Satellite database app by ALGGEN

Id Genbank id Name Type Indice Satlength Numrep Replength Seed Seq
30180 NC_021885.1 Candidatus-Profftella-armatura Bacteria 151038-151293 256 6 15 TTTTTTTTAT TTATTTTTATATTATTTTTTTTTATATTATTTTTTTTTATATTATTTTTTTTTATATTAT
165140 NZ_LR134374.1 Legionella-spiritensis-strain-NCTC12082-genome-assembly Bacteria 433386-434146 761 4 218 TTTTTTTGTG TTTTTTTGTGCTTCTTTGAAGTGGTGGGCGTGGAAGGGGAAGGATAGATTCGTCAGTCACGTTGTTCCTTCCTCACCCCTTCGGGGCGCGCTAAAGCGCGTCCAAAATGCTTCGCCGCGCGTTGCGCTCTTCGCTGCGCATTTTGTTGAACCTCATTCGGTTCGAACACTTCCGGGCCAGGTACATCAGTGTACTGGCCTGTATTTCGGAGTGATTGCTTTTTTTGTGCTTCTTTGGAGTGGCGGGCATGGAAGGGGAAGGATAGATTCGTCAGTCACGTTGTTCCTTCCTCACCCCTTCGGGGCGCGCTAAAGCGCGTCCAAAATGCTTCGCCGCGCGTTGCGCTCTTCGCTGCGCATTTTGTCGAACCTCATTCGGTTCGAACACTTCCGGGCCAGGTACATCAGTGTACTGGCCTGTATTTCGGAGTGATTGCTTTTTTTGTGCTTCTTTGGAGTGGCGGGCATGGAAGGGGAAGGATAGATTCGTCAGTCACGTTGTTCCTTCCTCACCCCTTCGGGGCGCGCTAAAGCGCGTCCAAAATGCTTCGCCGCGCGTTGCGCTCTTCGCTGCGCATTTTGTCGAACCTCATTCGGTTCGAACACTTCCGGGCCAGGTACATCAGTGTACTGGCCTGTATTTCGGAGTGATTGC
161937 NZ_CP045403.1 Bacillus-sp Bacteria 3596222-3596305 84 4 21 TTTTTTTGCG TTTTTTTGCGGGTTCGGTGGGTTTTTTTGCGGGTTCGGTGGTTTTTTTTGCGGCTTTAGGACT
135865 NZ_CP032900.1 Helicobacter-pylori-strain-476-A-EK5-chromosome Bacteria 1572777-1572852 76 5 15 TTTTTTTGAA TTTTTTTGAACCCTTTTTTTTTGAACCCTTTTTTTTTGAACCCTTTTTTTTTGAACCCTTTTTTTTTGAACCCTT
134812 NZ_CP032474.1 Helicobacter-pylori-strain-476-C-EK5-chromosome Bacteria 1539373-1539433 61 4 15 TTTTTTTGAA TTTTTTTGAACCCTTTTTTTTTGAACCCTTTTTTTTTGAACCCTTTTTTTTTGAACCCTT
52897 NZ_CP010350.1 Acinetobacter-johnsonii-XBB1 Bacteria 3526-3585 60 5 12 TTTTTTTCTT TTTTTTTCTTCTTTTTTTTCTTCTTTTTTTTCTTCTTTTTTTTCTTCT
1965 NZ_CP009503.1 Methanosarcina-sp Arqueas 3075948-3076104 157 13 12 TTTTTTTCTT TTTTTTTCTTCGTTTTTTTCTTCGTTTTTTTCTTCGTTTTTTTCTTCGTTTTTTTCTTCGTTTTTTTCTTCGTTTTTTTCTTCGTTTTTTTCTTCGTTTTTTTCTTCGTTTTTTTCTTCGTTTTTTTCTTCGTTTTTTTCTTCGTTTTTTTCTTCG
102132 NZ_CP022345.1 Bacillus-thuringiensis-strain-c25-chromosome Bacteria 3796484-3796604 121 4 24 TTTTTTTCTG TTTTTTTCTGTCTCAGTTTTTTGATTTTTTTCTGCCTCTACCTTCTGATTCTTTTCTGTCTCAGTTTTTTGA
