Satellite database app by ALGGEN

Id Genbank id Name Type Indice Satlength Numrep Replength Seed Seq
17240 NC_013454.1 Blattabacterium-sp Bacteria 522305-522590 286 4 75 AAAAAAAACA AAAAAAAACATTCTCAAGAAAATTTAAAAGCTTCCAAAAATTCATTTTCGGAAAATAAAAATACAAACAATGAGAAAAAAAAACATTCTCAAGAAAATTTAAAAGCTTCCAAAAATTCATTTTCGGAAAATAAAAATACAAACAATGGGAAAAAAAAACATTTTCAAGAAAATTTAAAAACCTCCAAAAATTCATTTTCGGAAAATAAAAATACAAACAATGGGA
141644 NZ_CP034759.1 Litorilituus-sediminis-strain-JCM-17549-chromosome Bacteria 3611011-3611675 665 6 111 AAAAAAAACG AAAAAAAACGCGCTTTCAAATGAGAGCGCGCAAAAAATGAAGCCATCACTTTAAAGGGCGGAATAACATGTCTGTTATTATCTTTATACTAATTTTATTGAATTACAGGCAAAAAAAAACGCGCTTTCAAATGAGAGCGCGCAAAACATGAAGCCATCACTTTAAAGGGCGGAATAACGTTTCGGTTATTGCCTTATTCACTTGTTTTAGCAAAATTTAGATAAAAAAAACGCGCTTTCAAATGAGAGCGCGCAAAACATGAAGCCATCACTTTAAAGGGCGGAATAACGTTTCGGTTATTGCCTTATTCACTTGTTTTAGCAAAATTTAGATAAAAAAAACGCGCTTTCAAATGAGAGCGCGCAAAACATGAAGCCATCACTTTAAAGGGCGGAATAACGTTTCGGTTATTGCCTTATTCACTTGTTTTAGCAAAATTTAGAT
125051 NZ_CP029019.1 Candidatus-Sulcia-muelleri-isolate-SMPLAKAE-chromosome Bacteria 198505-198553 49 4 12 AAAAAAAAGA AAAAAAAAGAAGAAAAAAAAGAAGAAAAAAAAGAAGAAAAAAAAGAAG
23187 NC_017359.1 Helicobacter-pylori-Sat464 Bacteria 1218665-1218793 129 7 16 AAAAAAAAGA AAAAAAAAGAGAGTTTAAAAAAAAGAGAGTTTAAAAAAAAGAGAGTTTAAAAAAAAGAGAGTTTAAAAAAAAGAGAGTTTAAAAAAAAGAGAGTTT
23179 NC_017359.1 Helicobacter-pylori-Sat464 Bacteria 878744-878988 245 9 16 AAAAAAAAGA AAAAAAAAGAGAGTTTAAAAAAAAGAGAGTTTAAAAAAAAGAGAGTTTAAAAAAAAGAGAGTTTAAAAAAAAGAGAGTTTAAAAAAAAGAGAGTTTAAAAAAAAGAGAGTTT
23241 NC_017367.1 Helicobacter-pylori-F57-DNA Bacteria 954793-954944 152 9 17 AAAAAAAAGA AAAAAAAAGAGGGTTTAAAAAAAAAGAGGGTTTAAAAAAAAAGAGGGTTTAAAAAAAAAGAGGGTTTAAAAAAAAAGAGGGTTTAAAAAAAAAGAGGGTTTAAAAAAAAAGAGGGTTTA
23248 NC_017367.1 Helicobacter-pylori-F57-DNA Bacteria 1287917-1288046 130 8 16 AAAAAAAAGA AAAAAAAAGAGGGTTTAAAAAAAAGAGAGTTTAAAAAAAAGAGAGTTTAAAAAAAAGAGAGTTTAAAAAAAAGAGAGTTTAAAAAAAAGAGAGTTTAAAAAAAAGAGAGTTT
85001 NZ_CP017769.1 Myroides-sp Bacteria 2060447-2060511 65 4 16 AAAAAAACAC AAAAAAACACCATCACAAAAAAACACCATCACAAAAAAACACCATCACAAAAAAACACCATCAC
132928 NZ_CP031727.1 Cellvibrio-sp Bacteria 3986706-3986889 184 4 45 AAAAAAACCA AAAAAAACCAAAACCTTCATCATCACTAGCAGCCAACAAGCTATCAAAAAAACCAAAGGATTCATCGTCGGAAACGGTCGCCGACTCTTCAAAAAAACCATAAGCTTCACTTTCGGACGCAGGAGAGGTTTCGGT
144199 NZ_CP036262.1 Planctomycetes-bacterium-FF011L-chromosome Bacteria 6655960-6656812 853 4 213 AAAAAAACCT AAAAAAACCTGGCTCCCCTCGCCCTCAAAACAAGCTCGCTTAAAACAGGTTGGATATTGAATCAACGGTTCGCCAGCTAGTTCAGTTGAATGCGATTCAAAGGCTTGTTTAGGGGCGAGGGAAGCCAGATTTTGATCAGTTATAAACTTCACCTCCCCCGCGAAAGCCCCCTCCCTCCAGGACGCGTTCGCTAGGGACATGGAAAGAATAAGCAAAAAAACCTGGCTCCCCTCGCCCTCAAAACAAGCTCGCTAAAAACAGGTTGAATATTGAATCAACGGTTCGCCAGCTAGTTCAATTGAGTGCGATTAAAAGGCTTGTTTAGGGGCGAGAGAAGCCAGATTTTGATCAGTTATAAACTTCACCTCCCCCGCGAAAGCCCCCTCCCTCCAGGACGCGTTCGCTAGGGACATGGAAAGAATAAGCAAAAAAACCTGGCTCCCCTCGCCCTCAAAACAAGCTCGCTAAAAACAGGTTGAATATTGAATCAACGGTTCGCCAGCTAGTTCAATTGAGTGCAATTAAAAGGCTTGTTTAGGGGCGAGGGAAGCCAGATTTTGATCAGTTATAAACTTCACCTCCCCCGCGAAAGCCCCCTCCCTCCAGGACGCGTTCGCTAGGGACATGGAAAGAATAAGTAAAAAAACCTGGCTCCCCTCGCCCTCAAAACAAGCTCGCTTAAAACAGGTTGGATATTGAATCAACGGTTCGCCAGCTAGTTCAGTTGAATGCGATTCAAAGGCTTGTTTAGGGGCGAGGGAAGCCAGATTTTGATCAGTTATAAACTTCACCTCCCCCGCGAAAGCCCCCTCCCTCCAGGACGCGTTCGCTAGGGACATGGAAAGAATAAGC
