Satellite database app by ALGGEN

Id Genbank id Name Type Indice Satlength Numrep Replength Seed Seq
17240 NC_013454.1 Blattabacterium-sp Bacteria 522305-522590 286 4 75 AAAAAAAACA AAAAAAAACATTCTCAAGAAAATTTAAAAGCTTCCAAAAATTCATTTTCGGAAAATAAAAATACAAACAATGAGAAAAAAAAACATTCTCAAGAAAATTTAAAAGCTTCCAAAAATTCATTTTCGGAAAATAAAAATACAAACAATGGGAAAAAAAAACATTTTCAAGAAAATTTAAAAACCTCCAAAAATTCATTTTCGGAAAATAAAAATACAAACAATGGGA
141644 NZ_CP034759.1 Litorilituus-sediminis-strain-JCM-17549-chromosome Bacteria 3611011-3611675 665 6 111 AAAAAAAACG AAAAAAAACGCGCTTTCAAATGAGAGCGCGCAAAAAATGAAGCCATCACTTTAAAGGGCGGAATAACATGTCTGTTATTATCTTTATACTAATTTTATTGAATTACAGGCAAAAAAAAACGCGCTTTCAAATGAGAGCGCGCAAAACATGAAGCCATCACTTTAAAGGGCGGAATAACGTTTCGGTTATTGCCTTATTCACTTGTTTTAGCAAAATTTAGATAAAAAAAACGCGCTTTCAAATGAGAGCGCGCAAAACATGAAGCCATCACTTTAAAGGGCGGAATAACGTTTCGGTTATTGCCTTATTCACTTGTTTTAGCAAAATTTAGATAAAAAAAACGCGCTTTCAAATGAGAGCGCGCAAAACATGAAGCCATCACTTTAAAGGGCGGAATAACGTTTCGGTTATTGCCTTATTCACTTGTTTTAGCAAAATTTAGAT
23248 NC_017367.1 Helicobacter-pylori-F57-DNA Bacteria 1287917-1288046 130 8 16 AAAAAAAAGA AAAAAAAAGAGGGTTTAAAAAAAAGAGAGTTTAAAAAAAAGAGAGTTTAAAAAAAAGAGAGTTTAAAAAAAAGAGAGTTTAAAAAAAAGAGAGTTTAAAAAAAAGAGAGTTT
23187 NC_017359.1 Helicobacter-pylori-Sat464 Bacteria 1218665-1218793 129 7 16 AAAAAAAAGA AAAAAAAAGAGAGTTTAAAAAAAAGAGAGTTTAAAAAAAAGAGAGTTTAAAAAAAAGAGAGTTTAAAAAAAAGAGAGTTTAAAAAAAAGAGAGTTT
134815 NZ_CP032475.1 Helicobacter-pylori-strain-381-F-EK9-chromosome Bacteria 583096-583534 439 4 15 AAAAAAAAGA AAGAAAAAGAGGTTCAAAAAAAAGAGGTTCAAAAAAAAGAGGTTC
125051 NZ_CP029019.1 Candidatus-Sulcia-muelleri-isolate-SMPLAKAE-chromosome Bacteria 198505-198553 49 4 12 AAAAAAAAGA AAAAAAAAGAAGAAAAAAAAGAAGAAAAAAAAGAAGAAAAAAAAGAAG
135868 NZ_CP032901.1 Helicobacter-pylori-strain-381-A-EK4-chromosome Bacteria 581388-581826 439 4 15 AAAAAAAAGA AAGAAAAAGAGGTTCAAAAAAAAGAGGTTCAAAAAAAAGAGGTTC
23179 NC_017359.1 Helicobacter-pylori-Sat464 Bacteria 878744-878988 245 9 16 AAAAAAAAGA AAAAAAAAGAGAGTTTAAAAAAAAGAGAGTTTAAAAAAAAGAGAGTTTAAAAAAAAGAGAGTTTAAAAAAAAGAGAGTTTAAAAAAAAGAGAGTTTAAAAAAAAGAGAGTTT
23241 NC_017367.1 Helicobacter-pylori-F57-DNA Bacteria 954793-954944 152 9 17 AAAAAAAAGA AAAAAAAAGAGGGTTTAAAAAAAAAGAGGGTTTAAAAAAAAAGAGGGTTTAAAAAAAAAGAGGGTTTAAAAAAAAAGAGGGTTTAAAAAAAAAGAGGGTTTAAAAAAAAAGAGGGTTTA
85001 NZ_CP017769.1 Myroides-sp Bacteria 2060447-2060511 65 4 16 AAAAAAACAC AAAAAAACACCATCACAAAAAAACACCATCACAAAAAAACACCATCACAAAAAAACACCATCAC
132928 NZ_CP031727.1 Cellvibrio-sp Bacteria 3986706-3986889 184 4 45 AAAAAAACCA AAAAAAACCAAAACCTTCATCATCACTAGCAGCCAACAAGCTATCAAAAAAACCAAAGGATTCATCGTCGGAAACGGTCGCCGACTCTTCAAAAAAACCATAAGCTTCACTTTCGGACGCAGGAGAGGTTTCGGT
132939 NZ_CP031728.1 Cellvibrio-sp Bacteria 4978598-4978734 137 5 15 AAAAAAACCG AAGAAAACCGAAAGTAAAAAAACCGAAAGTAAAAAAACCGAAAGT