8820 NC_007205.1 Candidatus-Pelagibacter-ubique-HTCC1062 Bacteria 166528-166945 418 5 96 TTTTTTTCTC TTTTTTTCTCTCCATCTCTTGATGATCGATCAGGTCTTCCATAACTAGAGGGTTTTGATTTATCTCCAAAACTAGATTTTCCTTTGTACCCGAAACTTTTTTTCTCTCCATCTCTTGATGATCGATCAGGTCTTCCATAACTAGAGGGTTTTGATTTATCTCCAAAACTAGATTTTCCTTTGTACCCGAAACTTTTTTTCTCTCCATCTCTTGATGATCGATCAGGTCTTCCATAACTAGAGGGTTTTGATTTATCTCCAAAACTAGATTTTCCTTTGTACCCGAAAC
22847 NC_017256.1 Buchnera-aphidicola-str Bacteria 600997-601162 166 11 15 TTTTTTTCAA TTTTTTTCAAGAGATTTTTTTTCAAGAGAGTTTTTTTCAAGAGAGTTTTTTTCAAGAGAGTTTTTTTCAAGAGATTTTTTTTCAAGAGAGTTTTTTTCAAGAGAGTTTTTTTCAAGAGAGTTTTTTTCAAGAGAGTTTTTTTCAAGAGAGTTTTTTTCAAGAGAG
134849 NZ_CP032478.1 Helicobacter-pylori-strain-25-A-EK9-chromosome Bacteria 1341822-1341878 57 4 14 TTTTTTTAAC TTTTTTTAACTCTCTTTTTTTAACTCTCTTTTTTTAACTCTCTTTTTTTAACTCTC
135925 NZ_CP032906.1 Helicobacter-pylori-strain-25-A-EK1-chromosome Bacteria 1341803-1341859 57 4 14 TTTTTTTAAC TTTTTTTAACTCTCTTTTTTTAACTCTCTTTTTTTAACTCTCTTTTTTTAACTCTC
5039 NZ_CP009526.1 Methanosarcina-barkeri-str Arqueas 1472604-1472838 235 6 28 TTTTTTTAAA TTTTTTTAAAAGGGTTGCGAGCAAACCGTTTTTTTAAAAGGGTTGCGGTCAAGCAGTTTTTTTAAAAGGGTTGCGGTTAAGCAGTTTTTTTAAAAGGGTTGCGGGCAAGCAG
130893 NZ_CP031123.2 Providencia-sp Bacteria 4319385-4319448 64 4 14 TTTTTTGTTT TTTTTTGTTTTTTGTTTTTTGTTTTTTGTTTTTTGTTTTTTG
5302 NZ_CP009528.1 Methanosarcina-barkeri-MS Arqueas 442280-442379 100 7 14 TTTTTTGTTT TTTTTTGTTTGTATTTTTTTGTTTGTATTTTTTTGTTTGTATTTTTTTGTTTGTATTTTTTTGTTTGTATTTTCTTGTTTGTAT
135779 NZ_CP032869.1 Mucilaginibacter-sp Bacteria 1590026-1590468 443 8 55 TTTTTTGTGG TTTTTTGTGGATAGTTGGTGAGTTTTAGGCACGCAAAGACGCGAAGACGCAAAGATTTTTTGTGGATAGTTGGTGAGTTTTAAGCGCGCAAAGAGGCTAAGGCGCAAAGATTTTTTGTGGATGGTTGGTGAGTTTTAAGTGCGCAAAGAGGCTAAGGCGCAAAGGTTTTTTGTGGATAGTTGGTAAGTTTTAAGCACGCAAAGATGCTAAGGCGCAAAGGTTTTTTGTGGATAGTTGGTGAGTTTTAAGTGCGCAAAGAGGCTAAGGCGCAAAGGTTTTTTGTGGATAGTTGGTGAGTTTTAAGTGCGCAAAGAGGCTAAGGCGCAAAGGTTTTTTGTGGATAGTTGGTTAGTTTTAAGTGCGCAAAGAGGCTAAGGCGCAAAGG
81942 NZ_CP017253.2 Clostridium-taeniosporum-strain-1k-chromosome Bacteria 47724-47831 108 5 21 TTTTTTGTCC TTTTTTGTCCCCCTTAATTCATTTTTTGTCCCTCGCAATTCATTTTTTGTCCCCCGCAATTGA
97346 NZ_CP020822.1 Tenacibaculum-maritimum-strain-TM-KORJJ-chromosome Bacteria 2300159-2300439 281 5 56 TTTTTTGTAC TTTTTTGTACAGCGTTTTTTTCTCTCGTAAAAACACTGTACAAGATTTCAACGTCATTTTTTGTACAGCGTTTTTTTGCCTCGTAAAAACACTGTACAAGATTTCAACTTCGTTTTTTGTACAGTGTTTTTTTCTCTCGTAAAAACACTGTACAAGATTTCAACTTCGTTTTTTGTACAGTGTTTTTTTCCCTCGTAAAAACGCTGTACAAGATTTCAACTTCATTTTTTGTACAGTGTTTTTTTCCCTCGTAAAAACACTGTACAAGATGTTAACTTGA
169163 NZ_LT634361.1 Tenacibaculum-maritimum-isolate-NCIMB-2154T-genome-assembly Bacteria 2153916-2154140 225 4 56 TTTTTTGTAC TTTTTTGTACAGCGTTTTTTTCTCTCGTAAAAACACTGTACAAGATTTCAACTTCGTTTTTTGTACAGTGTTTTTTTCCCTCGTAAAAACACTGTACAAGATTTCAACTTCGTTTTTTGTACAGTGTTTTTTTCCCTCGTAAAAACGCTGTACAAGATGTTAACTTCATTTTTTGTACAGTGTTTTTTTCCCTCGTAAAAACGCTGTACAAGATTTCAACTTCG
97340 NZ_CP020822.1 Tenacibaculum-maritimum-strain-TM-KORJJ-chromosome Bacteria 1884265-1884489 225 4 56 TTTTTTGTAC TTTTTTGTACAGCGCTTTTTTCCCTCGTAAAAACACTGTACAAGATGTCAACTTCGTTTTTTGTACAGCGTTTTTTTCTCTCGTAAAAACACTGTACAAGATGTTAACTTCATTTTTTGTACAGCGTTTTTTTCTCTCGTAAAAACACTGTACAAGATGTTAACTTCGTTTTTTGTACAGCGTTTTTTTCCCCCGTAAAAACACTGTACAAGATTTCAACTTCG
154669 NZ_CP041663.1 Mycoplasma-anserisalpingitis-strain-MYCAV93-chromosome Bacteria 826673-827201 529 8 66 TTTTTTGGTT TTTTTTGGTTGTGTTAAAGTTGAGTTAGTATAGACGAATTAGTGCGCCAGTATCTGTTTATTGACGTTTTTTGGTTGTGTTAAAGTTGAGTTAGTATAGACTAGCTTTAGCGATTAATTCATCGTAAACGTGTTTTTTGGTTGTGTTAAAGTTGAGTTAGTATAGACCAGGCAAGAACATTAAAGTAAATTCATTAAGTTTTTTGGTTGTGTTAAAGTTGAGTTAGTATAAACCTCAGTTTTGAAAGAATAAAGCTCTTCCCTGTTTTTTGGTTGTGTTAAAGTTGAGTTAGTATAGACTACTGTTTTCAGCGTGTGATGTAAAAAGTCGTTTTTTGGTTGTGTTAAAGTTGAGTTAGTATAGACAGTTCTAACAATTATTTAATCAATTGAACAG
113460 NZ_CP025117.1 Olleya-sp Bacteria 1833030-1833390 361 6 60 TTTTTTGGGA TTTTTTGGGAGGAGGCCAAAAAACAGTAATTAGAAAATCTGTGATTTTCAAATACTAAGTTTTTTTGGGAGGAGGCCAAAAAACAGTAATTAGAAAATCTGTGATTTTCAAATACTAAGTTTTTTTGGGAGGAGGCCAAAAAACAGTAATTGGAAAATCTGTGATTTTCAAATACCAAGTTTTTTTGGGAGGAGGCCAAAAAACAGTAATTAGAAAATCTGTGATTTTCAAATACCAAGTTTTTTTGGGAGGAGGCCAAAAAACAGTAATTGGAAAATCTGTGATTTTCAAATACCAAGTTTTTTTGGGAGGAGGCCAAAAAACAGTAATTGGAAAATCTGTGATTTTCAAATACCAAGT