30170 NC_021883.1 Mannheimia-haemolytica-USMARC_2286 Bacteria 335524-335596 73 4 18 AAAAAAACTG AAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGAT
83014 NZ_CP017536.1 Mannheimia-haemolytica-strain-1476 Bacteria 333611-333683 73 4 18 AAAAAAACTG AAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGAT
28753 NC_021082.1 Mannheimia-haemolytica-M42548 Bacteria 843418-843490 73 4 18 AAAAAAACTG AAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGAT
82850 NZ_CP017504.1 Mannheimia-haemolytica-strain-32635-chromosome Bacteria 335472-335544 73 4 18 AAAAAAACTG AAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGAT
83120 NZ_CP017551.1 Mannheimia-haemolytica-strain-1287-chromosome Bacteria 337474-337546 73 4 18 AAAAAAACTG AAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGAT
82914 NZ_CP017520.1 Mannheimia-haemolytica-strain-1609-chromosome Bacteria 335426-335516 91 5 18 AAAAAAACTG AAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGAT
83021 NZ_CP017537.1 Mannheimia-haemolytica-strain-1475 Bacteria 335548-335638 91 5 18 AAAAAAACTG AAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGAT
83042 NZ_CP017540.1 Mannheimia-haemolytica-strain-1451 Bacteria 333793-333883 91 5 18 AAAAAAACTG AAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGAT
83086 NZ_CP017546.1 Mannheimia-haemolytica-strain-1342-chromosome Bacteria 334988-335078 91 5 18 AAAAAAACTG AAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGAT
83098 NZ_CP017548.1 Mannheimia-haemolytica-strain-1319-chromosome Bacteria 335528-335618 91 5 18 AAAAAAACTG AAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGAT
83000 NZ_CP017534.1 Mannheimia-haemolytica-strain-1503 Bacteria 327756-327846 91 5 18 AAAAAAACTG AAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGAT
82937 NZ_CP017524.1 Mannheimia-haemolytica-strain-1576-chromosome Bacteria 335428-335518 91 5 18 AAAAAAACTG AAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGAT
83049 NZ_CP017541.1 Mannheimia-haemolytica-strain-1450 Bacteria 337015-337105 91 5 18 AAAAAAACTG AAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGAT
82956 NZ_CP017528.1 Mannheimia-haemolytica-strain-1561-chromosome Bacteria 333718-333808 91 5 18 AAAAAAACTG AAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGAT
83072 NZ_CP017544.1 Mannheimia-haemolytica-strain-1373-chromosome Bacteria 335499-335589 91 5 18 AAAAAAACTG AAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGAT