Satellite database app by ALGGEN

Id Genbank id Name Type Indice Satlength Numrep Replength Seed Seq
65363 NZ_CP013118.1 Salinivirga-cyanobacteriivorans-strain-L21-Spi-D4-chromosome Bacteria 4177909-4196880 18972 256 66 CCGCACCAAA CCGCACCAAAATGGAATTGAAATGTCGTATCAATTGATACAGCATTTTGCCCGTAAAAGCTTCCAACCGCACCAAAATGGAATTGAAATCAATTTACTAAGACGTGCTTGGCTCTTAACCATACGCTTCCAACCGCACCAAAATGGAATTGAAATATTGTTGCGAGAGTTAACTTAATGACGTCTTTCCACCTTCCAACCGCACCAAAATGGAATTGAAATTTAAACAGCAATTAAAACGCGATCTCGAGAAATGGGCTTCCAACCGCACCAAAATGGAATTGAAATAAAATTGATACAATTACAGGAATTAAAGCACCGACACTTCCAACCGCACCAAAATGGAATTGAAATCACAAATACAGGGCAGTAACGATGGAACTTTTTGGACTTCCAACCGCACCAAAATGGAATTGAAATATACCCCGTCAATGATACTAGCTTTTTTTATCAGTACTTCCAACCGCACCAAAATGGAATTGAAATCTTATAGTCCGAGGATTCTTATCGTTTACTTTTATTCTTCCAACCGCACCAAAATGGAATTGAAATACCACCAACTATCCATGAATCATATTTTAATTTTAACTTCCAACCGCACCAAAATGGAATTGAAATAAAAATATTATCTCTCAACAAATATAACTCCATCAACTTCCAACCGCACCAAAATGGAATTGAAATACGAAGGCGAAACTGTTCTTGATAATACAATGGGTACTTCCAACCGCACCAAAATGGAATTGAAATCAGTTTTTTTTGTCCCTTCGCTGGCTTCGCTCAATCCTTCCAACCGCACCAAAATGGAATTGAAATATCGTCAAAAATTCAGAAGGGTACGGCTATAATTACCTTCCAACCGCACCAAAATGGAATTGAAATTCCGCCAGTTAGTAGGATAGTCTTATATCGGGCAACCTTCCAACCGCACCAAAATGGAATTGAAATAATTGTATCACTCTATATTGAAGGAAATGGAAAATGCTTCCAACCGCACCAAAATGGAATTGAAATTACATATCCATCATGCTTTCCCGTATCAATCCCATACTTCCAACCGCACCAAAATGGAATTGAAATTAAGAAGCCCCACCGCCACAACAGTATAAATCAAGCCTTCCAACCGCACCAAAATGGAATTGAAATGAGAAAGTGGATGAATTGATTGCGCATAAGGCAACTCTTCCAACCGCACCAAAATGGAATTGAAATTTGAAATTGAATACAATAGTAGTGAAAATGATGGTGCTTCCAACCGCACCAAAATGGAATTGAAATATATAATTTTTCAGGCACTTATGATGGAAATGAGTTCTTCCAACCGCACCAAAATGGAATTGAAATTGAGCAGGATGACAAGATAAAGGATTTACAGATCAACTTCCAACCGCACCAAAATGGAATTGAAATACCTGAGAGCTTTGAGTCGCCCAGCTTTGTAGTATCCTTCCAACCGCACCAAAATGGAATTGAAATGTTGTTGAATTTAAAATTTAAAAATATGAAAACTACCTTCCAACCGCACCAAAATGGAATTGAAATTACACATCATGAAAAATTTAACAAAAATTATCGATTCTTCCAACCGCACCAAAATGGAATTGAAATGGTTTACTGTACACTAAAACACGTGAATTATGGCAACTTCCAACCGCACCAAAATGGAATTGAAATATGATGGGAATTCTGAATACTATCAACGGAGCTACGCTTCCAACCGCACCAAAATGGAATTGAAATCCAGAATGTTGGCCGGTTTTAGGGCTTATGCAGAACCTTCCAACCGCACCAAAATGGAATTGAAATTACCTTCCAAATCCTCAGATTTGAATTCTTCATTACCTTCCAACCGCACCAAAATGGAATTGAAATATGCTAACGGACCTAATGCGGCAGTCAATCCTCCTACTTCCAACCGCACCAAAATGGAATTGAAATATGTCATCAATTGCCATAAATTGCATATCAGGATCACTTCCAACCGCACCAAAATGGAATTGAAATATGCAGGCACATCTTAGCGCCTTTGTACATCCATGGCTTCCAACCGCACCAAAATGGAATTGAAATTCAAAATAATGATCCATGTTTTCATGCATCACTGCTCTTCCAACCGCACCAAAATGGAATTGAAATGAACAAGTTTTAGGCAGGCATTATTTTTTATGGCTTCTTCCAACCGCACCAAAATGGAATTGAAATATGCTAATCGAACAATTACTTCATACAATTCATAATCTTCCAACCGCACCAAAATGGAATTGAAATATGTAAGCAACTTATTGTTTACTTTAAGATATGATGCTTCCAACCGCACCAAAATGGAATTGAAATAAAATAGTATCATCGGCCATTTCTTCCTTTCTACTACTTCCAACCGCACCAAAATGGAATTGAAATCAATTAAAAGGGCAAAAGTTAAACGATAAGTTTTCCCTTCCAACCGCACCAAAATGGAATTGAAATTACACATCATGAAAAATTTAACAAAAATTATCGATTCTTCCAACCGCACCAAAATGGAATTGAAATCTTATAGTCCGAGGATTCTTATCGTTTACTTTTATTCTTCCAACCGCACCAAAATGGAATTGAAATGAGCCATGAGCCAATAAGCTCAACCGTGATATTTTTCTTCCAACCGCACCAAAATGGAATTGAAATCGAATTAATGATGATTAAAAGGAAAATTGATTAGTTCTTCCAACCGCACCAAAATGGAATTGAAATATGTCATCAATTTCCATAAATTGCATATCAGGATCACTTCCAACCGCACCAAAATGGAATTGAAATTAGATAAAAAATTTAGACCTTCGGCAGCTTCTGTGGCTTCCAACCGCACCAAAATGGAATTGAAATTAGTTTATTATTACTATCTCCCCCTATACTATATTACTTCCAACCGCACCAAAATGGAATTGAAATTTACATCAGCGTTTGAGATATTAAATAAATCTTTGTCTTCCAACCGCACCAAAATGGAATTGAAATATGTTTAACGAATTTATACAATACATGGGACATTTTCTTCCAACCGCACCAAAATGGAATTGAAATTGAATGGTTTATTCAGTGCGTTTGGGCAGCGTTTTGCTTCCAACCGCACCAAAATGGAATTGAAATCGAAAATGGCTTGGTTGAAGGCGCTAACGAAATGCGCTTCCAACCGCACCAAAATGGAATTGAAATAAAAACAAGCTAAAACAGCCGTTAACAGATTAAATCCTTCCAACCGCACCAAAATGGAATTGAAATACATTAAAATAATTTAAAAATTATACATTATGAGAACTTCCAACCGCACCAAAATGGAATTGAAATTAATTAGCAAGGTGCTTTCTTCGATAGCTGTTTTCCCTTCCAACCGCACCAAAATGGAATTGAAATATAGTCGTTACGTGAGTAACGGCTTTGGTGTGAGTGCTTCCAACCGCACCAAAATGGAATTGAAATTTAATATCGGGGTTTTCCCTGAATTTACAAGGATTACTTCCAACCGCACCAAAATGGAATTGAAATTAGGGCGCATTTTATCTCCTGCGCTCCGTCGCAGGACTTCCAACCGCACCAAAATGGAATTGAAATTGTAGATGAAACAGAATACATTTTAAAGTTACCTGACTTCCAACCGCACCAAAATGGAATTGAAATCAATGTGTTTGAGGAGTACACGGCGGCCGGGGCAATCTTCCAACCGCACCAAAATGGAATTGAAATTAATTACCTCCTTTGTATTTCTAAATTAAATATAAACTTCCAACCGCACCAAAATGGAATTGAAATTTAATATCGGGGTTTTCCCTGAATTTACAAGGATTACTTCCAACCGCACCAAAATGGAATTGAAATTAGGGCGCATTTTATCTCCTGCGCTCCGTCGCAGGACTTCCAACCGCACCAAAATGGAATTGAAATTGTAGATGAAACAGAATACATTTTAAAGTTACCTGACTTCCAACCGCACCAAAATGGAATTGAAATCAATGTGTTTGAGGAGTACACGGCGGCCGGGGCAATCTTCCAACCGCACCAAAATGGAATTGAAATTAATTACCTCCTTTGTATTTCTAAATTAAATATAAACTTCCAACCGCACCAAAATGGAATTGAAATTTGTTTTCGCTTCCTTTGTTGTAGTTTCCCACGTTGCTTCCAACCGCACCAAAATGGAATTGAAATTATTTACACGGGGCATACTTTGTAATGTCTGGTTTCCTTCCAACCGCACCAAAATGGAATTGAAATTACTATCAGGATCGCCCGTTTCTGAGCGTGCCACAACTTCCAACCGCACCAAAATGGAATTGAAATTTCTCATAACAGGTGCGGCACGCTCAGGAACTAGTACTTCCAACCGCACCAAAATGGAATTGAAATGGAAGATTAACTCCTAGAGAACTGAAAATATCTGTGCTTCCAACCGCACCAAAATGGAATTGAAATATATACTACGTGCTCATTTTCTTTGAATATTTCCGGCTTCCAACCGCACCAAAATGGAATTGAAATGGAAAAAACATAAAACAATTAACAAGTAGAATTAATCTTCCAACCGCACCAAAATGGAATTGAAATTCGAAAAAAAGGTAGAAGAACTTCCAATACATGAACCTTCCAACCGCACCAAAATGGAATTGAAATAACTCTCATATTGACACAATTTTATCAAGAAGGCCACTTCCAACCGCACCAAAATGGAATTGAAATATAGTACCTGATTCCATAAACCATGTAACATCATTACTTCCAACCGCACCAAAATGGAATTGAAATTCATACCCAATAATATCAATCCATTCTTCCCCTTGACTTCCAACCGCACCAAAATGGAATTGAAATAAGAATGGGCGTACAAAATGAAAGGGAAATGTATAGCTTCCAACCGCACCAAAATGGAATTGAAATATACTGGACCATTCCGTACGGGTTTTGCATAATTTGCTTCCAACCGCACCAAAATGGAATTGAAATGCAGCCAAGACGCGGATCAATGGAACGCTTTTATTACTTCCAACCGCACCAAAATGGAATTGAAATTGGTTGATTTTCTTTTAATCCTTGCCGTTTCATTATCTTCCAACCGCACCAAAATGGAATTGAAATGCCAGCACTGAAGAACAGGATGATGTTCAAGATATACTTCCAACCGCACCAAAATGGAATTGAAATCTTCCATTGCTTTCCAGCAAATCCCCCTGTAAAATGCTTCCAACCGCACCAAAATGGAATTGAAATGCACCAGAATGGGCTTGAACTTTACCCGCGCTGGTGCTTCCAACCGCACCAAAATGGAATTGAAATCTAGGAACATTGGTTTACCTGTCTGCGAATAGTATTCTTCCAACCGCACCAAAATGGAATTGAAATTATCCTGTCTAATATAACGTGCAAAATAATCCCTGACTTCCAACCGCACCAAAATGGAATTGAAATTTATATGATTTGAAAAATTATGCCCTTTTTTCGTAACTTCCAACCGCACCAAAATGGAATTGAAATCTTAGAGACGCAAGAATTTAAAACGAAGATATTATGCTTCCAACCGCACCAAAATGGAATTGAAATTTTCTATTCAACTTAAAAAAGGAGATAGTATAGAGGCTTCCAACCGCACCAAAATGGAATTGAAATTTGTACCTTTTTGCAATAATGTAAGTAGAGCGGGCCCTTCCAACCGCACCAAAATGGAATTGAAATACGGTAATTTTTTCCATTTGAATTTCATTGACGGCTCTTCCAACCGCACCAAAATGGAATTGAAATGTGGATGTTTCAGGCGTGAAGATTAGAAAAGGTGAGCTTCCAACCGCACCAAAATGGAATTGAAATAATACGCTACAAACAACAAGGAGATAAAGATGCTGGCTTCCAACCGCACCAAAATGGAATTGAAATACGGAAGATTTTGAGGCACAATGGCACGCATTTAAGCTTCCAACCGCACCAAAATGGAATTGAAATGAAATTTACTCAGCACAGTACTGCTGATTATCGGAGCTTCCAACCGCACCAAAATGGAATTGAAATAATCAAACTTCAAGGTTATTAAGAGGGAATATCACACTTCCAACCGCACCAAAATGGAATTGAAATACGAAGGCGAAACTGTTCTTGATAATACAATGGGTACTTCCAACCGCACCAAAATGGAATTGAAATACATAAAAGAAAACCTAAAAGAAATTCCAGAGGTTTCTTCCAACCGCACCAAAATGGAATTGAAATATCGCTGCATGTCCTCAAAATACCGTCCGTATGGTTCTTCCAACCGCACCAAAATGGAATTGAAATCAATTATTTAATCCAGCAACCTTAATATAAACCTGTCTTCCAACCGCACCAAAATGGAATTGAAATAAGGAAACAATAAAAATATTGAAAATGATATTAATACTTCCAACCGCACCAAAATGGAATTGAAATATGCAATTGCATTAATACCATCAATTGCATTTAAAGCTTCCAACCGCACCAAAATGGAATTGAAATATGAAAGACTTTATTTTGCCCGCAGCATTGACAAGGCTTCCAACCGCACCAAAATGGAATTGAAATTGCGATGTACTTCATTATATCGCAATTCTCAATTTTCTTCCAACCGCACCAAAATGGAATTGAAATCAGTTACTTGGTGGGAAATAGCGCGCGGGATAGTGGCTTCCAACCGCACCAAAATGGAATTGAAATTCAGACAAAGTTGCAAAAGTCTTTATTCCAGTATCACTTCCAACCGCACCAAAATGGAATTGAAATTTATCTCTCAGGTAATAGCTATCATCTTCCGGCTCTCTTCCAACCGCACCAAAATGGAATTGAAATTAATTAAGGTATGTGTCGGGGTCGTAGCTCACAAACCTTCCAACCGCACCAAAATGGAATTGAAATTTGGGCGGCGTTATTAATGGGATAAAAGGGATGACCCTTCCAACCGCACCAAAATGGAATTGAAATTATTATAGACCCAATTAGATATGCAGTAAGATTTTACTTCCAACCGCACCAAAATGGAATTGAAATATTTCAGGCCCTTGTGATATTTCGGTAAAGTAATCACTTCCAACCGCACCAAAATGGAATTGAAATAAATGTCGTAATAAGTCCACCTTATCCCGGTGTGTTCTTCCAACCGCACCAAAATGGAATTGAAATAGGGCAAAAAAGGCTTAGTACCCAAAGCCCTAACTACTTCCAACCGCACCAAAATGGAATTGAAATAACTTACAGGCAAACAACACAAACATGTTTTAGTTGCTTCCAACCGCACCAAAATGGAATTGAAATATGCCAAGCAAATAAGTTTGTTTTAACTATTGTAGCCTTCCAACCGCACCAAAATGGAATTGAAATTCGTACATTGTTGTACGAATATCATAAGTGGATGCGCTTCCAACCGCACCAAAATGGAATTGAAATATATAATTTGATATTGCGTATGCAAATCGAAAATTACTTCCAACCGCACCAAAATGGAATTGAAATCATTAAGCGGGTTTTTTTCTTACTATATATAAAATTCTTCCAACCGCACCAAAATGGAATTGAAATATTTTTGTTCATCATTCTTTTTCATAATTTTATATCCTTCCAACCGCACCAAAATGGAATTGAAATATATAATCTTTTATGCTAAATGGATTATATTCTCTACTTCCAACCGCACCAAAATGGAATTGAAATAATACGCTACAAACAACAAGGAGATAAAGATGCTGGCTTCCAACCGCACCAAAATGGAATTGAAATAACGCAAAACCATTTTGCAAAAATGGTAAGTAGGCTCTTCCAACCGCACCAAAATGGAATTGAAATAATATCGAAATACTCGATAAACTTGCGGTCTTCGCTCTTCCAACCGCACCAAAATGGAATTGAAATGAAATTTACTCAGCACAGTACTGCTGATTATCGGAGCTTCCAACCGCACCAAAATGGAATTGAAATTTAGAATTAAAAAACTTTGTAAAGGCTAACCGCCTGCTTCCAACCGCACCAAAATGGAATTGAAATCAGCTAAAGCCATGTTAATATATGCCATTTTAAGCTCTTCCAACCGCACCAAAATGGAATTGAAATAATCAAACTTCAAGGTTATTAAGAGGGAATATCACACTTCCAACCGCACCAAAATGGAATTGAAATACGAAGGCGAAACTGTTCTTGATAATACAATGGGTACTTCCAACCGCACCAAAATGGAATTGAAATTTCCTTTAACATTCAATGCATCACGCTCACCACTGGCTTCCAACCGCACCAAAATGGAATTGAAATATCAGTATTGCTAAGAAGCGATAATGAACAGGCAGCCTTCCAACCGCACCAAAATGGAATTGAAATTCGGGAATGCTTTTGCCGTAAGATTCATTGCAGATACTTCCAACCGCACCAAAATGGAATTGAAATCCTTCTGATTCCCACTCAATATTCTGAATAGGCATGCTTCCAACCGCACCAAAATGGAATTGAAATATTCTAAATGAATGATTGACAGCAATTACTTTCTTCCTTCCAACCGCACCAAAATGGAATTGAAATACAACGTCTTACTGAATTGCGGAAGGAGGGTGCGCACTTCCAACCGCACCAAAATGGAATTGAAATTACTTTCCAAATCCTCAGGTTTGAATTCTTCATTACCTTCCAACCGCACCAAAATGGAATTGAAATAACGAATCTATTGATCTTTCGATTTATTCTCCGCCCCTTCCAACCGCACCAAAATGGAATTGAAATATCCTAATAAACTATTTGTTACTAGTAAATCCTTTACTTCCAACCGCACCAAAATGGAATTGAAATTTCCTTTAACATTCAATGCATCACGCTCACCACTGGCTTCCAACCGCACCAAAATGGAATTGAAATATCAGTATTGCTAAGAAGCGATAATGAACAGGCAGCCTTCCAACCGCACCAAAATGGAATTGAAATTCGGGAATGCTTTTGCCGTAAGATTCATTGCAGATACTTCCAACCGCACCAAAATGGAATTGAAATCCTTCTGATTCCCACTCAATATTCTGAATAGGCATGCTTCCAACCGCACCAAAATGGAATTGAAATATTCTAAATGAATGATTGACAGCAATTACTTTCTTCCTTCCAACCGCACCAAAATGGAATTGAAATACAACGTCTTACTGAATTGCGGAAGGAGGGTGCGCACTTCCAACCGCACCAAAATGGAATTGAAATTACTTTCCAAATCCTCAGGTTTGAATTCTTCATTACCTTCCAACCGCACCAAAATGGAATTGAAATAACGAATCTATTGATCTTTCGATTTATTCTCCGCCCCTTCCAACCGCACCAAAATGGAATTGAAATATCCTAATAAACTATTTGTTACTAGTAAATCCTTTACTTCCAACCGCACCAAAATGGAATTGAAATATGATCCGACTTTTCCAACCTTCAGAAAAAATCATTCTTCCAACCGCACCAAAATGGAATTGAAATATAAAATTACTATGCCAAATGCACAAGTCCAGTAATCTTCCAACCGCACCAAAATGGAATTGAAATTAACAGAATTAATTGCGGTTGGTATTGTTGCACATACTTCCAACCGCACCAAAATGGAATTGAAATTATTTTCGCCCTGCCTGCGTTTATTTCGATAGTTTCCTTCCAACCGCACCAAAATGGAATTGAAATATTCTAAATGAATGATTGACAGCAATTACTTTCTTCCTTCCAACCGCACCAAAATGGAATTGAAATTCGAAATAAGGCGGGTCAACTACTGCTAAGTCAAAACTTCCAACCGCACCAAAATGGAATTGAAATCTGATTAAAGCCTATTCCCTGGGCATTCATAACATACTTCCAACCGCACCAAAATGGAATTGAAATATACGTTTAAAGCCTTCGTATGTGACAACTGTAATGCTTCCAACCGCACCAAAATGGAATTGAAATATGATATTACCAAAATTTATTGTTATTGCAATTCTTCTTCCAACCGCACCAAAATGGAATTGAAATATCCTTGTCGCCCTCAGTGAATTTAGTTGCCTTATGCTTCCAACCGCACCAAAATGGAATTGAAATAAACAATTGCTGAATCACTAGGAGATATAAAAATTGCTTCCAACCGCACCAAAATGGAATTGAAATTATATAGTGTAGAATTTTGCGGGCAATTGTTTTATTCTTCCAACCGCACCAAAATGGAATTGAAATATTAGTGTCTAATTACGATATAATTGCATTAGAGGACTTCCAACCGCACCAAAATGGAATTGAAATACTGGAAGCGGCAAAACGGTTATTTTCAGTTACATTCTTCCAACCGCACCAAAATGGAATTGAAATGACCAAAGGGATGCAACAACAATTTCATTTAATGCACTTCCAACCGCACCAAAATGGAATTGAAATGATCTAATGTTAAATTCATTGAGTGCGTCAAATCGGCTTCCAACCGCACCAAAATGGAATTGAAATATCGGATTAATTTTTCATCTGTCATGACCCTTTGGTCTTCCAACCGCACCAAAATGGAATTGAAATGTACTTCGGTACTGATGGGTGGGAACCCAACGTTGACTTCCAACCGCACCAAAATGGAATTGAAATACCTTACCCACTTATTGAAATTGATGTGATTAAAAACTTCCAACCGCACCAAAATGGAATTGAAATAACTTGAAACACGGAACCTGAAACCTGAAACATGGACTTCCAACCGCACCAAAATGGAATTGAAATCCACATTAGATTTAGCTGCCGCGGGTAATATGAAGTCTTCCAACCGCACCAAAATGGAATTGAAATTAGTGAGCTGTTTCAAATTGCGGATAGTTTTAATAACTTCCAACCGCACCAAAATGGAATTGAAATTTGGATGTGAGTGTAGGGGTGTTCACGGATGAGGAACTTCCAACCGCACCAAAATGGAATTGAAATGCTCTCGATGGATGGAAAGGTACGTGGGCAGAATGACTTCCAACCGCACCAAAATGGAATTGAAATTTTGAGAGCGCATCTCATCTGGTAGCATTTTCATGACTTCCAACCGCACCAAAATGGAATTGAAATAGAGGTGTTACACCTTTGGATACTTCTGTAAGAAAACTTCCAACCGCACCAAAATGGAATTGAAATCTCACAAATAAATTGCGGCGGGTTGAATGTTGATAGCTTCCAACCGCACCAAAATGGAATTGAAATATACATGTAAGTCAAACTAGAAGGCAAGTCGGCAACCTTCCAACCGCACCAAAATGGAATTGAAATAAAAATATGATAAAATTAAGACCTTACCAAGAAAGACTTCCAACCGCACCAAAATGGAATTGAAATTTCTTTACTTTTCTTCAATGCATAATCAGCAGCGGCCTTCCAACCGCACCAAAATGGAATTGAAATGTCGTATCAATTGATACAGCATTTTGCCCGTAAAAGCTTCCAACCGCACCAAAATGGAATTGAAATCAATTTACTAAGACGTGCTTGGCTCTTAACCATACGCTTCCAACCGCACCAAAATGGAATTGAAATATTATCAAATTCGTAGAAAGTGTATGCGTTCAAACCCTTCCAACCGCACCAAAATGGAATTGAAATCCACCAAAGTCATTCCTAAAAATGAAAATACGTTCACTTCCAACCGCACCAAAATGGAATTGAAATCTTGTTGGTGCCATGTTCCTTTATACCAGCTTACTTCTTCCAACCGCACCAAAATGGAATTGAAATGGCTTTCTTTTTTCGGGCAAATTTAAAACCTAGCGACTTCCAACCGCACCAAAATGGAATTGAAATATTGTTGCGAGAGTTAACTTAATGACGTCTTTCCACCTTCCAACCGCACCAAAATGGAATTGAAATTTAAACAGCAATTAAAACGCGATCTCGAGAAATGGGCTTCCAACCGCACCAAAATGGAATTGAAATATTGATTGGAATTGTCGTTGCAGGGTTAAACGAGTTCTTCCAA