78819 NZ_CP016796.1 Francisella-sp Bacteria 1810527-1810653 127 6 21 TTTTTTGCTC TTTTTTGCTCCAGATCAGAATTTTTTTGCTCCAAATCAGAATTTTTTTGCTCCAAATCAGAATTTTTTTGCTCCAGATCAGAATTTTTTTGCTCCAGATCAGAATTTTTTTGCTCCAGATCAGAAT
10233 NC_008312.1 Trichodesmium-erythraeum-IMS101 Bacteria 2349457-2352832 3376 15 225 TTTTTTGAGA TTTTTTGAGATGAAATGATTTTTAGGAGGTTGTTTGATGTTTAAGGTTGGCAACTATATTTGGTGATTTATTGAAGAGCGATCGCTAAACTGGCTACTACCTAAAATCTGCAAGTTAAAACCTACAACTTCTTAAGGAATGTAATAAGTTGATTCAAAATAATAAGCTAAAAACTACAGGGTTGTTTCCCTGAATAGGTTGTTAAAGTAATGTTTGAAAAGTCAATTTTTTGAGATGAAAGGATTTTTAGGAGGTTGTTTGATGTTTAAGGTTGGCAACTATATTTGGTGATTTATTGAAGAGCGATCGCTAAACTGGCTACTACCTAAAATCTGCAAGTTAAAACCTACAACTTCTTAAGGAATGTAATAAGTTGATTCAAAATAATAAGCTAAAAACTACAGGGTTGTTTCCCTGAATAGGTTGTTAAAGTAATGTTTGAAAAGTCAATTTTTTGAGATGAAAGGAATTTTAGGAGGTTATTTAATATTTAAGGTTGGCAACTATATTTGGTGATTTCTTGAAGAGCGATCGCTAAACTGGCTACTACCTAAAATCTGCAAGTTAAAACCTACAACTTCTTAAGGAAAGTAATAAGTTGATTCAAAATAATAAGCTAAAAACTACAGGGTTGTTTCCCTGAATAGGTTGTTAAAGTAATGTTTGAAAAGTCAATTTTTTGAGATGAAAGGATTTTTAGGAGGTTGTTTGATGTTTAAGGTTGGCAACTATATTTGGTGATTTCTTGAAGAGCGATCGCTAAACTGGCTACTACCTAAAATCTGCAGGTTAAAACCTACAACTTCTTAAGGAAAGTAATAAGTTGATTCAAAATAATAAGCTAAAAACTACAGGGTTGTTTGCCTGAATAGGTTGTTAAAGTAATTTTTGAAAAGTCAATTTTTTGAGATGAAAGGAATTTTAGGAGGTTATTTAATATTTAAGGTTGGCAACTATATTTGGTGATTTCTTGAAGAGCGATCGCTAAACTGGCTACTACCTAAAATCTGCAGGTTAAAACCTACAACTTCTTAAGGAAAGTAATAAGTTGATTCAAAATAATAAGCTAAAAACTACAGGGTTGTTTGCCTGAATAGGTTGTTAAAGTAATTTTTGAAAAGTCAATTTTTTGAGATGAAAGGAATTTTAGGAGGTTATTTAATATTTAAGGTTGGCAACTATATTTGGTGATTTCTTGAAGAGCGATCGCTAAACTGGCTACTACCTAAAATCTGCAAGTTAAAACCTACAACTTCTTAAGGAAAGTAATAAGTTGATTCAAAATAATAAGCTAAAAACTACAGGGTTGTTTCCCTGAATAGGTTGTTAAAGTAATGTTTGAAAAGTCAATTTTTTGAGATGAAAGGATTTTTAGGAGGTTGTTTGATGTTTAAGGTTGGCAACTATATTTGGTGATTTCTTGAAGAGCGATCGCTAAACTGGCTACTACCTAAAATCTGCAGGTTAAAACCTACAACTTCTTAAGGAAAGTAATAAGTTGATTCAAAATAATAAGCTAAAAACTACAGGGTTGTTTGCCTGAATAGGTTGTTAAAGTAATTTTTGAAAAGTCAATTTTTTGAGATGAAAGGAATTTTAGGAGGTTATTTAATATTTAAGGTTGGCAACTATATTTGGTGATTTCTTGAAGAGCGATCGCTAAACTGGCTACTACCTAAAATCTGCAAGTTAAAACCTACAACTTCTTAAGGAAAGTAATAAGTTGATTCAAAATAATAAGCTAAAAACTACAGGGTTGTTTCCCTGAATAGGTTGTTAAAGTAATGTTTGAAAAGTCAATTTTTTGAGATGAAAGGATTTTTAGGAGGTTGTTTGATGTTTAAGGTTGGCAACTATATTTGGTGATTTCTTGAAGAGCGATCGCTAAACTGGCTACTACCTAAAATCTGCAAGTTAAAACCTACAACTTCTTAAGGAATGTAATAAGTTGATTCAAAATAATAAGCTAAAAACTACAGGGTTGTTTGCCTGAATAGGTTGTTAAAGTAATGTTTGAAAAGTCAATTTTTTGAGATGAAAGGATTTTTAGGAGGTTGTTTGATGTTTAAGGTTGGCAACTATATTTGGTGATTTCTTGAAGAGCGATCGCTAAACTGGCTACTACCTAAAATCTGCAGGTTAAAACCTACAACTTCTTAAGGAAAGTAATAAGTTGATTCAAAATAATAAGCTAAAAACTACAGGGTTGTTTGCCTGAATAGGTTGTTAAAGTAATTTTTGAAAAGTCAATTTTTTGAGATGAAAGGAATTTTAGGAGGTTATTTAATATTTAAGGTTGGCAACTATATTTGGTGATTTCTTGAAGAGCGATCGCTAAACTGGCTACTACCTAAAATCTGCAAGTTAAAACCTACAACTTCTTAAGGAAAGTAATAAGTTGATTCAAAATAATAAGCTAAAAACTACAGGGTTGTTTGCCTGAATAGGTTGTTAAAGTAATTTTTGAAAAGTCAATTTTTTGAGATGAAAGGAATTTTAGGAGGTTATTTAATATTTAAGGTTGGCAACTATATTTGGTGATTTCTTGAAGAGCGATCGCTAAACTGGCTACTACCTAAAATCTGCAAGTTAAAACCTACAACTTCTTAAGGAAAGTAATAAGTTGATTCAAAATAATAAGCTAAAAACTACAGGGTTGTTTCCCTGAATAGGTTGTTAAAGTAATGTTTGAAAAGTCAATTTTTTGAGATGAAAGGATTTTTAGGAGGTTGTTTGATGTTTAAGGTTGGCAACTATATTTGGTGATTTATTGAAGAGCGATCGCTAAACTGGCTACTACCTAAAATCTGCAGGTTAAAACCTACAACTTCTTAAGGAAAGTAATAAGTTGATTCAAAATAATAAGCTAAAAACTACAGGGTTGTTTGCCTGAATAGGTTGTTAAAGTAATTTTTGAAAAGTCAATTTTTTGAGATGAAAGGAATTTTAGGAGGTTATTTAATATTTAAGGTTGGCAACTATATTTGGTGATTTCTTGAAGAGCGATCGCTAAACTGGCTACTACCTAAAATCTGCAAGTTAAAACCTACAACTTCTTAAGGAAAGTAATAAGTTGATTCAAAATAATAAGCTAAAAACTACAGGGTTGTTTCCCTGAATAGGTTGTTAAAGTAATGTTTGAAAAGTCAATTTTTTGAGATGAAAGGATTTTTAGGAGGTTGTTTGATGTTTAAGGTTGGCAACTATATTTGGTGATTTCTTGAAGAGCGATCGCTAAACTGGCTACTACCTAAAATCTGCAGGTTAAAACCTACAACTTCTTAAGGAAAGTAATAAGTTGATTCAAAATAATAAGCTAAAAACTACAGGGTTGTTTGCCTGAATAGGTTGTTAAAGTAATGTTTGAAAAGTCAA
104598 NZ_CP022983.1 Bacillus-kochii-strain-BDGP4-chromosome Bacteria 820683-821092 410 8 51 TTTTTTGACT TTTTTTGACTCATTTCCGCTTGAATCCAACCAAATTTTTACCCGGACTCGCTTTTTTGACTCGTTTCCGCTTGAATCCAATCAAATTTTTGCCTGGGCTCCCTTTTTTGACTCGTTTCCGCTTGAATCCAATCAAATTTTTGCCTGGGCTCCCTTTTTTGACTCGTTTCTGCTTGAATCCAATCAAATTTTTGCCTGGGCTCCCTTTTTTGACTCGTTTCTGCTTGAATCCAATCAAATTTTTGCCTGGGCTCCC