144199 NZ_CP036262.1 Planctomycetes-bacterium-FF011L-chromosome Bacteria 6655960-6656812 853 4 213 AAAAAAACCT AAAAAAACCTGGCTCCCCTCGCCCTCAAAACAAGCTCGCTTAAAACAGGTTGGATATTGAATCAACGGTTCGCCAGCTAGTTCAGTTGAATGCGATTCAAAGGCTTGTTTAGGGGCGAGGGAAGCCAGATTTTGATCAGTTATAAACTTCACCTCCCCCGCGAAAGCCCCCTCCCTCCAGGACGCGTTCGCTAGGGACATGGAAAGAATAAGCAAAAAAACCTGGCTCCCCTCGCCCTCAAAACAAGCTCGCTAAAAACAGGTTGAATATTGAATCAACGGTTCGCCAGCTAGTTCAATTGAGTGCGATTAAAAGGCTTGTTTAGGGGCGAGAGAAGCCAGATTTTGATCAGTTATAAACTTCACCTCCCCCGCGAAAGCCCCCTCCCTCCAGGACGCGTTCGCTAGGGACATGGAAAGAATAAGCAAAAAAACCTGGCTCCCCTCGCCCTCAAAACAAGCTCGCTAAAAACAGGTTGAATATTGAATCAACGGTTCGCCAGCTAGTTCAATTGAGTGCAATTAAAAGGCTTGTTTAGGGGCGAGGGAAGCCAGATTTTGATCAGTTATAAACTTCACCTCCCCCGCGAAAGCCCCCTCCCTCCAGGACGCGTTCGCTAGGGACATGGAAAGAATAAGTAAAAAAACCTGGCTCCCCTCGCCCTCAAAACAAGCTCGCTTAAAACAGGTTGGATATTGAATCAACGGTTCGCCAGCTAGTTCAGTTGAATGCGATTCAAAGGCTTGTTTAGGGGCGAGGGAAGCCAGATTTTGATCAGTTATAAACTTCACCTCCCCCGCGAAAGCCCCCTCCCTCCAGGACGCGTTCGCTAGGGACATGGAAAGAATAAGC
82906 NZ_CP017519.1 Mannheimia-haemolytica-strain-22549-chromosome Bacteria 335005-335113 109 6 18 AAAAAAACTG AAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGAT
82850 NZ_CP017504.1 Mannheimia-haemolytica-strain-32635-chromosome Bacteria 335472-335544 73 4 18 AAAAAAACTG AAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGAT
83072 NZ_CP017544.1 Mannheimia-haemolytica-strain-1373-chromosome Bacteria 335499-335589 91 5 18 AAAAAAACTG AAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGAT
82972 NZ_CP017530.1 Mannheimia-haemolytica-strain-1532-chromosome Bacteria 333071-333179 109 6 18 AAAAAAACTG AAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGAT
82914 NZ_CP017520.1 Mannheimia-haemolytica-strain-1609-chromosome Bacteria 335426-335516 91 5 18 AAAAAAACTG AAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGAT
83064 NZ_CP017543.1 Mannheimia-haemolytica-strain-1383 Bacteria 333791-333935 145 8 18 AAAAAAACTG AAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGAT
83086 NZ_CP017546.1 Mannheimia-haemolytica-strain-1342-chromosome Bacteria 334988-335078 91 5 18 AAAAAAACTG AAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGAT
83021 NZ_CP017537.1 Mannheimia-haemolytica-strain-1475 Bacteria 335548-335638 91 5 18 AAAAAAACTG AAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGAT
82964 NZ_CP017529.1 Mannheimia-haemolytica-strain-1560-chromosome Bacteria 328144-328252 109 6 18 AAAAAAACTG AAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGAT
82816 NZ_CP017491.1 Mannheimia-haemolytica-strain-38599-chromosome Bacteria 333751-333877 127 7 18 AAAAAAACTG AAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGAT
82857 NZ_CP017505.1 Mannheimia-haemolytica-strain-32619-chromosome Bacteria 332960-333086 127 7 18 AAAAAAACTG AAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGAT
82839 NZ_CP017501.1 Mannheimia-haemolytica-strain-33041-chromosome Bacteria 333747-333873 127 7 18 AAAAAAACTG AAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGATAAAAAAACTGAAGAGGAT