCGACTGAGACAACGGATTTTCTAAGCTGCCTGTATGGCAGTGAACTGCGAGCGCAACTTGTTCTAGTGTTTCATTGTTTTCTAAGCTGCCTGTATGGCAGTGAACGCTTCTACAAGAAGTTTGGCTTTGAACATACATTTCTAAGCTGCCTGTATGGCAGTGAACTATTCATCAGAACATTCAAAACTATTTGCTCTTTTCTAAGCTGCCTGTATGGCAGTGAACTTATCAACTTTGCCTTTAGTCTTGGTTTTTGATTTCTAAGCTGCCTGTATGGCAGTGAACCACTAAATAATCCAAGCTCAATGGCAGTAGGATTTCTAAGCTGCCTGTATGGCAGTGAACATTTGTACGAATCTCTCAATCCTACAGTGAATTTTCTAAGCTGCCTGTATGGCAGTGAACAATTCTGGGCAGAACTTGTCCTCAATGGAATCTTTCTAAGCTGCCTGTATGGCAGTGAACGTGCAGCCCGATGCCATATGTACTATAACCACTTTCTAAGCTGCCTGTATGGCAGTGAACTCAGGATTGAAGAGGGTTATGCACCGATTGAGTTTCTAAGCTGCCTGTATGGCAGTGAACCTTCTCGTATGGGTCGTATTCGTGATGCATTATTTCTAAGCTGCCTGTATGGCAGTGAACCGTTACACGGTGGCATAGTTCGCCTGCACGTTTTTCTAAGCTGCCTGTATGGCAGTGAACAGTCACCTCAAATCGCTGTAGGCTTGCGATATT
106576 NZ_CP023565.1 Lactobacillus-murinus-strain-CR147-chromosome Bacteria 1772688-1782312 9625 249 30 TTGATTCACT TTGATTCACTCGCACTTACTGATGCGCTCGTTGATTCACTCACACTCACTGATGCGCTTGTTGATTCGCTCGCACTTACTGAGGTGCTTGTTGATTCACTTACACTTACTGAAGTGCTCGTCGATTCACTTGCGCTCAATGATGCACTTGTTGATTCACTCGCACTCAATGATGCGCTCGTCGATTCACTCGCACTCACTGACGCAGACGTTGACTCACTTGCACTCACTGATGCACTTGTTGATTCGCTGGCACTCACTGACGCAGACGTTGATCCACTTGCACTTACTGACGCACTTGTTGATTCACTTGCACTCACTGATGCGCTTGTTGATTCGCTCGCGCTCACTGAGGCAGACGTTGATTCGCTCGCACTCACTGAGGCACTTGTTGATTCACTCGCACTTACTGACGCGCTCGTTGATTCGCTCGCGCTCACTGACGCTGACGTTGATTCACTTGCGCTTACTGATGCACTCGTTGATTCACTTGCACTTACCGATGCACTCGTTGATTCACTTGCACTTACTGATGCGCTCGTTGATTCACTTGCACTTACTGAGGCAGACGTTGATTCACTTACACTTACTGAAGTGCTCGTTGATTCACTTGCGCTCAATGAGGTAGACGTTGATTCGCTCGCGCTCACTGACGTGCTTGTTGATTCGCTCGCGCTTACTGATGCGCTCGTCGATTCACTTGCACTCAATGACGCACTTGTCGATTCACTCGCACTTACTGAGGTGCTCGTTGATTCGCTCGCGCTTACTGATGCGCTTGTTGATTCGCTCGCGCTTACTGATGCGCTCGTTGATTCACTCACACTCACTGATGCGCTTGTTGATTCACTCACGCTCACTGACGCACTTGTTGATTCACTTGCACTTACTGACGCTGACGTTGATTCACTTGCACTTACTGAAGTGCTTGTTGATTCACTTGCACTCACTGACGCACTTGTCGATTCACTCGCACTTACTGAGGTGCTCGTTGATTCACTTGCGCTCACTGACGCAGACGTTGATTCACTTGCACTTACTGACGCACTCGTTGATTCGCTGGCACTCACTGAGGTACTTGTTGATTCACTTGCACTTACTGAAGTGCTTGTTGATTCACTTGCACTCACTGACGCACTCGTTGATCCACTTGCACTTACTGAGGCGCTTGTTGATTCACTTGCACTTCCTGAGGCAGACGTTGATTCGCTGGCACTCACTGATGCACTCGTTGATTCGCTCGCGCTCACTGACGCTGACGTTGATTCACTTGCGCTTACTGATGCGCTTGTTGATTCGCTCGCGCTTACTGATGCACTCGTTGATTCACTGGCGCTCACTGACGTACTTGTCGATTCACTTGCACTCACTGACGCACTTGTTGATTCACTGGCGCTTACTGACGCACTCGTTGATTCACTCGCACTTAACGAAGCAGATGTTGATTCGCTCGCACTTACTGATGCGCTCGTTGATTCGCTCGCACTCACTGACGCACTTGTTGATTCACTTGCACTCACTGACGCTGACGTTGATTCGCTCGCACTTACTGATGCGCTTGTTGATTCACTTGCGCTCAATGACGCTGACGTTGATTCACTCGTACTTACTGAGGCAGAGGTTGATTCACTTACGCTCACTGATGCGCTCGTTGATTCACTTGCACTCACTGACGCACTCGTTGATTCGCTGGCACTCACTGATGCACTTGTTGATTCACTTGCGCTTACTGACGCGCTCGTTGATTCGCTCGCGCTCACTGACGCTGACGTTGATTCACTTGCGCTTACTGATGCACTCGTTGATTCACTTGCACTTACCGATGCACTCGTTGATTCGCTCGCGCTCACTGACGCTGACGTTGATTCACTTGCACTTACTGAAGTGCTTGTTGATTCACTTGCACTCACCGAGGCACTTGTTGATTCGCTCGTGCTTACTGACGCACTCATTGATTCACTCGCACTTGCTGATGCGCTCGTTGATTCGCTCGCGCTCACTGACGCACTTGTCGATTCACTTGCACTCACAGACGCACTTGTTGATTCACTTGCGCTTACTGACGCAGACGTTGATTCGCTCGCGCTTACTGATGCACTCGTTGACTCACTTGCGCTCACTGACGCAGACGTTGATTCGCTCGCGCTTACTGATGCACTTGTTGATTCGCTCGCACTCACTGACGCAGACGTTGATTCACTTGCGCTTACTGATGCGCTCGTTGATTCACTTGCGCTTACTGATGCGCTCGTTGATTCACTTGCACTCACTGAGGTACTTGTTGATTCACTCGCACTTACTGATGCAGACGTTGATCCACTTGCGCTCACTGACGCACTTGTTGATTCACTTGCACTTACTGACGCTGACGTTGATTCACTCGCACTTACTGATGCGCTCATTGATTCGCTCGCACTCACTGACGCACTTGTTGATTCACTTGCACTCACTGACGCTGACGTTGATTCACTCGCACTTGCTGATTCGCTCGTTGATTCACTTGTACTTACTGAAGTGCTTATTGATTCGCTCGCACTTACTGAAGTGCTCGTTGATTCGCTGGCGCTCACTGACGCACTCATTGATTCACTCGCACTCACTGATGCGCTTGTCGATTCACTCGCACTCACTGACGCAGACGTTGATTCACTTGCGCTCACTGATGCACTTGTTGATTCGCTTGCACTTACTGATGCGCTTGTTGATTCACTCGCACTTACTGAGGCAGACGTTGATTCGCTCGCGCTCACTGATGCGCTTGTTGATCCACTTGCGCTCACTGACGCACTTGTTGATTCACTCGCACTCACTGATGCGCTTGTTGATTCACTTGCACTTACTGATGCGCTTGTTGATTCACTTGCGCTTACTGACGCTGACGTTGATTCACTCGCACTCACTGATGCGCTCGTTGATTCACTTGCACTTACTGAAGTGCTTGTTGATTCGCTGGCGCTCACTGACGCACTTGTCGATTCACTCGCACTTACTGAAGTGCTTGTTGATTCGCTGGCGCTCACTGACGCACTTGTCGATTCACTCGCACTTACTGAAGTGCTTGTTGATTCGCTGGCGCTCACTGACGCACTTGTCGATTCACTCGCACTTACTGAAGTGCTTGTTGATTCACTTGCACTTACTGATGCGCTTGTTGATTCACTGGCGCTTACTGACGCTGACGTTGATTCACTCGCACTTACTGATGCGCTCGTTGATTCACTTGTACTTACTGAAGTGCTTATTGATTCGCTCGCACTTACTGAAGTGCTCGTTGATTCGCTGGCGCTCAATGACGCACCCATTGATTCACTCGCACTCACTGATGCGCTTGTTGATTCACTTGCGCTCACTGATGCGCTCGTTGATTCGCTCGCACTTACTGATGCGCTCGTTGATTCGCTCGCACTCACTGACGCACTTGTTGATTCACTTGCACTCACTGACGCTGACGTTGATTCGCTCGCACTTACTGATGCGCTTGTTGATTCACTTGCGCTCAATGACGCTGACGTTGATTCACTCGTACTTACTGAGGCAGAGGTTGATTCACTTGCACTTACTGACGCTGACGTTGATTCGCTGGCACTCACTGACGCTGACGTTGATTCGCTCGCACTCACTGACGCACTCGTTGATTCGCTTGCACTTACTGATGCGCTTGTTGATTCGCTCGCGCTCACTGACGCACTTGTTGATGCACTTGCACTTACTGAGGCAGACGTTGATTCACTCGCGCTCACTGAGGCAGACGTTGATTCACTCGCGCTCACTGAGGCAGACGTTGATTCGCTCGCACTCACTGATGCACTCGTTGACTCACTTGCGCTCACTGATGCGCTTGTCGATTCACTTGCACTCACTGATGCACTTGTTGATTCGCTTGCGCTCACTGACGCAGACATTGATTCACTTGCACTCACTGACGCACTTATTGATTCACTTGTGTTTACTGATACGCTTGTTGATTCGCTCGCACTTACTGAAGTGCTTGTTGATTCACTCGCACTTACTGAGGCAGAGGTTGATTCGCTGGCGCTTACTGACTCACTCGTTGATCCACTTGCGCTTACCGATGCACTTGTTGATTCGCTGGCGCTCACTGACGCACTTATTGATTCACTTGTGCTTACTGATACGCTTGTTGATTCGCTCGCGCTTACTGATGCGCTCGTTGATTCACTTGCACTTACTGAAGCAGACGTTGATTCACTTGCGCTCACTGACGCTGACGTTGATTCACTCGCACTTACTGAAGCAGACGTTGATTCACTTGCGCTCACTGACGCACTTGTTGATCCACTTGCACTTACTGAGGCAGACGTTGATTCGCTCGCGCTCACTGACGCTGACGTTGATTCACTTGCGCTCACTGACGCACTTGTTGATTCGCTCGCACTTACTGAAGCAGACGTTGATTCACTTGCGCTCACTGACGCACTTGTTGATTCGCTCGCACTTACTGACGCACTTGTTGATTCACTCGCACTTACTGAAGCAGACG
