Satellite database app by ALGGEN

Id Genbank id Name Type Indice Satlength Numrep Replength Seed Seq
117995 NZ_CP026323.1 Helicobacter-pylori-strain-26695-dRdM1dM2-chromosome Bacteria 0-104 105 7 14 TGATTAGTGA TGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAG
118025 NZ_CP026326.1 Helicobacter-pylori-strain-26695-dR-chromosome Bacteria 0-104 105 7 14 TGATTAGTGA TGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAG
118015 NZ_CP026325.1 Helicobacter-pylori-strain-dRdM1-chromosome Bacteria 0-104 105 7 14 TGATTAGTGA TGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAG
70767 NZ_CP014241.1 Bifidobacterium-angulatum-strain-GT102 Bacteria 0-1056 1057 16 66 TGACAGACAT TGACAGACATCTGAAACACAATCTCCGTTTCCTCAGTAATGAGGTCAGTGGTCTAGGTCATTGATCTGACAGACATCTGAAACGGTTTGGGGCATCCGGTGCGCCTGAGCTGTGTGGTCTAGGTCATTGATCTGACAGACATCTGAAACTGCGTTGCCTTACTCCCGACGCTTGCAGCTGTGGTCTAGGTCATTGATCTGACAGACATCTGAAACTACGATGCGCCAAGCTGAATGGTCAGCAGGGTGGTCTAGGTCATTGATCTGACAGACATCTGAAACTTGTTCCGTATCCCTGTTTTTAGGAGGATAGTGGTCTAGGTCATTGATCTGACAGACATCTGAAACTAGAGATTGAGGGCGTAATTGTCGGTTTTGGTGGTCTAGGTCATTGATCTGACAGACATCTGAAACGGCACGCCGCAGCCAGGGACGCCACGGCCAGTGGTCTAGGTCATTGATCTGACAGACATCTGAAACTATAAACGTATACACATGCCCCCTAACCACGTGGTCTAGGTCATTGATCTGACAGACATCTGAAACTTCGTTACCGGTTTCCTCGATGGGCTTACGGTGGTCTAGGTCATTGATCTGACAGACATCTGAAACACTTCGAGCATTGGCTGGACACCGTGGCGTGTGGTCTAGGTCATTGATCTGACAGACATCTGAAACTTGGCATCCACGCCGGAACCAGTGAAGGAGGTGGTCTAGGTCATTGATCTGACAGACATCTGAAACTACGGCCTACTCGGGTGAGTGATGGCCGACGTGGTCTAGGTCATTGATCTGACAGACATCTGAAACGATGAATGTGCCCGCCTTGATTAGTCCAAAGTGGTCTAGGTCATTGATCTGACAGACATCTGAAACAAACCAAACAAACAGACTGAATGAATCAGAGTGGTCTAGGTCATTGATCTGACAGACATCTGAAACCTACGATTCGCATTCCGTACGTGTATAGGAGTGGTCTAGGTCATTGATC
169334 NZ_LT667500.1 Buchnera-aphidicola-strain-BCifornacula-genome-assembly Bacteria 0-109 110 10 11 GGTTATCCAC GGTTATCCACCGGTTATCCACCGGTTATCCACCGGTTATCCACCGGTTATCCACCGGTTATCCACCGGTTATCCACCGGTTATCCACCGGTTATCCACCGGTTATCCACC
80058 NZ_CP017025.1 Campylobacter-coli-strain-14983A-chromosome Bacteria 0-109 110 5 22 TATTAAGACG TATTAAGACGACAAAATTCTACTATTAAGACGACAAAATTCTACTATTAAGACGACAAAATTCTACTATTAAGACGACAAAATTCTACTATTAAGACGACAAAATTCTAC
