Satellite database app by ALGGEN

Id Genbank id Name Type Indice Satlength Numrep Replength Seed Seq
58421 NZ_CP011807.3 Pandoraea-faecigallinarum-strain-DSM-23572 Bacteria 2104443-2104485 43 4 10 GGGAAGAAGC GGGAAGAAGCGGGAAGAAGCGGGAAGAAGC
937 NC_014222.1 Methanococcus-voltae-A3 Arqueas 1783070-1783112 43 4 10 AATATAAAAA AATATAAAAAAATATAAAAAAATATAAAAA
898 NC_014222.1 Methanococcus-voltae-A3 Arqueas 109496-109539 44 4 11 TAATATAAAA TAATATAAAATTAATATAAAAATAATATAAAAA
90827 NZ_CP018811.1 Paraburkholderia-sp Bacteria 3025163-3025206 44 4 11 GCGGGAAACA GCGGGAAACACGCGGGAAACACGCGGGAAACAC
895 NC_014222.1 Methanococcus-voltae-A3 Arqueas 45240-45283 44 4 11 TAATATAAAA TAATATAAAATTAATATAAAAATAATATAAAAA
32340 NZ_AP017898.1 Sphingopyxis-sp Bacteria 2916866-2916910 45 4 11 GGCTCGGCAG GGCTCGGCAGTGGCTCGGCAGTGGCTCGGCAGTGGCTCGGCAGT
32186 NZ_AP017367.1 Leptolyngbya-sp Bacteria 2066962-2067006 45 4 11 TTGATCTGAA TTGATCTGAATTTGATCTGAATTTGATCTGAATTTGATCTGAAT
32684 NZ_AP018203.1 Leptolyngbya-boryana-NIES-2135-DNA Bacteria 3358427-3358471 45 4 11 GGAGCTTGTT GGAGCTTGTTCGGAGCTTGTTCGGAGCTTGTTCGGAGCTTGTTC
30024 NC_021877.1 Burkholderia-pseudomallei-MSHR305-chromosome-2 Bacteria 1365976-1366020 45 4 11 GGGCCTCGGT GGGCCTCGGTTGGGCCTCGGTTGGGCCTCGGTCGGGCCTCGGTC
30236 NC_021985.1 Streptomyces-collinus-Tu-365 Bacteria 3164154-3164198 45 4 11 CGCCGCGGGT CGCCGCGGGTCCGCCGCGGGTCCGCCGCGGGTCCGCCGCGGGTC
31270 NC_023018.2 Pandoraea-pnomenusa Bacteria 1528063-1528107 45 4 11 GTGCCCGCCA GTGCCCGCCACGTGCCCGCCACGTGCCCGCCACGTGCCCGCCAC
32179 NZ_AP017367.1 Leptolyngbya-sp Bacteria 1794090-1794134 45 4 11 CTGACCGAAA CTGACCGAAAGCTGACCGAAAGCTGACCGAAAGCTGACCGAAAG
21510 NC_016616.1 Dechlorosoma-suillum-PS Bacteria 2272909-2272953 45 4 11 GATTTGGGGC GATTTGGGGCGGATTTGGGGCGGATTTGGGGCGGATTTGGGGCA
32215 NZ_AP017367.1 Leptolyngbya-sp Bacteria 4168097-4168141 45 4 11 GGCGATTGGG GGCGATTGGGCGGCGATTGGGGGGCGATTGGGCGGAGATTGGGC
32685 NZ_AP018203.1 Leptolyngbya-boryana-NIES-2135-DNA Bacteria 3358560-3358604 45 4 11 CGAACACACA CGAACACACACCGAACACACACCGAACACACACCGAACACACAC
25597 NC_018527.1 Burkholderia-pseudomallei-BPC006-chromosome-I Bacteria 2534959-2535003 45 4 11 TCGTATCGGC TCGTATCGGCTTCGTATCGGCCTCGTATCGGCCTCGTATCGGCC
24969 NC_018011.1 Alistipes-finegoldii-DSM-17242 Bacteria 273308-273352 45 4 11 ACAACGAAAC ACAACGAAACAACAACGAAACAACAACGAAACAACAACGAAACA
25944 NC_018695.1 Paraburkholderia-phenoliruptrix-BR3459a-chromosome-1 Bacteria 3414869-3414913 45 4 11 TGGCTGTTGC TGGCTGTTGCCTGGCTGTTGCCTGGCTGTTGCCTGGCTGTTGCC
26406 NC_019673.1 Saccharothrix-espanaensis-DSM-44229 Bacteria 4438199-4438243 45 4 11 GCGCCAGACC GCGCCAGACCTGCGCCAGACCTGCGCCAGACCTGCGCCAGACCT
27002 NC_019701.1 Pseudanabaena-sp Bacteria 1708255-1708299 45 4 11 ACCAATGCCT ACCAATGCCTGACCAATGCCTGACCAATGCCTGACCAATGCCTG
29547 NC_021658.1 Sorangium-cellulosum-So0157-2 Bacteria 8274337-8274381 45 4 11 TTCCCGCACG TTCCCGCACGATTCCCGCACGGTTCCCGCACGATTCCCGCACGA
29688 NC_021658.1 Sorangium-cellulosum-So0157-2 Bacteria 13875100-13875144 45 4 11 CATGTGAGAG CATGTGAGAGACATGTGAGAGACATGTGAGAGGCATGTGAGAGG
31222 NC_022904.2 Pandoraea-pnomenusa-3kgm Bacteria 1399471-1399515 45 4 11 GATGTCCGCG GATGTCCGCGCGATGTCCGCGCGATGTCCGCGTGATGTCCGCGT
31224 NC_022904.2 Pandoraea-pnomenusa-3kgm Bacteria 4188283-4188327 45 4 11 TCCCGCCTCT TCCCGCCTCTTTCCCGCCTCTCTCCCGCCTCTTTCCCGCCTCTC
31935 NZ_AP014809.1 Methylobacterium-populi-DNA Bacteria 4126143-4126187 45 4 11 GCTGAGGGTC GCTGAGGGTCTGCTGAGGGTCTGCTGAGGGTCTGCTGAGGGTCT