Satellite database app by ALGGEN

Id Genbank id Name Type Indice Satlength Numrep Replength Seed Seq
23259 NC_017368.1 Helicobacter-pylori-F16-DNA Bacteria 1255732-1255852 121 11 10 AAGATTAAAT AAGATTAAATAAGATTAAATAAGATTAAATAAGATTAAATAAGATTAAATAAGATTAAATAAGATTAAATAAGATTAAATAAGATTAAATAAGATTAAAT
23973 NC_017595.1 Streptococcus-salivarius-JIM8777 Bacteria 1048744-1048794 51 4 10 AAGAAGTACT AAGAAGTACTAAGAAGTACTAAGAAGTACT
23142 NC_017354.1 Helicobacter-pylori-52 Bacteria 1247169-1247249 81 7 10 AAGATTAAAT AAGATTAAATAAGATTAAATAAGATTAAATAAGATTAAATAAGATTAAATAAGATTAAAT
23249 NC_017367.1 Helicobacter-pylori-F57-DNA Bacteria 1290568-1290648 81 7 10 AAGATTAAAT AAGATTAAATAAGATTAAATAAGATTAAATAAGATTAAATAAGATTAAATAAGATTAAAT
23338 NC_017379.1 Helicobacter-pylori-Puno135 Bacteria 1309135-1309215 81 7 10 AAGATTAAAT AAGATTAAATAAGATTAAATAAGATTAAATAAGATTAAATAAGATTAAATAAGATTAAAT
24122 NC_017656.1 Escherichia-coli-O55:H7-str Bacteria 48929-48989 61 5 10 ATAAAAACCC ATAAAAACCCATAAAAACCCATAAAAACCCATAAAAACCC
22660 NC_017168.1 Yersinia-pestis-A1122 Bacteria 2846206-2846256 51 4 10 GGTGATAGTC GGTGATAGTCGGTGATAGTCGGTGATAGTC
22860 NC_017265.1 Yersinia-pestis-biovar-Medievalis-str Bacteria 837474-837524 51 4 10 ATTTTCAATC ATTTTCAATCATTTTCAATCATTTTCAATC
23165 NC_017358.1 Helicobacter-pylori-Cuz20 Bacteria 197947-198027 81 7 10 TTCTAAACAT TTCTAAACATTTCTAAACATTTCTAAACATTTCTAAACATTTCTAAACATTTCTAAACAT
23220 NC_017365.1 Helicobacter-pylori-F30-DNA Bacteria 141526-141656 131 12 10 TTTAATCTTA TTTAATCTTATTTAATTTTATTTAATTTTATTTAATCTTATTTAATCTTATTTAATCTTATTTAATCTTATTTAATCTTATTTAATCTTATTTAATTTTATTTAATCTTA
23300 NC_017375.1 Helicobacter-pylori-83 Bacteria 1274030-1274130 101 9 10 AAGATTAAAT AAGATTAAATAAGATTAAATAAGATTAAATAAGATTAAATAAGATTAAATAAGATTAAATAAGATTAAATAAGATTAAAT
21887 NC_016901.1 Shewanella-baltica-OS678 Bacteria 505133-505253 121 11 10 TCGCTAAGAC TCGCTAAGACTCGCTAAGACTCGCTAAGACTCGCTAAGACTCGCTAAGACTCGCTAAGACTCGCTAAGACTCGCTAAGACTCGCTAAGACTCGCTAAGAC
23796 NC_017554.1 Pantoea-ananatis-PA13 Bacteria 2549985-2550045 61 5 10 TGTACAACTT TGTACAACTTTGTACAACTTTGTACAACTTTGTACAACTT
23842 NC_017566.1 Shewanella-putrefaciens-200 Bacteria 1458726-1458826 101 9 10 TTTTGTTAGC TTTTGTTAGCTTTTGTTAGCTTTTGTTAGCTTTTGTTAGCTTTTGTTAGCTTTTGTTAGCTTTTGTTAGCTTTTGTTAGC
20975 NC_016001.1 Flavobacterium-branchiophilum-FL-15 Bacteria 718636-718696 61 5 10 ATTAAAACAA ATTAAAACAAATTAAAACAAATTAAAACAAATTAAAACAA
21512 NC_016616.1 Dechlorosoma-suillum-PS Bacteria 2318547-2318597 51 4 10 GGAGGTGGCG GGAGGTGGCGGGAGGTGGCGGGAGGTGGCG
21149 NC_016109.1 Kitasatospora-setae-KM-6054-DNA Bacteria 174475-175251 777 5 10 GCGGGCCCGG GCGGGCCCGGGCGGGCCCGGGCGGGCCCGG
22820 NC_017243.1 Brachyspira-intermedia-PWSA Bacteria 1579616-1579696 81 7 10 AATATTATTG AATATTATTGAATATTATTGAATATTATTGAATATTATTGAATATTATTGAATATTATTG
21350 NC_016582.1 Streptomyces-bingchenggensis-BCW-1 Bacteria 1986527-1986617 91 8 10 GGGACACGGA GGGACACGGAGGGACACGGAGGGACACGGAGGGACACGGAGGGACACGGAGGGACACGGAGGGACACGGA
23150 NC_017355.1 Helicobacter-pylori-v225d Bacteria 617816-617886 71 6 10 TTCATTGGGG TTCATTGGGGTTCATTGGGGTTCATTGGGGTTCATTGGGGTTCATTGGGG
21393 NC_016582.1 Streptomyces-bingchenggensis-BCW-1 Bacteria 11059403-11059603 201 19 10 ACGGCGAACA ACGGCGAACAACGGCGAACAACGGCGAACAACGGCGAACAACGGCGAACAACGGCGAACAACGGCGAACAACGGCGAACAACGGCGAACAACGGCGAACAACGGCGAACAACGGCGAACAACGGCGAACAACGGCGAACAACGGCGAACAACGGCGAACAACGGCGAACAACGGCGAACA
23188 NC_017359.1 Helicobacter-pylori-Sat464 Bacteria 1221312-1221392 81 7 10 AAGATTAAAT AAGATTAAATAAGATTAAATAAGATTAAATAAGATTAAATAAGATTAAATAAGATTAAAT
20728 NC_015859.1 Corynebacterium-variabile-DSM-44702 Bacteria 912596-913150 555 15 10 GCACTGACCG GCACTGACCGGCACTGACCGGCACTGACCGGCACTGACCGGCACTGACCGGCACTGACCGGCACTGACCGGCACTGACCGGCACTGACCGGCACTGACCGGCACTGACCGGCACTGACCGGCACTGACCG
20727 NC_015859.1 Corynebacterium-variabile-DSM-44702 Bacteria 911423-911623 201 19 10 CCGGCACTGA CCGGCACTGACCGGCACTGACCGGCACTGACCGGCACTGACCGGCACTGACCGGCACTGACCGGCACTGACCGGCACTGACCGGCACTGACCGGCACTGACCGGCACTGACCGGCACTGACCGGCACTGACCGGCACTGACCGGCACTGACCGGCACTGACCGGCACTGACCGGCACTGA
21687 NC_016800.1 Corynebacterium-diphtheriae-BH8 Bacteria 191624-191674 51 4 10 CCCGCGGAAC CCCGCGGAACCCCGCGGAACCCCGCGGAAC