118861 NZ_CP026515.1 Helicobacter-pylori-strain-dRdM2addM2-chromosome Bacteria 0-111 112 8 14 TGATTAGTGA TGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAG
31196 NC_022886.1 Helicobacter-pylori-BM012A Bacteria 0-153 154 11 14 AGTGATTAGT AGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATT
6658 NZ_CP042905.1 Anaerobic-archaeon-MK-D1-chromosome Arqueas 0-1535 1536 4 282 TAAATATTAT TAAATATTATAGCCCGTAATAGCAGAGTCACCAACACTTAAAGGTGCATCCCAAGTTAATTCTACCTGTTCATCTCCTGGAATTGCTTGAAGATTTTGAGGGGCACTTGGAACACCCAATGGAGTAGCACTCACTTCATCACATAAGGGCCCTTCTCCTTCAGTATTATTAGCAGAAATTTGATAATAATAGATTTGTCCATTGGTTAAACCAGTATCAGTATAGCTCAAAACATCTCCAATTGAAGTGAATAATGATAAACTCCCAGAACTGGTTCCTCTATAAATATTATAACCTGTAATAACAGACCCACCATCACTTAAAGGTGCACCCCAAGTTAATTCTACCTGTTCATCTCCTGGAATTGCTTGAAGATTTTGAGGTACGGTTGGAGCACCCAATGGAGTAGTACTCACTTCATCACATAATGGCCCTTCTCCTTCAGTATTTTTCGCAGAAATTTGATAATAATAAATTTGCCCATTGGTTAAACCAGTATCAGTATAGCTCAAAACATCTCCAATTGAAGTGAATAATGATAAACTCCCAGAACTGGTCCCTCTATAAATATTATAGCCCGTAATAGCAGAGTCACCAGCACTTAAAGGTGCATCCCAAGTTAATTCTACCTGTTCATCTCCTGGAATTGCTTGAAGATTTTGAGGGGCACTTGGAACACCCAATGGAGTAGCACTCACTTCATCACATAATGGCCCTTCTCCTTCAGTATTATTAGCAGAAATTTGATAATAATAAATTTGTCCATTGGTTAAACCAGTATCAGTATAGGTCAAAACATCTCCAATTGAGGTGAATAATGATAAACTCCCAGAACTGGTCCCTCTA
31233 NC_022911.1 Helicobacter-pylori-BM012S Bacteria 0-160 161 11 14 AGTGATTAGT AGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATT
31656 NZ_AP013356.1 Helicobacter-pylori-26695-1CL-DNA Bacteria 0-167 168 12 14 TGATTAGTGA TGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAG
31636 NZ_AP013354.1 Helicobacter-pylori-26695-1-DNA Bacteria 0-167 168 12 14 TGATTAGTGA TGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAG
26100 NC_018938.1 Helicobacter-pylori-Rif2 Bacteria 0-167 168 12 14 TGATTAGTGA TGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAG
31646 NZ_AP013355.1 Helicobacter-pylori-26695-1CH-DNA Bacteria 0-167 168 12 14 TGATTAGTGA TGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAG
53133 NZ_CP010436.1 Helicobacter-pylori-strain-26695-1MET Bacteria 0-167 168 12 14 TGATTAGTGA TGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAG
53123 NZ_CP010435.1 Helicobacter-pylori-26695-1 Bacteria 0-167 168 12 14 TGATTAGTGA TGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAG
26090 NC_018937.1 Helicobacter-pylori-Rif1 Bacteria 0-167 168 12 14 TGATTAGTGA TGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAG
26110 NC_018939.1 Helicobacter-pylori-26695 Bacteria 0-167 168 12 14 TGATTAGTGA TGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAG
6792 NC_000915.1 Helicobacter-pylori-26695-chromosome Bacteria 0-167 168 12 14 TGATTAGTGA TGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAG
160008 NZ_CP044186.1 Salmonella-enterica-subsp Bacteria 0-185 186 5 37 TGGGCGGATT TGGGCGGATTTCCACACGGCACCGGCACCCGGCAAGGTGGGCGGATTCCCACACGGCACCGGCGCCCGGCAAGGTGGGCGGATTTCCACACAGCACCGGCGCCCGGCAAGGTGGGTGGATTCCCACACGGCACCGGCGCCCGGTAAGGTGGGCGGATTTCCACACGACAGCGGCGCCCGGCAAGA
115200 NZ_CP025466.1 Klebsiella-pneumoniae-strain-JS187-chromosome Bacteria 0-2006 2007 27 67 CCCCTTGTTC CCCCTTGTTCGCAGTCCTGCTCCGGGAGCCCCAGCAGCTTCCTGATAGCCAGTCACATTAAAACAACCCCCTTGTTCGCAGTCCGGCTCCGGGTGGCCCAGCGGCTTTCTGATACCCCGGCAGGACAAAACAACCCCCTTGTTCGCAATGCTGCTTCGGGTGGCCCAGCGGCTTTCTGATACCCCGGCAGGACAAAACAACCCCCTTGTTCGCAGTCCTGCTCCGGGTGGCCCAGCGGCTTTCTGATACCCCGGCAGGACAAAACAACCCCCTTGTTCGCAATGCTGCTTCGGGTGGCCCAGCGGCTTTCTGATACCCCGGCAGGACAAAACACCCCCCTTGTTCGCAGTCCTGCTCCGGGAGCCCCAGCAGCTTCCTGATAGCCAGTCACATTAAAACAACCCCCTTGTTCGCAGTCCGGCTCCGGGTGGCCCAGCGGCTTTCTGATACCCCGGCAGGACAAAACAACCCCCTTGTTCGCAATGCTGCTTCGGGTGGCCCAGCTGCTTTCTGATACCCCGGCAGGACAAAACAACCCCCTTGTTCGCAGTCCGGCTCCGGGTGGCCCAGCGGCTTTCTGATACCCCGGCAGGACAAAACAACCCCCTTGTTCGCAATGCTGCTTCGGGTGGCCCAGCTGCTTTCTGATACCCCGGCAGGACAAAACAACCCCCTTGTTCGCAGTTCTGCTCCGGGTGGCCCTGCGGCTTCATGACAACCCCACAGGGTAAAACAACCCCCTTGTTCGCAGTCCTGCTCCGCGTGGCCCAGCGGCTTTCTGATACCCCGGCAGGATAAAACAACCCCCTTGTTCGCAGTCCGGCTCCGGGTGGACCAGCAGCTTTCTGATTGCCCGGCAGGACAAAACAACCCCCTTGTTCGCAGTCCTGCTCCGGGTGGCACAGCGTATTCCTGACAGACTGGCATGACAAAACAACCCCCTTGTTCGCAGTCCGGCTCCGGGAGGCCAGGCGGATTTCTGATATCCCGACAGAGTAAAACAACCCCCTTGTTCGCAGATCTGCTCCGGGTGGCCGAGCGGCTTCATGACAGCCAGACAAGACAAAACAACCCCCTTGTTCGCAGTTCTGCTCCGGGTAGCCCAGCGGCTTCATGACAACCCGACAGGGTGAAACAACCCCCTTGTTCGCAGTCCGGCTTCGGGTGGCCCAGCGGCTTTCTGATACCCTGACAAGACAAAACAACCCCCTTGTTCGCAGTGCTGCTACGAGTGGCCCAGCGGATTCCTGATACCCCGGCATGACAAAACAACCCCCTTGTTCGCAGCCCGGCTTCGGGTGGACCAGCGGCTTTCTGATACCCCGGCAGGGTAAAACAACCCCCTTGTTCGCAGTCATGCTCCGGGTGGCCCAGCGGCTTTCTGATACCCCGGCAGGGTAAAACAACCCCCTTGTTCGCAGTCATGCTCCGGGTGGCCCAGCGGCTTTCTGATACCCCGGCAGAGCAAAACAAC
83143 NZ_CP017561.1 Paraburkholderia-sprentiae-WSM5005-chromosome-1 Bacteria 0-2129 2130 122 12 ATGCGGATGC ATGCGGATGCGGATGCGGATGCGGATGCGGATGCGGATGCGGATGCGGATGCCGATGCCGATGCCGATGCCGATGCCGATGCCGACGCGGATGCCGACGCGGATGCCGACGCGGATGCTGACGCGGATGCTGATGCCGATGCCGATGCGGATGCTGACGCGGATGCCGATGCGGATACCGATGCCGATGCTGATGCCGATGCTGATGCGGATGCTGACGCGGATGCTGACGCGGATGCGGATGCGGATGCGGATGCGGATGCGGATGCGGATGCGGATGCCGATGCCGATGCCGATGCCGATGCCGATGCCGACGCGGATGCCGACGCGGATGCCGACGCGGATGCTGACGCGGATGCTGATGCCGATGCCGATGCGGATGCTGACGCGGATGCCGATGCGGATACCGATGCCGATGCTGATGCCGATGCTGATGCGGATGCTGACGCGGATGCTGACGCGGATGCGGATGCGGATGCGGATGCGGATGCGGATGCGGATGCGGATGCCGATGCCGATGCCGATGCCGATGCCGATGCCGACGCGGATGCCGACGCGGATGCCGACGCGGATGCTGACGCGGATGCTGATGCCGATGCCGATGCGGATGCTGACGCGGATGCCGATGCGGATACCGATGCCGATGCCGATGCCGATGCGGATGCGGATGCTGACGCGGATGCTGATGCTGATGCCGATGCGGATGCGGATGCGGATGCGGATGCGGATGCGGATGCGGATGCGGATGCGGATGCGGATGCCGATGCCGATGCCGATGCCGATGCCGATGCCGACGCGGATGCCGACGCGGATGCTGACGCGGATGCTGATGCCGATGCCGATGCCGATGCCGATGCCGATGCTGATGCGGATGCTGACGCGGATGCTGATGCTGATGCCGACGCGGATGCGGATGCGGATGCGGATGCGGATGCGGATGCGGATGCGGATGCGGATGCGGATGCGGACGCGGATGCGGATGCGGATGCGGATGCGG
68709 NZ_CP013714.1 Staphylococcus-equorum-strain-C2014 Bacteria 0-2401 2402 9 267 ACGATTAGTG ACGATTAGTGGTACGCCAACAAAAGTAGGTAATTATCCAATCACTGTAACGACAAAAGATGAGGTTGGTAATACTACGGAAACGAACTTTACAATCAATGTTGAAGATACAACGGCACCAAATCTTGACCCAGTGGATGATCAAACTAAAGAAGTGAATACACCAATCGATGATATTCAATTAGGCGGTTCAGATAATAGTAACGGACCAATTACACATGAAGTCAGCGACTTACCAGAAGGTATCACGTTTGATGCAGAAACGAATACGATTAGTGGTACGCCAACAAAAGTAGGTAATTATCCAATCACTGTAACGACAAAAGATGAGGTTGGTAATACTACGGAAACGAACTTTACAATCAATGTTGAAGATACAACGGCACCAAATCTTGACCCAGTGGATGATCAAACTAAAGAAGTGAATACACCAATCGATGATATTCAATTAGGCGGTTCAGATAATAGTAACGGACCAATTACACATGAAGTCAGCGACTTACCAGAAGGTATCACGTTTGATGCAGAAACGAATACGATTAGTGGTACGCCAACAAAAGTAGGTAATTATCCAATCACTGTAACGACAAAAGATGAGGTTGGTAATACTACGGAAACGAACTTTACAATCAATGTTGAAGATACAACGGCACCAAATCTTGACCCAGTGGATGATCAAACTAAAGAAGTGAATACACCAATCGATGATATTCAATTAGGCGGTTCAGATAATAGTAACGGACCAATTACACATGAAGTCAGCGACTTACCAGAAGGTATCACGTTTGATGCAGAAACGAATACGATTAGTGGTACGCCAACAAAAGTAGGTAATTATCCAATCACTGTAACGACAAAAGATGAGGTTGGTAATACTACGGAAACGAACTTTACAATCAATGTTGAAGATACAACGGCACCAAATCTTGACCCAGTGGATGATCAAACTAAAGAAGTGAATACACCAATCGATGATATTCAATTAGGCGGTTCAGATAATAGTAACGGACCAATTACACATGAAGTCAGCGACTTACCAGAAGGTATCACGTTTGATCCAGAAACGAATACGATTAGTGGTACGCCAACAAAAGTAGGTAATTATCCAATCACTGTAACGACAAAAGATGAGGTTGGTAATACTACGGAAACGAACTTTACAATCAATGTTGAAGATACAACGGCACCAAATCTTGACCCAGTGGATGATCAAACTAAAGAAGTGAATACACCAATCGATGATATTCAATTAGGCGGTTCAGATAATAGTAACGGACCAATTACACATGAAGTCAGCGACTTACCAGAAGGTATCACGTTTGATGCAGAAACGAATACGATTAGTGGTACGCCAACAAAAGTAGGTAATTATCCAATCACTGTAACGACAAAAGATGAGGTTGGTAATACTACGGAAACGAACTTTACAATCAATGTTGAAGATACAACGGCACCAAATCTTGACCCAGTGGATGATCAAACTAAAGAAGTGAATACACCAATCGATGATATTCAATTAGGCGGTTCAGATAATAGTAACGGACCAATTACACATGAAGTCAGCGACTTACCAGAAGGTATCACGTTTGATGCAGAAACGAATACGATTAGTGGTACGCCAACAAAAGTAGGTAATTATCCAATCACTGTAACGACAAAAGATGAGGTTGGTAATACTACGGAAACGAACTTTACAATCAATGTTGAAGATACAACGGCACCAAATCTTGACCCAGTGGATGATCAAACTAAAGAAGTGAATACACCAATCGATGATATTCAATTAGGCGGTTCAGATAATAGTAACGGACCAATTACACATGAAGTCAGCGACTTACCAGAAGGTATCACGTTTGATGCAGAAACGAATACAATTAGTGGTACGCCAACAAAAGTAGGTAATTATCCAATCACTGTAACGACAAAAGATGAGGTTGGTAATACTACGGAAACGAACTTTACAATCAATGTTGAAGATACAACGGCACCAAATCTTGACCCAGTGGATGATCAAACTAAAGAAGTGAATACACCAATCGATGATATTCAATTAGGCGGTTCAGATAATAGTAACGGACCAATTACACATGAAGTCAGCGACTTACCAGAAGGTATCACGTTTGATGCAGAAACGAAT
60784 NZ_CP012275.1 Pediococcus-damnosus-strain-TMW-2 Bacteria 0-254 255 16 15 TCTGCGGCAG TCTGCGGCAGCTTTATCTGCAGCAGCTTTGTCTGCGGCAGCCTTGTCTGCGGCGGCTTTATCTGCAGCAGCTTTGTCTGCGGCGGCTTTGTCTGCGGCAGCTTTATCTGCGGCAGCTTTATCTGCAGCAGCTTTATCTGCGGCGGCTTTGTCTGCGGCAGCTTTGTCTGCGGCAGCTTTGTCTGCGGCAGCTTTGTCTGCAGCAGCTTTGTCTGCGGCAGCTTTA
60804 NZ_CP012288.1 Pediococcus-damnosus-strain-TMW-2 Bacteria 0-329 330 20 15 TCTGCGGCAG TCTGCGGCAGCTTTATCTGCGGCAGCTTTGTCTGCGGCAGCTTTGTCTGCGGCAGCCTTGTCTGCGGCGGCCTTGTCTGCGGCAGCTTTATCTGCAGCAGCTTTGTCTGCGGCAGCCTTGTCTGCGGCGGCTTTATCTGCAGCAGCTTTGTCTGCGGCGGCTTTGTCTGCGGCAGCTTTATCTGCGGCAGCTTTATCTGCAGCAGCTTTATCTGCGGCGGCTTTGTCTGCGGCAGCTTTGTCTGCGGCAGCTTTGTCTGCGGCAGCTTTA