83148 NZ_CP017561.1 Paraburkholderia-sprentiae-WSM5005-chromosome-1 Bacteria 3640951-3645487 4537 248 12 GATGCGGATG GATGCGGATGGGGATTCGGATGCAGATGCCGATGCTGACGCGGATGCGGATGCGGACGCAGATGCCGATGCCGATGCCGATGCCGATGCGGATGCGGATGCCGATGCCGATGCAGATGCAGATGCAGATGCTGATGCAGATGCAGATGCCGATGCTGATGCGGATGCGGATGCGGATGCGGATGCGGATGCAGATGCGGATACCGATGCTGATGCTGATGCCGATGCAGATGCCGATGCCGATTCGGATGCAGATGCAGATGCAGATGCTGATGCTGATGCAGATGCAGATGCCGATGCTGATGCGGATGCCGATGCGGATGCGGATGCGGATGCGGATGCGGATGCGGATGCGGATGCGGATGCGGATACCGATGCCGATGCAGATGCCGATGCCGATTCGGATGCAGATGCAGATGCAGATGCTGATGCTGATGCAGATGCAGATGCCGATGCTGATGCGGATGCCGATGCGGATGCGGATGCGGATGCGGATGCGGATGCGGATGCGGATGCGGATGCGGATACCGATGCCGATGCAGATGCCGATGCCGATGCGGATGCAGATGCAGATGCAGATGCTGATGCTGATGCAGATGCAGATGCCGATGCTGACGCGGATGCAGACGCGGATGCGGATGCGGATGCGGATGCGGATGCGGATGCGGATGCGGATGCTGATGCGGATGCGGATACCGATGCGGACGCCGATGCCGATGCCGATGCCGATGCCGATGCGGATGCGGATGCGGATGCGGATGCGGATGCGGATGCGGATGCTGACGCGGATGCGGATGCGGATGCGGATGCGGATGCGGATGCGGATGCAGATGCAGATGCAGATGCAGATGTAGATGCAGATGCCGACGCGGATGCGGATGCGGATGCGGATGCGGATGCGGATGCCGATGCCGATGCCGATGCCGACGCGGATGCTGATGCCGATGCTGATGCCGATGCTGATGCCGATGCCGATGCGGATGCGGATGCGGATGCGGATGCGGATGCGGATGCGGATGCGGATGCCGATGCCGATGCCGATGCCGATGCCGATGCCGACGCGGATGCCGACGCGGATGCCGACGCGGATGCTGACGCGGATGCCGATGCCGATGCCGATGCGGATGCTGATGCGGATACCGATGCCGATGCTGATGCCGATGCTGATGCGGATGCTGACGCGGATGCTGATGCGGATGCCGATGCGGATGCGGATGCGGATGCGGATGCGGATGCGGATGCGGATGCGGATGCGGATGCGGATGCCGATGCCGATGCCGATGCCGATGCCGATGCCGACGCGGATGCCGACGCGGATGCCGACGCGGATGCTGACGCGGATGCTGATGCCGATGCCGATGCGGATGCTGACGCGGATGCCGATGCGGATACCGATGCCGATGCTGATGCCGATGCTGATGCGGATGCTGACGCGGATGCTGACGCGGATGCGGATGCGGATGCGGATGCGGATGCGGATGCGGATGCGGATGCCGATGCCGATGCCGATGCCGATGCCGATGCCGACGCGGATGCCGACGCGGATGCCGACGCGGATGCTGACGCGGATGCTGATGCCGATGCCGATGCGGATGCTGACGCGGATGCCGATGCGGATACCGATGCCGATGCTGATGCCGATGCTGATGCGGATGCTGACGCGGATGCTGACGCGGATGCGGATGCGGATGCGGATGCGGATGCGGATGCGGATGCGGATGCCGATGCCGATGCCGATGCCGATGCCGATGCCGACGCGGATGCCGACGCGGATGCCGACGCGGATGCTGACGCGGATGCTGATGCCGATGCCGATGCGGATGCTGACGCGGATGCCGATGCGGATACCGATGCCGATGCTGATGCCGATGCTGATGCGGATGCTGACGCGGATGCTGACGCGGATGCGGATGCGGATGCG