129951 NZ_CP030278.1 Ethanoligenens-harbinense-strain-W1-chromosome Bacteria 674794-693566 18773 283 67 TTTCAATCCA TTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTCCTCCTGGCAAAATTAAAACAGAATATATATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCCCGTCTGATGATGACCGGATGGCTACCGGTCGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGCCGATTCGATAGATTTAAGGCTATCCAGTTTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTCCTCCTGGCAAAATTAAAACAGAATATATATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTTGTCGATGTTTACGTCGGGTTAAGTGTCTATCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGGCACGGGATATTTATGGTCGCATTCGAGGTACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGCGCGTGGGTCTGTCAAACTGCGTAAACAGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTACGCATCAACTTACGAGATATCATGACAAGAGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATACAGGCTTGGATTTGGATAATGTCGCTTCCATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGGATCGTGGCTGACATATGGTGATATCGAGAACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTGTCTGTGGGAATACGTTGCCTTTGATGTTGGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCTGCCGAGCAGGTAGTCTGTTGATGTTTTGAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCACGTGATCGGATGGTTTTATCAGCTGTTTCCTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTGCCCTGGGCGAGATCAAAGAAAACTATGTGACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGATACCCGCCAACATACGATTGGCATTACGTTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCAACTTCCTCCTGCGCTCCGTGAGACTATCTATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACAAGCAGGTGGCGGGATATCTCAACGCCAAGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGCGCTTGGCATGTTGAGTATGCGCGCAGCACAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATATACATTTTGGCGTAGTAACATGAATGATATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCAACACACAACAACGACGACAAAATAATCATATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACCGATTGGGGTATTTTTTTGCTACTGTGTCACAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCGAGGGCCTGACCAGCAGGCCCACACCACACACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCGATCGCGCCGGGCATACTCCCGAGGATTAAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTCAAAATTCGCAATCACATTCGTATGCGTTGGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAGTTGCATAGTATTGCAACACCATTTTAGTAGACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTGGGCATCTGGTTATTTGGTTGTTCGTGCAGGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGATTTTGCCCAATCATTGTGATGTTTGACGCTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATTCTGAAGTCCTTTAGCATGAAAGTTCCCAAAGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATCAAGGTTTCCGCCAATTACCGTTGAATTTGCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATCCCGGCGCAAGGTACACAAGACATCCTGCGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTATCGGATCGCCTATTGACCTTGCCAGCGTACCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTTAATATCCGGAGTGATTTCTCCGGGCTTTGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGGCATCAGCAGCGCTTTTTCCGACGGCTTAGGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCACAGGGGCGCAGGGCTTAGGGCACCGGTGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTATTGGATTCCCCAAATCCTCTATAATTGAACTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCTGGACGCGTTGAAAGCCCGCATCGACCGTATAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATTGGACCGGATGGGTCTCTGGTAGCCTACCTCGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCATGCGTGGTGCCACGGGTATATCACCAACGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACAAAGTATGTAATAAATATAACCATGCATAACAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATTCTGCGATTACGATGTTATGTGCAGAGTTAGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCAATCCAGTCCGTTATTGCCGTATACGCTGATCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCGCACCCAGCGTCAACAGGCAAAGGCACGGTTGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGACAAGTGACATAGATATTATAAGATATCAAGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCGCTACGGCGGCAATCAGGATAACAGCTATTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAACGACAGACAGTTATCCTATGAACGACGTGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTATGACTGTTGATAATCTGAAACGTTATGCTATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTAGCCCAGCGTGCCGCAATGCTATAAAGATAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGTCGGGCACCACGACGAACCGGTGAGCGGATGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGCTACATTGGCTAATATGTATTCTACTGAAATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCACAGGGCAAGGGCAAGTCTACTGTGCTGGCCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGATGGATGCTATTAATACACCAATGGATGTAATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCATAATTTTGACTTCCTTTGCAATAATGTCATGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGATATCCCCGGAAAGCATCGCCGGGGGAATATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGTTTCAGAATTTAAAACAGAGGGGATAGAATGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAATATCAGGCAATCATAACTTCACTTAAATATAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCGGCGTTCGGATGGGTGCCACGGATGGATCGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGAGGAGGTGTGAAAGCATGAGCAATCTTCCTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCACTCTGGATACTGTTGTTGATGATGTACACAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAACGGACACAGTGGGACATGCTACCAATATACCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAGCCTTATCACTCCCGAGCACCGGTATAAGCCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTCCTTTACCGCTACTCCCTGCCGCTTGGATGGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTACACCAGTTATATCACCGAGTATGGCCTTGCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAGGGCCTCGCGGCTATCAGACAAGCTATCCAAACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAAGTATATAACTCCATCTCCGCCACTCCGGGTGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGTGCTGGTTCTTGTCGTCAAGCATATCATTTCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCACCATCTCGCCGCGCTGAGCGCGGTGTATTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCAGCGAGGGATTACAGCTCGGCAGGTGTTCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAAGGATACCGCGTTGTCGTTTACGCCGGGTATCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGACACGCGAAGTAATGACTGGTATACGGAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCAGCGAGGGATTACAGCTCGGCAGGTGTTCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCCCCTCACGCAAGCATCGGCAGAATCGCTTTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTACAGGGCGACACTGTGTTGCAAATCTCGAATTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCAGCGAGGGATTACAGCTCGGCAGGTGTTCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCAGCGAGGGATTACAGCTCGGCAGGTGTTCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGGATTTTCTTGTTTTGGTAGTTGAAGATTTGAGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGTGACCGATGGCCCCAAATGTGATACCGTTTTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGAACCCGCCATTTTCACAAGCAGAGCAATTTATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGATGGCAACCACAACATCGTTGTGCCTTTTACTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACGCAGGGCTGATTATGACCGTATCCACCGAGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTCCGGCGGGACGTTCTACCAGTCTACCACAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTCCACGACAAACCTTTTTTGTCGCAATCAAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGATGCCGGCAACTCGGACAGCGCCACACGTACACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAGCCCGCGTAAAAAAGGCATCCGAACCAGTGACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACACAAAAGATGCCCTGCAATACATCGTTGGGTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGGCAAGTAACGTTCATTTTGCAGAGCCAAAGTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTGCATAGTCCTTGTTTCGACGTGCGCGCTTGGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTCGGCCGAATCTGCAATCATCCAGCTCAAAAGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTAACCCAACGATGTATTCCAGCGCACTTCTTGTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGAGGATGTGTTCGATGGTGCGTCCACCGCTTTCTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGTTCCGTTTTTGTTTAACGCCAGCTGGAATGTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCACGATACAGTGTAAATGATATAATATAGACAGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTGATGATTGGGAAGACGACGAGTCAGAAGATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGACATCTTTTGTAGACTTATACCCAGTGATTGCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTCAACAACAGACGGTTTTACAATTATGTGAGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATTTCGTGCCGGAAAGCTTCGGTAGTGTCATAAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAGATGTCGTGCTGCCCCGCCGCTTTTGGCGGCTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATATTGGGAATCACATGCTTGGTGGTTCGACGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCAAGCTGACGATCATAGTCCACGCCGATGATGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGTCCCTCTCTGCTATACTATCCACAGGGGTGTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGCAGACAGTCCGTTGATTACAGACACGATGCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCCATTGCAGCACTCATGTCCAGCGTTCGGAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATTGCACTTGCTGCAGATGTTCCGGCTATTCTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAGAAGGGCAGATCGTCTTCTCCACTGATTTCTACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGACATCACCGGGGCAATCAAGCGCATGGCTGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAATGGCCCACCAGATTGCAATGCCCACTGAAAGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGACCTCATCAACTGCAACGTGACCGTGCTGCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGTCGGAAATGTGATCGAATAGGGGAAATTCTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGGCTCTTGGATTTTTGCCATTTATAAAGTAATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCCGCCCCATAGAGGGCGGCATTTTTATGCGAAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCACACGTGCCGCAACACATGCTCCGAAAAATGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCATAGCTTTCAGCTTTGGCGAACGGTCAAACACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGTTTACTCTGCGCATCTCAAGCACCCCTTTATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATACCCGGTGCCCTCAGACACCTTGATGAAAGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGCAGACAGTCCGTTGATTACAGACACGATGCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGCAGCGCCAGCACCAGCGCGTCAATGGCAACCGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGAAATTCCAAGAGTGCGGCGGAGTTCGATTGGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACAGACGCTCTTGTATCGCCTGCTCCATCTTATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTTGGATGACGAGGAGCTTGCCGAGGCGGTCGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTCAAAATGTGCCGCTACCCGTCATTATTTCATCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACATCATCATTTGCCCTTTGCACCGCAGATGGGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGGTCAGTGTTTGTTTTGTACGTACCAGATGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATATGTTGCTGTCGTTGCTTGACGTATAGGTGTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGAACAGCTTTCAAAGGCGACCGCGCCGATAATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAGCACCCGCCGTTATACGTTGACGGGTGCTTAAGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATTGAGCAGCACATTTACCCCGTCGTCATGCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTTTCAGTCCCTCGGCGTTCCACATTAAATTTCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTACGGGCTTATGCGAGATTGATGCATACGCGATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCGGTATCAGCACCACTGTTGATCTTAACACAGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATAATCTGTTCGCCATTTGCCTTACAAGTTTGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTGTTGAAGCGACCTATAAGGCACAGCTCGCAGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGACCGACTGGAACGTGAAAAACCGATCGAAGGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGACAGACCACAATTGCCGCGACAATCACCGCAACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAGATTGTAATGCCCACTGAAAGAAATCCTTAACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGTATGCGCGTTGTCATCGTCAAGTAATCAATCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTATCACCGCCTTATAAGATATTATTATATCATACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATATTATATCATTGACACTGTATAATGTCAATACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCAACATTCTTGACCCGAACACGGACGCGAAGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTACATGGGCCTTGGGTCTGTGTCTTTGATTAATAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAACACATACGCCCGCCGGTGGTGTCGGTTATACAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCTTGAAAACCCGCGATGGGCGAATGTTTCTTACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTCAGTGCCGCCGGTGCCGGCCCCCTTGTTCCACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAAATCGTTTCCCGTTTGCCATAACGCCGTTCATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCAGTTGATTTCCGTTCTCGCGCCGAAGGAACTGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATCAGCCAGCCGCTTCCGACGCTGGATCAAAGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCGCATATGGCGCGCAAAATTGTGGATGAAATCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATTAACAGTTTGTTCATAAATGTGGTTTGGAGGGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTGATGGAATTGTCGGACGGCGATGTGAGAAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCTACGGGCGGATTTTTTATGCCTAAAAGGAGCTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTGATGGAATTGTCGGACGGCGATGTGAGAAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTTCCCGTATAGGCTGTATTGGATGCCCTATGGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGGCATTACATGTAAGCGAAATATGCCGCATTATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGTGGGAAAAAATCATGACCGGCAGCTACAATGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTTTGCGGGCTTGAGACCGCCAGTGGCCGCATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGTCACCCAGCGACGCGTCCACCGGCTCCCGGTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGACATCTTTTGTAGACTTATACCCAGTGATTGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGATACCATTGATCGTTATAGTTGTCCGGGGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAAATCCCAGCCGTAGAACTGGTATACGCAAAGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATAAGAGATTTGAAAAGCCCGTGGTTTCGTCCATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTACCGCTTGATCGTGCGTTGTGATGTCTTCACGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTGTATATAAACCCTTTTTGACTACCATAAATCGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGTGCTGCATCCAGCAATACAGGCCCTTATGCTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAATTTTACTTTCATACGTCATACGCCGCCTTGCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCAACCGACGCGATACCTACGCCAACTGGCAGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATTGCCATATAATTATCCTCCTGTTTTTTCAGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGCGCGGTAGTATAATATAGTTACAGGGTAAGCGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTAAATCCGCACTGGATAACAAGCGGCTGGAAATCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGTTACGCCCGGTTCCGATTTAAATGCCAGCGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCAGCGGTTCCGGCGTTACGCCCGGTTCCGATTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAGCAGGTCATTGTAGCTGCTCAGTACTTCCGCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGTTGGTTGCTGTATCCATCCAGCATGCGCTCGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTCATGTAGCTCCATATTTCTTGATACACGCTATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCTTTTGGGCTAACGCATACGCCCTGTACACTAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCCCAGCCGGTGTGTTTCCAGAGCTTGCGGCCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATCGACTTCATTCACGCTGTCCAGACGGCAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCACAAGCCGTCCAGAAGCCCGTACAGGAACCCA
114055 NZ_CP025286.1 Ethanoligenens-harbinense-YUAN-3-chromosome Bacteria 674795-693567 18773 283 67 TTTCAATCCA TTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTCCTCCTGGCAAAATTAAAACAGAATATATATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCCCGTCTGATGATGACCGGATGGCTACCGGTCGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGCCGATTCGATAGATTTAAGGCTATCCAGTTTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTCCTCCTGGCAAAATTAAAACAGAATATATATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTTGTCGATGTTTACGTCGGGTTAAGTGTCTATCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGGCACGGGATATTTATGGTCGCATTCGAGGTACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGCGCGTGGGTCTGTCAAACTGCGTAAACAGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTACGCATCAACTTACGAGATATCATGACAAGAGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATACAGGCTTGGATTTGGATAATGTCGCTTCCATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGGATCGTGGCTGACATATGGTGATATCGAGAACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTGTCTGTGGGAATACGTTGCCTTTGATGTTGGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCTGCCGAGCAGGTAGTCTGTTGATGTTTTGAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCACGTGATCGGATGGTTTTATCAGCTGTTTCCTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTGCCCTGGGCGAGATCAAAGAAAACTATGTGACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGATACCCGCCAACATACGATTGGCATTACGTTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCAACTTCCTCCTGCGCTCCGTGAGACTATCTATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACAAGCAGGTGGCGGGATATCTCAACGCCAAGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGCGCTTGGCATGTTGAGTATGCGCGCAGCACAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATATACATTTTGGCGTAGTAACATGAATGATATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCAACACACAACAACGACGACAAAATAATCATATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACCGATTGGGGTATTTTTTTGCTACTGTGTCACAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCGAGGGCCTGACCAGCAGGCCCACACCACACACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCGATCGCGCCGGGCATACTCCCGAGGATTAAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTCAAAATTCGCAATCACATTCGTATGCGTTGGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAGTTGCATAGTATTGCAACACCATTTTAGTAGACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTGGGCATCTGGTTATTTGGTTGTTCGTGCAGGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGATTTTGCCCAATCATTGTGATGTTTGACGCTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATTCTGAAGTCCTTTAGCATGAAAGTTCCCAAAGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATCAAGGTTTCCGCCAATTACCGTTGAATTTGCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATCCCGGCGCAAGGTACACAAGACATCCTGCGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTATCGGATCGCCTATTGACCTTGCCAGCGTACCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTTAATATCCGGAGTGATTTCTCCGGGCTTTGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGGCATCAGCAGCGCTTTTTCCGACGGCTTAGGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCACAGGGGCGCAGGGCTTAGGGCACCGGTGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTATTGGATTCCCCAAATCCTCTATAATTGAACTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCTGGACGCGTTGAAAGCCCGCATCGACCGTATAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATTGGACCGGATGGGTCTCTGGTAGCCTACCTCGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCATGCGTGGTGCCACGGGTATATCACCAACGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACAAAGTATGTAATAAATATAACCATGCATAACAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATTCTGCGATTACGATGTTATGTGCAGAGTTAGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCAATCCAGTCCGTTATTGCCGTATACGCTGATCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCGCACCCAGCGTCAACAGGCAAAGGCACGGTTGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGACAAGTGACATAGATATTATAAGATATCAAGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCGCTACGGCGGCAATCAGGATAACAGCTATTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAACGACAGACAGTTATCCTATGAACGACGTGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTATGACTGTTGATAATCTGAAACGTTATGCTATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTAGCCCAGCGTGCCGCAATGCTATAAAGATAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGTCGGGCACCACGACGAACCGGTGAGCGGATGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGCTACATTGGCTAATATGTATTCTACTGAAATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCACAGGGCAAGGGCAAGTCTACTGTGCTGGCCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGATGGATGCTATTAATACACCAATGGATGTAATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCATAATTTTGACTTCCTTTGCAATAATGTCATGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGATATCCCCGGAAAGCATCGCCGGGGGAATATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGTTTCAGAATTTAAAACAGAGGGGATAGAATGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAATATCAGGCAATCATAACTTCACTTAAATATAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCGGCGTTCGGATGGGTGCCACGGATGGATCGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGAGGAGGTGTGAAAGCATGAGCAATCTTCCTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCACTCTGGATACTGTTGTTGATGATGTACACAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAACGGACACAGTGGGACATGCTACCAATATACCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAGCCTTATCACTCCCGAGCACCGGTATAAGCCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTCCTTTACCGCTACTCCCTGCCGCTTGGATGGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTACACCAGTTATATCACCGAGTATGGCCTTGCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAGGGCCTCGCGGCTATCAGACAAGCTATCCAAACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAAGTATATAACTCCATCTCCGCCACTCCGGGTGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGTGCTGGTTCTTGTCGTCAAGCATATCATTTCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCACCATCTCGCCGCGCTGAGCGCGGTGTATTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCAGCGAGGGATTACAGCTCGGCAGGTGTTCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAAGGATACCGCGTTGTCGTTTACGCCGGGTATCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGACACGCGAAGTAATGACTGGTATACGGAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCAGCGAGGGATTACAGCTCGGCAGGTGTTCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCCCCTCACGCAAGCATCGGCAGAATCGCTTTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTACAGGGCGACACTGTGTTGCAAATCTCGAATTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCAGCGAGGGATTACAGCTCGGCAGGTGTTCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCAGCGAGGGATTACAGCTCGGCAGGTGTTCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGGATTTTCTTGTTTTGGTAGTTGAAGATTTGAGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGTGACCGATGGCCCCAAATGTGATACCGTTTTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGAACCCGCCATTTTCACAAGCAGAGCAATTTATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGATGGCAACCACAACATCGTTGTGCCTTTTACTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACGCAGGGCTGATTATGACCGTATCCACCGAGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTCCGGCGGGACGTTCTACCAGTCTACCACAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTCCACGACAAACCTTTTTTGTCGCAATCAAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGATGCCGGCAACTCGGACAGCGCCACACGTACACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAGCCCGCGTAAAAAAGGCATCCGAACCAGTGACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACACAAAAGATGCCCTGCAATACATCGTTGGGTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGGCAAGTAACGTTCATTTTGCAGAGCCAAAGTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTGCATAGTCCTTGTTTCGACGTGCGCGCTTGGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTCGGCCGAATCTGCAATCATCCAGCTCAAAAGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTAACCCAACGATGTATTCCAGCGCACTTCTTGTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGAGGATGTGTTCGATGGTGCGTCCACCGCTTTCTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGTTCCGTTTTTGTTTAACGCCAGCTGGAATGTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCACGATACAGTGTAAATGATATAATATAGACAGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTGATGATTGGGAAGACGACGAGTCAGAAGATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGACATCTTTTGTAGACTTATACCCAGTGATTGCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTCAACAACAGACGGTTTTACAATTATGTGAGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATTTCGTGCCGGAAAGCTTCGGTAGTGTCATAAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAGATGTCGTGCTGCCCCGCCGCTTTTGGCGGCTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATATTGGGAATCACATGCTTGGTGGTTCGACGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCAAGCTGACGATCATAGTCCACGCCGATGATGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGTCCCTCTCTGCTATACTATCCACAGGGGTGTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGCAGACAGTCCGTTGATTACAGACACGATGCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCCATTGCAGCACTCATGTCCAGCGTTCGGAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATTGCACTTGCTGCAGATGTTCCGGCTATTCTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAGAAGGGCAGATCGTCTTCTCCACTGATTTCTACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGACATCACCGGGGCAATCAAGCGCATGGCTGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAATGGCCCACCAGATTGCAATGCCCACTGAAAGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGACCTCATCAACTGCAACGTGACCGTGCTGCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGTCGGAAATGTGATCGAATAGGGGAAATTCTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGGCTCTTGGATTTTTGCCATTTATAAAGTAATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCCGCCCCATAGAGGGCGGCATTTTTATGCGAAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCACACGTGCCGCAACACATGCTCCGAAAAATGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCATAGCTTTCAGCTTTGGCGAACGGTCAAACACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGTTTACTCTGCGCATCTCAAGCACCCCTTTATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATACCCGGTGCCCTCAGACACCTTGATGAAAGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGCAGACAGTCCGTTGATTACAGACACGATGCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGCAGCGCCAGCACCAGCGCGTCAATGGCAACCGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGAAATTCCAAGAGTGCGGCGGAGTTCGATTGGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACAGACGCTCTTGTATCGCCTGCTCCATCTTATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTTGGATGACGAGGAGCTTGCCGAGGCGGTCGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTCAAAATGTGCCGCTACCCGTCATTATTTCATCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACATCATCATTTGCCCTTTGCACCGCAGATGGGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGGTCAGTGTTTGTTTTGTACGTACCAGATGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATATGTTGCTGTCGTTGCTTGACGTATAGGTGTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGAACAGCTTTCAAAGGCGACCGCGCCGATAATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAGCACCCGCCGTTATACGTTGACGGGTGCTTAAGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATTGAGCAGCACATTTACCCCGTCGTCATGCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTTTCAGTCCCTCGGCGTTCCACATTAAATTTCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTACGGGCTTATGCGAGATTGATGCATACGCGATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCGGTATCAGCACCACTGTTGATCTTAACACAGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATAATCTGTTCGCCATTTGCCTTACAAGTTTGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTGTTGAAGCGACCTATAAGGCACAGCTCGCAGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGACCGACTGGAACGTGAAAAACCGATCGAAGGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGACAGACCACAATTGCCGCGACAATCACCGCAACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAGATTGTAATGCCCACTGAAAGAAATCCTTAACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGTATGCGCGTTGTCATCGTCAAGTAATCAATCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTATCACCGCCTTATAAGATATTATTATATCATACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATATTATATCATTGACACTGTATAATGTCAATACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCAACATTCTTGACCCGAACACGGACGCGAAGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTACATGGGCCTTGGGTCTGTGTCTTTGATTAATAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAACACATACGCCCGCCGGTGGTGTCGGTTATACAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCTTGAAAACCCGCGATGGGCGAATGTTTCTTACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTCAGTGCCGCCGGTGCCGGCCCCCTTGTTCCACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAAATCGTTTCCCGTTTGCCATAACGCCGTTCATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCAGTTGATTTCCGTTCTCGCGCCGAAGGAACTGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATCAGCCAGCCGCTTCCGACGCTGGATCAAAGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCGCATATGGCGCGCAAAATTGTGGATGAAATCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATTAACAGTTTGTTCATAAATGTGGTTTGGAGGGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTGATGGAATTGTCGGACGGCGATGTGAGAAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCTACGGGCGGATTTTTTATGCCTAAAAGGAGCTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTGATGGAATTGTCGGACGGCGATGTGAGAAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTTCCCGTATAGGCTGTATTGGATGCCCTATGGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGGCATTACATGTAAGCGAAATATGCCGCATTATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGTGGGAAAAAATCATGACCGGCAGCTACAATGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTTTGCGGGCTTGAGACCGCCAGTGGCCGCATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGTCACCCAGCGACGCGTCCACCGGCTCCCGGTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGACATCTTTTGTAGACTTATACCCAGTGATTGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGATACCATTGATCGTTATAGTTGTCCGGGGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAAATCCCAGCCGTAGAACTGGTATACGCAAAGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATAAGAGATTTGAAAAGCCCGTGGTTTCGTCCATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTACCGCTTGATCGTGCGTTGTGATGTCTTCACGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTGTATATAAACCCTTTTTGACTACCATAAATCGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGTGCTGCATCCAGCAATACAGGCCCTTATGCTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAATTTTACTTTCATACGTCATACGCCGCCTTGCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCAACCGACGCGATACCTACGCCAACTGGCAGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATTGCCATATAATTATCCTCCTGTTTTTTCAGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGCGCGGTAGTATAATATAGTTACAGGGTAAGCGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTAAATCCGCACTGGATAACAAGCGGCTGGAAATCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGTTACGCCCGGTTCCGATTTAAATGCCAGCGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCAGCGGTTCCGGCGTTACGCCCGGTTCCGATTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAGCAGGTCATTGTAGCTGCTCAGTACTTCCGCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGTTGGTTGCTGTATCCATCCAGCATGCGCTCGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTCATGTAGCTCCATATTTCTTGATACACGCTATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCTTTTGGGCTAACGCATACGCCCTGTACACTAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCCCAGCCGGTGTGTTTCCAGAGCTTGCGGCCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATCGACTTCATTCACGCTGTCCAGACGGCAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCACAAGCCGTCCAGAAGCCCGTACAGGAACCCA
114069 NZ_CP025288.1 Ethanoligenens-harbinense-strain-X-29-chromosome Bacteria 674783-693555 18773 283 67 TTTCAATCCA TTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTCCTCCTGGCAAAATTAAAACAGAATATATATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCCCGTCTGATGATGACCGGATGGCTACCGGTCGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGCCGATTCGATAGATTTAAGGCTATCCAGTTTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTCCTCCTGGCAAAATTAAAACAGAATATATATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTTGTCGATGTTTACGTCGGGTTAAGTGTCTATCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGGCACGGGATATTTATGGTCGCATTCGAGGTACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGCGCGTGGGTCTGTCAAACTGCGTAAACAGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTACGCATCAACTTACGAGATATCATGACAAGAGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATACAGGCTTGGATTTGGATAATGTCGCTTCCATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGGATCGTGGCTGACATATGGTGATATCGAGAACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTGTCTGTGGGAATACGTTGCCTTTGATGTTGGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCTGCCGAGCAGGTAGTCTGTTGATGTTTTGAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCACGTGATCGGATGGTTTTATCAGCTGTTTCCTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTGCCCTGGGCGAGATCAAAGAAAACTATGTGACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGATACCCGCCAACATACGATTGGCATTACGTTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCAACTTCCTCCTGCGCTCCGTGAGACTATCTATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACAAGCAGGTGGCGGGATATCTCAACGCCAAGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGCGCTTGGCATGTTGAGTATGCGCGCAGCACAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATATACATTTTGGCGTAGTAACATGAATGATATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCAACACACAACAACGACGACAAAATAATCATATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACCGATTGGGGTATTTTTTTGCTACTGTGTCACAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCGAGGGCCTGACCAGCAGGCCCACACCACACACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCGATCGCGCCGGGCATACTCCCGAGGATTAAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTCAAAATTCGCAATCACATTCGTATGCGTTGGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAGTTGCATAGTATTGCAACACCATTTTAGTAGACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTGGGCATCTGGTTATTTGGTTGTTCGTGCAGGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGATTTTGCCCAATCATTGTGATGTTTGACGCTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATTCTGAAGTCCTTTAGCATGAAAGTTCCCAAAGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATCAAGGTTTCCGCCAATTACCGTTGAATTTGCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATCCCGGCGCAAGGTACACAAGACATCCTGCGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTATCGGATCGCCTATTGACCTTGCCAGCGTACCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTTAATATCCGGAGTGATTTCTCCGGGCTTTGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGGCATCAGCAGCGCTTTTTCCGACGGCTTAGGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCACAGGGGCGCAGGGCTTAGGGCACCGGTGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTATTGGATTCCCCAAATCCTCTATAATTGAACTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCTGGACGCGTTGAAAGCCCGCATCGACCGTATAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATTGGACCGGATGGGTCTCTGGTAGCCTACCTCGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCATGCGTGGTGCCACGGGTATATCACCAACGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACAAAGTATGTAATAAATATAACCATGCATAACAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATTCTGCGATTACGATGTTATGTGCAGAGTTAGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCAATCCAGTCCGTTATTGCCGTATACGCTGATCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCGCACCCAGCGTCAACAGGCAAAGGCACGGTTGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGACAAGTGACATAGATATTATAAGATATCAAGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCGCTACGGCGGCAATCAGGATAACAGCTATTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAACGACAGACAGTTATCCTATGAACGACGTGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTATGACTGTTGATAATCTGAAACGTTATGCTATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTAGCCCAGCGTGCCGCAATGCTATAAAGATAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGTCGGGCACCACGACGAACCGGTGAGCGGATGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGCTACATTGGCTAATATGTATTCTACTGAAATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCACAGGGCAAGGGCAAGTCTACTGTGCTGGCCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGATGGATGCTATTAATACACCAATGGATGTAATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCATAATTTTGACTTCCTTTGCAATAATGTCATGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGATATCCCCGGAAAGCATCGCCGGGGGAATATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGTTTCAGAATTTAAAACAGAGGGGATAGAATGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAATATCAGGCAATCATAACTTCACTTAAATATAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCGGCGTTCGGATGGGTGCCACGGATGGATCGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGAGGAGGTGTGAAAGCATGAGCAATCTTCCTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCACTCTGGATACTGTTGTTGATGATGTACACAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAACGGACACAGTGGGACATGCTACCAATATACCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAGCCTTATCACTCCCGAGCACCGGTATAAGCCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTCCTTTACCGCTACTCCCTGCCGCTTGGATGGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTACACCAGTTATATCACCGAGTATGGCCTTGCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAGGGCCTCGCGGCTATCAGACAAGCTATCCAAACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAAGTATATAACTCCATCTCCGCCACTCCGGGTGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGTGCTGGTTCTTGTCGTCAAGCATATCATTTCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCACCATCTCGCCGCGCTGAGCGCGGTGTATTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCAGCGAGGGATTACAGCTCGGCAGGTGTTCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAAGGATACCGCGTTGTCGTTTACGCCGGGTATCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGACACGCGAAGTAATGACTGGTATACGGAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCAGCGAGGGATTACAGCTCGGCAGGTGTTCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCCCCTCACGCAAGCATCGGCAGAATCGCTTTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTACAGGGCGACACTGTGTTGCAAATCTCGAATTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCAGCGAGGGATTACAGCTCGGCAGGTGTTCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCAGCGAGGGATTACAGCTCGGCAGGTGTTCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGGATTTTCTTGTTTTGGTAGTTGAAGATTTGAGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGTGACCGATGGCCCCAAATGTGATACCGTTTTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGAACCCGCCATTTTCACAAGCAGAGCAATTTATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGATGGCAACCACAACATCGTTGTGCCTTTTACTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACGCAGGGCTGATTATGACCGTATCCACCGAGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTCCGGCGGGACGTTCTACCAGTCTACCACAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTCCACGACAAACCTTTTTTGTCGCAATCAAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGATGCCGGCAACTCGGACAGCGCCACACGTACACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAGCCCGCGTAAAAAAGGCATCCGAACCAGTGACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACACAAAAGATGCCCTGCAATACATCGTTGGGTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGGCAAGTAACGTTCATTTTGCAGAGCCAAAGTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTGCATAGTCCTTGTTTCGACGTGCGCGCTTGGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTCGGCCGAATCTGCAATCATCCAGCTCAAAAGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTAACCCAACGATGTATTCCAGCGCACTTCTTGTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGAGGATGTGTTCGATGGTGCGTCCACCGCTTTCTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGTTCCGTTTTTGTTTAACGCCAGCTGGAATGTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCACGATACAGTGTAAATGATATAATATAGACAGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTGATGATTGGGAAGACGACGAGTCAGAAGATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGACATCTTTTGTAGACTTATACCCAGTGATTGCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTCAACAACAGACGGTTTTACAATTATGTGAGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATTTCGTGCCGGAAAGCTTCGGTAGTGTCATAAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAGATGTCGTGCTGCCCCGCCGCTTTTGGCGGCTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATATTGGGAATCACATGCTTGGTGGTTCGACGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCAAGCTGACGATCATAGTCCACGCCGATGATGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGTCCCTCTCTGCTATACTATCCACAGGGGTGTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGCAGACAGTCCGTTGATTACAGACACGATGCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCCATTGCAGCACTCATGTCCAGCGTTCGGAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATTGCACTTGCTGCAGATGTTCCGGCTATTCTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAGAAGGGCAGATCGTCTTCTCCACTGATTTCTACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGACATCACCGGGGCAATCAAGCGCATGGCTGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAATGGCCCACCAGATTGCAATGCCCACTGAAAGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGACCTCATCAACTGCAACGTGACCGTGCTGCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGTCGGAAATGTGATCGAATAGGGGAAATTCTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGGCTCTTGGATTTTTGCCATTTATAAAGTAATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCCGCCCCATAGAGGGCGGCATTTTTATGCGAAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCACACGTGCCGCAACACATGCTCCGAAAAATGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCATAGCTTTCAGCTTTGGCGAACGGTCAAACACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGTTTACTCTGCGCATCTCAAGCACCCCTTTATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATACCCGGTGCCCTCAGACACCTTGATGAAAGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGCAGACAGTCCGTTGATTACAGACACGATGCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGCAGCGCCAGCACCAGCGCGTCAATGGCAACCGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGAAATTCCAAGAGTGCGGCGGAGTTCGATTGGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACAGACGCTCTTGTATCGCCTGCTCCATCTTATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTTGGATGACGAGGAGCTTGCCGAGGCGGTCGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTCAAAATGTGCCGCTACCCGTCATTATTTCATCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACATCATCATTTGCCCTTTGCACCGCAGATGGGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGGTCAGTGTTTGTTTTGTACGTACCAGATGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATATGTTGCTGTCGTTGCTTGACGTATAGGTGTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGAACAGCTTTCAAAGGCGACCGCGCCGATAATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAGCACCCGCCGTTATACGTTGACGGGTGCTTAAGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATTGAGCAGCACATTTACCCCGTCGTCATGCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTTTCAGTCCCTCGGCGTTCCACATTAAATTTCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTACGGGCTTATGCGAGATTGATGCATACGCGATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCGGTATCAGCACCACTGTTGATCTTAACACAGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATAATCTGTTCGCCATTTGCCTTACAAGTTTGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTGTTGAAGCGACCTATAAGGCACAGCTCGCAGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGACCGACTGGAACGTGAAAAACCGATCGAAGGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGACAGACCACAATTGCCGCGACAATCACCGCAACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAGATTGTAATGCCCACTGAAAGAAATCCTTAACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGTATGCGCGTTGTCATCGTCAAGTAATCAATCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTATCACCGCCTTATAAGATATTATTATATCATACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATATTATATCATTGACACTGTATAATGTCAATACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCAACATTCTTGACCCGAACACGGACGCGAAGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTACATGGGCCTTGGGTCTGTGTCTTTGATTAATAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAACACATACGCCCGCCGGTGGTGTCGGTTATACAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCTTGAAAACCCGCGATGGGCGAATGTTTCTTACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTCAGTGCCGCCGGTGCCGGCCCCCTTGTTCCACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAAATCGTTTCCCGTTTGCCATAACGCCGTTCATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCAGTTGATTTCCGTTCTCGCGCCGAAGGAACTGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATCAGCCAGCCGCTTCCGACGCTGGATCAAAGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCGCATATGGCGCGCAAAATTGTGGATGAAATCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATTAACAGTTTGTTCATAAATGTGGTTTGGAGGGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTGATGGAATTGTCGGACGGCGATGTGAGAAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCTACGGGCGGATTTTTTATGCCTAAAAGGAGCTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTGATGGAATTGTCGGACGGCGATGTGAGAAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTTCCCGTATAGGCTGTATTGGATGCCCTATGGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGGCATTACATGTAAGCGAAATATGCCGCATTATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGTGGGAAAAAATCATGACCGGCAGCTACAATGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTTTGCGGGCTTGAGACCGCCAGTGGCCGCATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGTCACCCAGCGACGCGTCCACCGGCTCCCGGTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGACATCTTTTGTAGACTTATACCCAGTGATTGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGATACCATTGATCGTTATAGTTGTCCGGGGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAAATCCCAGCCGTAGAACTGGTATACGCAAAGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATAAGAGATTTGAAAAGCCCGTGGTTTCGTCCATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTACCGCTTGATCGTGCGTTGTGATGTCTTCACGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTGTATATAAACCCTTTTTGACTACCATAAATCGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGTGCTGCATCCAGCAATACAGGCCCTTATGCTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAATTTTACTTTCATACGTCATACGCCGCCTTGCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCAACCGACGCGATACCTACGCCAACTGGCAGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATTGCCATATAATTATCCTCCTGTTTTTTCAGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGCGCGGTAGTATAATATAGTTACAGGGTAAGCGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTAAATCCGCACTGGATAACAAGCGGCTGGAAATCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGTTACGCCCGGTTCCGATTTAAATGCCAGCGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCAGCGGTTCCGGCGTTACGCCCGGTTCCGATTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAGCAGGTCATTGTAGCTGCTCAGTACTTCCGCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGTTGGTTGCTGTATCCATCCAGCATGCGCTCGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTCATGTAGCTCCATATTTCTTGATACACGCTATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCTTTTGGGCTAACGCATACGCCCTGTACACTAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCCCAGCCGGTGTGTTTCCAGAGCTTGCGGCCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATCGACTTCATTCACGCTGTCCAGACGGCAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCACAAGCCGTCCAGAAGCCCGTACAGGAACCCA
114062 NZ_CP025287.1 Ethanoligenens-harbinense-strain-B49-chromosome Bacteria 639963-658735 18773 283 67 TTTCAATCCA TTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTCCTCCTGGCAAAATTAAAACAGAATATATATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCCCGTCTGATGATGACCGGATGGCTACCGGTCGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGCCGATTCGATAGATTTAAGGCTATCCAGTTTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTCCTCCTGGCAAAATTAAAACAGAATATATATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTTGTCGATGTTTACGTCGGGTTAAGTGTCTATCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGGCACGGGATATTTATGGTCGCATTCGAGGTACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGCGCGTGGGTCTGTCAAACTGCGTAAACAGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTACGCATCAACTTACGAGATATCATGACAAGAGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATACAGGCTTGGATTTGGATAATGTCGCTTCCATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGGATCGTGGCTGACATATGGTGATATCGAGAACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTGTCTGTGGGAATACGTTGCCTTTGATGTTGGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCTGCCGAGCAGGTAGTCTGTTGATGTTTTGAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCACGTGATCGGATGGTTTTATCAGCTGTTTCCTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTGCCCTGGGCGAGATCAAAGAAAACTATGTGACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGATACCCGCCAACATACGATTGGCATTACGTTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCAACTTCCTCCTGCGCTCCGTGAGACTATCTATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACAAGCAGGTGGCGGGATATCTCAACGCCAAGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGCGCTTGGCATGTTGAGTATGCGCGCAGCACAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATATACATTTTGGCGTAGTAACATGAATGATATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCAACACACAACAACGACGACAAAATAATCATATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACCGATTGGGGTATTTTTTTGCTACTGTGTCACAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCGAGGGCCTGACCAGCAGGCCCACACCACACACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCGATCGCGCCGGGCATACTCCCGAGGATTAAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTCAAAATTCGCAATCACATTCGTATGCGTTGGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAGTTGCATAGTATTGCAACACCATTTTAGTAGACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTGGGCATCTGGTTATTTGGTTGTTCGTGCAGGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGATTTTGCCCAATCATTGTGATGTTTGACGCTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATTCTGAAGTCCTTTAGCATGAAAGTTCCCAAAGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATCAAGGTTTCCGCCAATTACCGTTGAATTTGCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATCCCGGCGCAAGGTACACAAGACATCCTGCGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTATCGGATCGCCTATTGACCTTGCCAGCGTACCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTTAATATCCGGAGTGATTTCTCCGGGCTTTGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGGCATCAGCAGCGCTTTTTCCGACGGCTTAGGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCACAGGGGCGCAGGGCTTAGGGCACCGGTGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTATTGGATTCCCCAAATCCTCTATAATTGAACTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCTGGACGCGTTGAAAGCCCGCATCGACCGTATAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATTGGACCGGATGGGTCTCTGGTAGCCTACCTCGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCATGCGTGGTGCCACGGGTATATCACCAACGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACAAAGTATGTAATAAATATAACCATGCATAACAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATTCTGCGATTACGATGTTATGTGCAGAGTTAGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCAATCCAGTCCGTTATTGCCGTATACGCTGATCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCGCACCCAGCGTCAACAGGCAAAGGCACGGTTGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGACAAGTGACATAGATATTATAAGATATCAAGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCGCTACGGCGGCAATCAGGATAACAGCTATTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAACGACAGACAGTTATCCTATGAACGACGTGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTATGACTGTTGATAATCTGAAACGTTATGCTATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTAGCCCAGCGTGCCGCAATGCTATAAAGATAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGTCGGGCACCACGACGAACCGGTGAGCGGATGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGCTACATTGGCTAATATGTATTCTACTGAAATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCACAGGGCAAGGGCAAGTCTACTGTGCTGGCCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGATGGATGCTATTAATACACCAATGGATGTAATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCATAATTTTGACTTCCTTTGCAATAATGTCATGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGATATCCCCGGAAAGCATCGCCGGGGGAATATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGTTTCAGAATTTAAAACAGAGGGGATAGAATGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAATATCAGGCAATCATAACTTCACTTAAATATAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCGGCGTTCGGATGGGTGCCACGGATGGATCGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGAGGAGGTGTGAAAGCATGAGCAATCTTCCTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCACTCTGGATACTGTTGTTGATGATGTACACAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAACGGACACAGTGGGACATGCTACCAATATACCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAGCCTTATCACTCCCGAGCACCGGTATAAGCCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTCCTTTACCGCTACTCCCTGCCGCTTGGATGGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTACACCAGTTATATCACCGAGTATGGCCTTGCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAGGGCCTCGCGGCTATCAGACAAGCTATCCAAACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAAGTATATAACTCCATCTCCGCCACTCCGGGTGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGTGCTGGTTCTTGTCGTCAAGCATATCATTTCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCACCATCTCGCCGCGCTGAGCGCGGTGTATTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCAGCGAGGGATTACAGCTCGGCAGGTGTTCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAAGGATACCGCGTTGTCGTTTACGCCGGGTATCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGACACGCGAAGTAATGACTGGTATACGGAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCAGCGAGGGATTACAGCTCGGCAGGTGTTCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCCCCTCACGCAAGCATCGGCAGAATCGCTTTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTACAGGGCGACACTGTGTTGCAAATCTCGAATTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCAGCGAGGGATTACAGCTCGGCAGGTGTTCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCAGCGAGGGATTACAGCTCGGCAGGTGTTCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGGATTTTCTTGTTTTGGTAGTTGAAGATTTGAGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGTGACCGATGGCCCCAAATGTGATACCGTTTTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGAACCCGCCATTTTCACAAGCAGAGCAATTTATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGATGGCAACCACAACATCGTTGTGCCTTTTACTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACGCAGGGCTGATTATGACCGTATCCACCGAGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTCCGGCGGGACGTTCTACCAGTCTACCACAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTCCACGACAAACCTTTTTTGTCGCAATCAAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGATGCCGGCAACTCGGACAGCGCCACACGTACACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAGCCCGCGTAAAAAAGGCATCCGAACCAGTGACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACACAAAAGATGCCCTGCAATACATCGTTGGGTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGGCAAGTAACGTTCATTTTGCAGAGCCAAAGTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTGCATAGTCCTTGTTTCGACGTGCGCGCTTGGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTCGGCCGAATCTGCAATCATCCAGCTCAAAAGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTAACCCAACGATGTATTCCAGCGCACTTCTTGTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGAGGATGTGTTCGATGGTGCGTCCACCGCTTTCTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGTTCCGTTTTTGTTTAACGCCAGCTGGAATGTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCACGATACAGTGTAAATGATATAATATAGACAGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTGATGATTGGGAAGACGACGAGTCAGAAGATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGACATCTTTTGTAGACTTATACCCAGTGATTGCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTCAACAACAGACGGTTTTACAATTATGTGAGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATTTCGTGCCGGAAAGCTTCGGTAGTGTCATAAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAGATGTCGTGCTGCCCCGCCGCTTTTGGCGGCTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATATTGGGAATCACATGCTTGGTGGTTCGACGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCAAGCTGACGATCATAGTCCACGCCGATGATGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGTCCCTCTCTGCTATACTATCCACAGGGGTGTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGCAGACAGTCCGTTGATTACAGACACGATGCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCCATTGCAGCACTCATGTCCAGCGTTCGGAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATTGCACTTGCTGCAGATGTTCCGGCTATTCTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAGAAGGGCAGATCGTCTTCTCCACTGATTTCTACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGACATCACCGGGGCAATCAAGCGCATGGCTGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAATGGCCCACCAGATTGCAATGCCCACTGAAAGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGACCTCATCAACTGCAACGTGACCGTGCTGCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGTCGGAAATGTGATCGAATAGGGGAAATTCTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGGCTCTTGGATTTTTGCCATTTATAAAGTAATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCCGCCCCATAGAGGGCGGCATTTTTATGCGAAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCACACGTGCCGCAACACATGCTCCGAAAAATGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCATAGCTTTCAGCTTTGGCGAACGGTCAAACACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGTTTACTCTGCGCATCTCAAGCACCCCTTTATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATACCCGGTGCCCTCAGACACCTTGATGAAAGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGCAGACAGTCCGTTGATTACAGACACGATGCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGCAGCGCCAGCACCAGCGCGTCAATGGCAACCGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGAAATTCCAAGAGTGCGGCGGAGTTCGATTGGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACAGACGCTCTTGTATCGCCTGCTCCATCTTATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTTGGATGACGAGGAGCTTGCCGAGGCGGTCGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTCAAAATGTGCCGCTACCCGTCATTATTTCATCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACATCATCATTTGCCCTTTGCACCGCAGATGGGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGGTCAGTGTTTGTTTTGTACGTACCAGATGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATATGTTGCTGTCGTTGCTTGACGTATAGGTGTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGAACAGCTTTCAAAGGCGACCGCGCCGATAATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAGCACCCGCCGTTATACGTTGACGGGTGCTTAAGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATTGAGCAGCACATTTACCCCGTCGTCATGCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTTTCAGTCCCTCGGCGTTCCACATTAAATTTCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTACGGGCTTATGCGAGATTGATGCATACGCGATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCGGTATCAGCACCACTGTTGATCTTAACACAGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATAATCTGTTCGCCATTTGCCTTACAAGTTTGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTGTTGAAGCGACCTATAAGGCACAGCTCGCAGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGACCGACTGGAACGTGAAAAACCGATCGAAGGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGACAGACCACAATTGCCGCGACAATCACCGCAACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAGATTGTAATGCCCACTGAAAGAAATCCTTAACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGTATGCGCGTTGTCATCGTCAAGTAATCAATCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTATCACCGCCTTATAAGATATTATTATATCATACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATATTATATCATTGACACTGTATAATGTCAATACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCAACATTCTTGACCCGAACACGGACGCGAAGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTACATGGGCCTTGGGTCTGTGTCTTTGATTAATAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAACACATACGCCCGCCGGTGGTGTCGGTTATACAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCTTGAAAACCCGCGATGGGCGAATGTTTCTTACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTCAGTGCCGCCGGTGCCGGCCCCCTTGTTCCACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAAATCGTTTCCCGTTTGCCATAACGCCGTTCATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCAGTTGATTTCCGTTCTCGCGCCGAAGGAACTGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATCAGCCAGCCGCTTCCGACGCTGGATCAAAGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCGCATATGGCGCGCAAAATTGTGGATGAAATCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATTAACAGTTTGTTCATAAATGTGGTTTGGAGGGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTGATGGAATTGTCGGACGGCGATGTGAGAAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCTACGGGCGGATTTTTTATGCCTAAAAGGAGCTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTGATGGAATTGTCGGACGGCGATGTGAGAAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTTCCCGTATAGGCTGTATTGGATGCCCTATGGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGGCATTACATGTAAGCGAAATATGCCGCATTATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGTGGGAAAAAATCATGACCGGCAGCTACAATGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTTTGCGGGCTTGAGACCGCCAGTGGCCGCATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGTCACCCAGCGACGCGTCCACCGGCTCCCGGTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGACATCTTTTGTAGACTTATACCCAGTGATTGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGATACCATTGATCGTTATAGTTGTCCGGGGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAAATCCCAGCCGTAGAACTGGTATACGCAAAGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATAAGAGATTTGAAAAGCCCGTGGTTTCGTCCATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTACCGCTTGATCGTGCGTTGTGATGTCTTCACGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTGTATATAAACCCTTTTTGACTACCATAAATCGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGTGCTGCATCCAGCAATACAGGCCCTTATGCTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAATTTTACTTTCATACGTCATACGCCGCCTTGCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCAACCGACGCGATACCTACGCCAACTGGCAGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATTGCCATATAATTATCCTCCTGTTTTTTCAGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGCGCGGTAGTATAATATAGTTACAGGGTAAGCGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTAAATCCGCACTGGATAACAAGCGGCTGGAAATCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGTTACGCCCGGTTCCGATTTAAATGCCAGCGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCAGCGGTTCCGGCGTTACGCCCGGTTCCGATTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAGCAGGTCATTGTAGCTGCTCAGTACTTCCGCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGTTGGTTGCTGTATCCATCCAGCATGCGCTCGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTCATGTAGCTCCATATTTCTTGATACACGCTATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCTTTTGGGCTAACGCATACGCCCTGTACACTAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCCCAGCCGGTGTGTTTCCAGAGCTTGCGGCCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATCGACTTCATTCACGCTGTCCAGACGGCAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCACAAGCCGTCCAGAAGCCCGTACAGGAACCCA
19109 NC_014828.1 Ethanoligenens-harbinense-YUAN-3 Bacteria 674782-693553 18772 283 67 TTTCAATCCA TTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTCCTCCTGGCAAAATTAAAACAGAATATATATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCCCGTCTGATGATGACCGGATGGCTACCGGTCGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGCCGATTCGATAGATTTAAGGCTATCCAGTTTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTCCTCCTGGCAAAATTAAAACAGAATATATATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTTGTCGATGTTTACGTCGGGTTAAGTGTCTATCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGGCACGGGATATTTATGGTCGCATTCGAGGTACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGCGCGTGGGTCTGTCAAACTGCGTAAACAGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTACGCATCAACTTACGAGATATCATGACAAGAGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATACAGGCTTGGATTTGGATAATGTCGCTTCCATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGGATCGTGGCTGACATATGGTGATATCGAGAACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTGTCTGTGGGAATACGTTGCCTTTGATGTTGGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCTGCCGAGCAGGTAGTCTGTTGATGTTTTGAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCACGTGATCGGATGGTTTTATCAGCTGTTTCCTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTGCCCTGGGCGAGATCAAAGAAAACTATGTGACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGATACCCGCCAACATACGATTGGCATTACGTTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCAACTTCCTCCTGCGCTCCGTGAGACTATCTATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACAAGCAGGTGGCGGGATATCTCAACGCCAAGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGCGCTTGGCATGTTGAGTATGCGCGCAGCACAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATATACATTTTGGCGTAGTAACATGAATGATATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCAACACACAACAACGACGACAAAATAATCATATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACCGATTGGGGTATTTTTTTGCTACTGTGTCACAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCGAGGGCCTGACCAGCAGGCCCACACCACACACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCGATCGCGCCGGGCATACTCCCGAGGATTAAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTCAAAATTCGCAATCACATTCGTATGCGTTGGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAGTTGCATAGTATTGCAACACCATTTTAGTAGACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTGGGCATCTGGTTATTTGGTTGTTCGTGCAGGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGATTTTGCCCAATCATTGTGATGTTTGACGCTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATTCTGAAGTCCTTTAGCATGAAAGTTCCCAAAGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATCAAGGTTTCCGCCAATTACCGTTGAATTTGCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATCCCGGCGCAAGGTACACAAGACATCCTGCGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTATCGGATCGCCTATTGACCTTGCCAGCGTACCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTTAATATCCGGAGTGATTTCTCCGGGCTTTGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGGCATCAGCAGCGCTTTTTCCGACGGCTTAGGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCACAGGGGCGCAGGGCTTAGGGCACCGGTGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTATTGGATTCCCCAAATCCTCTATAATTGAACTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCTGGACGCGTTGAAAGCCCGCATCGACCGTATAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATTGGACCGGATGGGTCTCTGGTAGCCTACCTCGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCATGCGTGGTGCCACGGGTATATCACCAACGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACAAAGTATGTAATAAATATAACCATGCATAACAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATTCTGCGATTACGATGTTATGTGCAGAGTTAGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCAATCCAGTCCGTTATTGCCGTATACGCTGATCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCGCACCCAGCGTCAACAGGCAAAGGCACGGTTGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGACAAGTGACATAGATATTATAAGATATCAAGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCGCTACGGCGGCAATCAGGATAACAGCTATTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAACGACAGACAGTTATCCTATGAACGACGTGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTATGACTGTTGATAATCTGAAACGTTATGCTATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTAGCCCAGCGTGCCGCAATGCTATAAAGATAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGTCGGGCACCACGACGAACCGGTGAGCGGATGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGCTACATTGGCTAATATGTATTCTACTGAAATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCACAGGGCAAGGGCAAGTCTACTGTGCTGGCCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGATGGATGCTATTAATACACCAATGGATGTAATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCATAATTTTGACTTCCTTTGCAATAATGTCATGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGATATCCCCGGAAAGCATCGCCGGGGGAATATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGTTTCAGAATTTAAAACAGAGGGGATAGAATGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAATATCAGGCAATCATAACTTCACTTAAATATAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCGGCGTTCGGATGGGTGCCACGGATGGATCGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGAGGAGGTGTGAAAGCATGAGCAATCTTCCTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCACTCTGGATACTGTTGTTGATGATGTACACAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAACGGACACAGTGGGACATGCTACCAATATACCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAGCCTTATCACTCCCGAGCACCGGTATAAGCCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTCCTTTACCGCTACTCCCTGCCGCTTGGATGGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTACACCAGTTATATCACCGAGTATGGCCTTGCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAGGGCCTCGCGGCTATCAGACAAGCTATCCAAACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAAGTATATAACTCCATCTCCGCCACTCCGGGTGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGTGCTGGTTCTTGTCGTCAAGCATATCATTTCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCACCATCTCGCCGCGCTGAGCGCGGTGTATTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCAGCGAGGGATTACAGCTCGGCAGGTGTTCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAAGGATACCGCGTTGTCGTTTACGCCGGGTATCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGACACGCGAAGTAATGACTGGTATACGGAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCAGCGAGGGATTACAGCTCGGCAGGTGTTCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCCCCTCACGCAAGCATCGGCAGAATCGCTTTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTACAGGGCGACACTGTGTTGCAAATCTCGAATTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCAGCGAGGGATTACAGCTCGGCAGGTGTTCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCAGCGAGGGATTACAGCTCGGCAGGTGTTCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGGATTTTCTTGTTTTGGTAGTTGAAGATTTGAGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGTGACCGATGGCCCCAAATGTGATACCGTTTTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGAACCCGCCATTTTCACAAGCAGAGCAATTTATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGATGGCAACCACAACATCGTTGTGCCTTTTACTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACGCAGGGCTGATTATGACCGTATCCACCGAGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTCCGGCGGGACGTTCTACCAGTCTACCACAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTCCACGACAAACCTTTTTTGTCGCAATCAAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGATGCCGGCAACTCGGACAGCGCCACACGTACACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAGCCCGCGTAAAAAAGGCATCCGAACCAGTGACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACACAAAAGATGCCCTGCAATACATCGTTGGGTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGGCAAGTAACGTTCATTTTGCAGAGCCAAAGTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTGCATAGTCCTTGTTTCGACGTGCGCGCTTGGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTCGGCCGAATCTGCAATCATCCAGCTCAAAAGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTAACCCAACGATGTATTCCAGCGCACTTCTTGTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGAGGATGTGTTCGATGGTGCGTCCACCGCTTTCTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGTTCCGTTTTTGTTTAACGCCAGCTGGAATGTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCACGATACAGTGTAAATGATATAATATAGACAGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTGATGATTGGGAAGACGACGAGTCAGAAGATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGACATCTTTTGTAGACTTATACCCAGTGATTGCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTCAACAACAGACGGTTTTACAATTATGTGAGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATTTCGTGCCGGAAAGCTTCGGTAGTGTCATAAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAGATGTCGTGCTGCCCCGCCGCTTTTGGCGGCTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATATTGGGAATCACATGCTTGGTGGTTCGACGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCAAGCTGACGATCATAGTCCACGCCGATGATGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGTCCCTCTCTGCTATACTATCCACAGGGGTGTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGCAGACAGTCCGTTGATTACAGACACGATGCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCCATTGCAGCACTCATGTCCAGCGTTCGGAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATTGCACTTGCTGCAGATGTTCCGGCTATTCTAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAGAAGGGCAGATCGTCTTCTCCACTGATTTCTACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGACATCACCGGGGCAATCAAGCGCATGGCTGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAATGGCCCACCAGATTGCAATGCCCACTGAAAGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGACCTCATCAACTGCAACGTGACCGTGCTGCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGTCGGAAATGTGATCGAATAGGGGAAATTCTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGGCTCTTGGATTTTTGCCATTTATAAAGTAATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCCGCCCCATAGAGGGCGGCATTTTTATGCGAAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCACACGTGCCGCAACACATGCTCCGAAAAATGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCATAGCTTTCAGCTTTGGCGAACGGTCAAACACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGTTTACTCTGCGCATCTCAAGCACCCCTTTATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATACCCGGTGCCCTCAGACACCTTGATGAAAGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGCAGACAGTCCGTTGATTACAGACACGATGCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGCAGCGCCAGCACCAGCGCGTCAATGGCAACCGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGAAATTCCAAGAGTGCGGCGGAGTTCGATTGGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACAGACGCTCTTGTATCGCCTGCTCCATCTTATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTTGGATGACGAGGAGCTTGCCGAGGCGGTCGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTCAAAATGTGCCGCTACCCGTCATTATTTCATCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACACATCATCATTTGCCCTTTGCACCGCAGATGGGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGGTCAGTGTTTGTTTTGTACGTACCAGATGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATATGTTGCTGTCGTTGCTTGACGTATAGGTGTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGAACAGCTTTCAAAGGCGACCGCGCCGATAATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAGCACCCGCCGTTATACGTTGACGGGTGCTTAAGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATTGAGCAGCACATTTACCCCGTCGTCATGCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTTTCAGTCCCTCGGCGTTCCACATTAAATTTCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTACGGGCTTATGCGAGATTGATGCATACGCGATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCGGTATCAGCACCACTGTTGATCTTAACACAGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATAATCTGTTCGCCATTTGCCTTACAAGTTTGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTGTTGAAGCGACCTATAAGGCACAGCTCGCAGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGACCGACTGGAACGTGAAAAACCGATCGAAGGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGACAGACCACAATTGCCGCGACAATCACCGCAACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAGATTGTAATGCCCACTGAAAGAAATCCTTAACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGTATGCGCGTTGTCATCGTCAAGTAATCAATCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTATCACCGCCTTATAAGATATTATTATATCATACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATATTATATCATTGACACTGTATAATGTCAATACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCAACATTCTTGACCCGAACACGGACGCGAAGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCAACATTCTTGACCCGAACACGGACGCGAAGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTACATGGGCCTTGGGTCTGTGTCTTTGATTAATAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAACACATACGCCCGCCGGTGGTGTCGGTTATACAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCTTGAAAACCCGCGATGGGCGAATGTTTCTTACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTCAGTGCCGCCGGTGCCGGCCCCCTTGTTCCACATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAAATCGTTTCCCGTTTGCCATAACGCCGTTCATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCAGTTGATTTCCGTTCTCGCGCCGAAGGAACTGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATCAGCCAGCCGCTTCCGACGCTGGATCAAAGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCGCATATGGCGCGCAAAATTGTGGATGAAATCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATTAACAGTTTGTTCATAAATGTGGTTTGGAGGGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTGATGGAATTGTCGGACGGCGATGTGAGAAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCTACGGGCGGATTTTTTATGCCTAAAAGGAGCTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTGATGGAATTGTCGGACGGCGATGTGAGAAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTTCCCGTATAGGCTGTATTGGATGCCCTATGGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGGCATTACATGTAAGCGAAATATGCCGCATTATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGTGGGAAAAAATCATGACCGGCAGCTACAATGAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTTTTGCGGGCTTGAGACCGCCAGTGGCCGCATTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGTCACCCAGCGACGCGTCCACCGGCTCCCGGTCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGGACATCTTTTGTAGACTTATACCCAGTGATTGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGTGATACCATTGATCGTTATAGTTGTCCGGGGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAAATCCCAGCCGTAGAACTGGTATACGCAAAGATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACATAAGAGATTTGAAAAGCCCGTGGTTTCGTCCATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTACCGCTTGATCGTGCGTTGTGATGTCTTCACGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTTGTATATAAACCCTTTTTGACTACCATAAATCGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTGTGCTGCATCCAGCAATACAGGCCCTTATGCTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACAATTTTACTTTCATACGTCATACGCCGCCTTGCAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCAACCGACGCGATACCTACGCCAACTGGCAGAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATTGCCATATAATTATCCTCCTGTTTTTTCAGTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGCGCGGTAGTATAATATAGTTACAGGGTAAGCGATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTAAATCCGCACTGGATAACAAGCGGCTGGAAATCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACGCGTTACGCCCGGTTCCGATTTAAATGCCAGCGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCAGCGGTTCCGGCGTTACGCCCGGTTCCGATTTATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCAGCAGGTCATTGTAGCTGCTCAGTACTTCCGCCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCGTTGGTTGCTGTATCCATCCAGCATGCGCTCGCATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCTCATGTAGCTCCATATTTCTTGATACACGCTATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCTTTTGGGCTAACGCATACGCCCTGTACACTAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCCCCAGCCGGTGTGTTTCCAGAGCTTGCGGCCAAATTTCAATCCACGCTCTCCGTGTGGAGAGCGACCATCGACTTCATTCACGCTGTCCAGACGGCAAATATTTCAATCCACGCTCTCCGTGTGGAGAGCGACTCCACAAGCCGTCCAGAAGCCCGTACAGGAACCCA
33566 NZ_AP018936.1 Streptococcus-pneumoniae-NU83127-DNA Bacteria 1676260-1694836 18577 464 24 GCTGAAGCCG GCTGAGGCCGAAGCACTCGTTGATGCTGAAGCTGAGGCACTGGTGCTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCCGACGCACTGGTGCTTGCTGAAGCTGACGCACTTGTTGATGCGGAAGCCGAAGCACTCGTTGAGGCTGAAGCTGACGCACTGGTACTTGCTGAAGCCGAGGCGCTTGTGCTTGCTGAAGCTGAGGCGCTTATGCTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCTGAAGCACTCGTTGATGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTGCTTGCTGAAGCTGACGCACTTGTTGATGCGGAAGCCGAAGCACTCGTTGAGGCTGAAGCTGACGCACTTGTACTTGCTGAGGCCGACGCACTGGTACTTGCGGAAGCCGACGCACTCGTTGATGCTGAAGCCGACGCACTGGTGCTTGCTGAGGCCGAAGCACTGGTACTTGCTGAAGCTGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTACTTGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGAAGCACTGGTGCTTGCTGAAGCTGACGCACTTGTTGATGCGGAAGCCGAAGCACTCGTTGAGGCTGAAGCTGACGCACTGGTACTTGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTGCTTGCTGAGGCCGAAGCACTGGTACTTGCTGAAGCTGAGGCGCTTGTGCTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCCGAGGCACTCGTTGATGCTGAAGCCGAGGCGCTTGTCGATGCTGAGGCCGACGCACTGGTACTTGCTGAAGCTGAGGCGCTTGTGCTTGCTGAAGCCGACGCACTGGTACTTGCTGAAGCTGAGGCGCTTGTGCTTGCTGAAGCCGAAGCACTGGTACTTGCGGAAGCCGACGCACTCGTTGATGCTGAAGCTGAGGCACTGGTACTTGCTGAGGCCGAAGCACTGGTACTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTGCTTGCTGAGGCCGAAGCACTGGTACTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCCGACGCACTCGTTGATGCTGAAGCTGAAGCACTCGTTGATGCTGAAGCCGAGGCACTCGTTGATGCTGAAGCCGAGGCACTGGTTGATGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTGCTTGCTGAAGCTGACGCACTTGTTGATGCGGAAGCCGAAGCACTCGTTGAGGCTGAAGCTGACGCACTTGTACTTGCTGAGGCCGAAGCACTTGTACTTGCTGAAGCCGACGCACTCGTTGATGCGGAAGCCGAAGCACTGGTACTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTGCTTGCTGAGGCCGAAGCACTGGTACTTGCTGAAGCTGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTACTTGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGAAGCACTGGTGCTTGCTGAAGCTGACGCACTTGTTGATGCGGAAGCCGAAGCACTCGTTGAGGCTGAAGCTGACGCACTGGTACTTGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTGCTTGCTGAGGCCGAAGCACTGGTACTTGCTGAAGCTGAGGCGCTTGTGCTTGCTGAAGCCGAAGCACTCGTTGATGCTGAAGCCGAGGCACTCGTTGATGCTGAAGCCGACGCACTGGTACTTGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGAAGCACTGGTGCTTGCTGAAGCTGACGCACTTGTTGATGCGGAAGCCGAAGCACTCGTTGAGGCTGAAGCTGACGCACTGGTACTTGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTGCTTGCTGAGGCCGAAGCACTGGTACTTGCTGAAGCTGAGGCGCTTGTGCTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCCGAGGCGCTTGTCGATGCTGAGGCCGACGCACTGGTACTTGCTGAAGCTGAGGCGCTTGTGCTTGCTGAAGCCGACGCACTGGTACTTGCTGAAGCTGAGGCGCTTGTGCTTGCTGAAGCCGAAGCACTGGTACTTGCGGAAGCCGACGCACTCGTTGATGCTGAAGCTGAGGCACTGGTACTTGCTGAGGCCGAAGCACTGGTACTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTGCTTGCTGAGGCCGAAGCACTGGTACTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCCGACGCACTCGTTGATGCTGAAGCTGAAGCACTCGTTGATGCTGAAGCCGAGGCACTCGTTGATGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTGCTTGCTGAAGCTGACGCACTTGTTGATGCGGAAGCCGAAGCACTCGTTGAGGCTGAAGCTGACGCACTTGTACTTGCTGAGGCCGAAGCACTTGTACTTGCTGAAGCTGAGGCGCTTGTGCTTGCTGAAGCCGACGCACTCGTTGATGCGGAAGCCGAAGCACTGGTACTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCCGACGCACTCGTTGATGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTGCTTGCTGAGGCCGAAGCACTGGTACTTGCTGAAGCTGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTACTTGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGAAGCACTGGTGCTTGCTGAAGCTGACGCACTTGTTGATGCGGAAGCCGAAGCACTCGTTGAGGCTGAAGCTGACGCACTGGTACTTGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTGCTTGCTGAGGCCGAAGCACTGGTACTTGCTGAAGCTGAGGCGCTTGTGCTTGCTGAAGCCGAAGCACTCGTTGATGCTGAAGCCGAGGCACTCGTTGATGCTGAAGCCGACGCACTGGTACTTGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGAAGCACTGGTGCTTGCTGAAGCTGACGCACTTGTTGATGCGGAAGCCGAAGCACTCGTTGAGGCTGAAGCTGACGCACTGGTACTTGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTGCTTGCTGAGGCCGAAGCACTGGTACTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCCGACGCACTCGTTGATGCTGAAGCTGAAGCACTCGTTGATGCTGAAGCCGAGGCACTCGTTGATGCTGAAGCCGAGGCACTGGTTGATGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTGCTTGCTGAAGCTGACGCACTTGTTGATGCGGAAGCCGAAGCACTCGTTGAGGCTGAAGCTGACGCACTTGTACTTGCTGAGGCCGAAGCACTTGTACTTGCTGAAGCCGACGCACTCGTTGATGCGGAAGCCGAAGCACTGGTACTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTGCTTGCTGAGGCCGAAGCACTGGTACTTGCTGAAGCTGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTACTTGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGAAGCACTGGTGCTTGCTGAAGCTGACGCACTTGTTGATGCGGAAGCCGAAGCACTCGTTGAGGCTGAAGCTGACGCACTGGTACTTGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTGCTTGCTGAGGCCGAAGCACTGGTACTTGCTGAAGCTGAGGCGCTTGTGCTTGCTGAAGCCGAAGCACTCGTTGATGCTGAAGCCGAGGCACTCGTTGATGCTGAAGCCGACGCACTGGTACTTGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGAAGCACTGGTGCTTGCTGAAGCTGACGCACTTGTTGATGCGGAAGCCGAAGCACTCGTTGAGGCTGAAGCTGACGCACTGGTACTTGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTGCTTGCTGAGGCCGAAGCACTGGTACTTGCTGAAGCTGAGGCGCTTGTGCTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCCGAGGCGCTTGTCGATGCTGAGGCCGACGCACTGGTACTTGCTGAAGCTGAGGCGCTTGTGCTTGCTGAAGCCGACGCACTGGTACTTGCTGAAGCTGAGGCGCTTGTGCTTGCTGAAGCCGAAGCACTGGTACTTGCGGAAGCCGACGCACTCGTTGATGCTGAAGCTGAGGCACTGGTACTTGCTGAGGCCGAAGCACTGGTACTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTGCTTGCTGAGGCCGAAGCACTGGTACTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCCGACGCACTCGTTGATGCTGAAGCTGAAGCACTCGTTGATGCTGAAGCCGAGGCACTCGTTGATGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTGCTTGCTGAAGCTGACGCACTTGTTGATGCGGAAGCCGAAGCACTCGTTGAGGCTGAAGCTGACGCACTTGTACTTGCTGAGGCCGAAGCACTTGTACTTGCTGAAGCTGAGGCGCTTGTGCTTGCTGAAGCCGACGCACTCGTTGATGCGGAAGCCGAAGCACTGGTACTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCCGACGCACTCGTTGATGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTGCTTGCTGAGGCCGAAGCACTGGTACTTGCTGAAGCTGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTACTTGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGAAGCACTGGTGCTTGCTGAAGCTGACGCACTTGTTGATGCGGAAGCCGAAGCACTCGTTGAGGCTGAAGCTGACGCACTGGTACTTGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTGCTTGCTGAGGCCGAAGCACTGGTACTTGCTGAAGCTGAGGCGCTTGTGCTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCCGAGGCACTCGTTGATGCTGAAGCCGAGGCGCTTGTCGATGCTGAGGCCGACGCACTGGTACTTGCTGAAGCTGAGGCGCTTGTGCTTGCTGAAGCCGACGCACTGGTACTTGCTGAAGCTGAGGCGCTTGTGCTTGCTGAAGCCGAAGCACTGGTACTTGCGGAAGCCGACGCACTCGTTGATGCTGAAGCTGAGGCACTGGTACTTGCTGAGGCCGAAGCACTGGTACTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCCGACGCACTGGTGCTTGCTGAGGCCGAAGCACTGGTACTTGCTGAAGCTGAGGCGCTTGTGCTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCCGAGGCACTCGTTGATGCTGAAGCCGAGGCGCTTGTCGATGCTGAGGCCGACGCACTGGTACTTGCTGAAGCTGAGGCGCTTGTGCTTGCTGAAGCCGACGCACTGGTACTTGCTGAAGCTGAGGCGCTTGTGCTTGCTGAAGCCGAAGCACTGGTACTTGCGGAAGCCGACGCACTCGTTGATGCTGAAGCTGAGGCACTGGTACTTGCTGAGGCCGAAGCACTGGTACTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTGCTTGCTGAGGCCGAAGCACTGGTACTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCCGACGCACTCGTTGATGCTGAAGCTGAAGCACTCGTTGATGCTGAAGCCGAGGCACTCGTTGATGCTGAAGCCGAGGCACTGGTTGATGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTGCTTGCTGAAGCTGACGCACTTGTTGATGCGGAAGCCGAAGCACTCGTTGAGGCTGAAGCTGACGCACTTGTACTTGCTGAGGCCGAAGCACTTGTACTTGCTGAAGCTGAGGCGCTTGTGCTTGCTGAAGCCGAAGCACTCGTTGATGCGGAAGCCGAAGCACTGGTACTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTGCTTGCTGAGGCCGAAGCACTGGTACTTGCTGAAGCTGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTACTTGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGAAGCACTGGTGCTTGCTGAAGCTGACGCACTTGTTGATGCGGAAGCCGAAGCACTCGTTGAGGCTGAAGCTGACGCACTGGTACTTGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTGCTTGCTGAGGCCGAAGCACTGGTACTTGCTGAAGCTGAGGCGCTTGTGCTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCCGAGGCACTCGTTGATGCTGAAGCCGAGGCGCTTGTCGATGCTGAGGCCGACGCACTGGTACTTGCTGAAGCTGAGGCGCTTGTGCTTGCTGAAGCCGACGCACTGGTACTTGCTGAAGCTGAGGCGCTTGTGCTTGCTGAAGCCGAAGCACTGGTACTTGCGGAAGCCGACGCACTCGTTGATGCTGAAGCTGAGGCACTGGTACTTGCTGAGGCCGAAGCACTGGTACTTGCTGAAGCCGACGCACTCGTTGATGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTGCTTGCTGAGGCCGAAGCACTGGTACTTGCTGAAGCTGATGCGCTTGTCGATGCTGAAGCCGAAGCACTGGTTGAGGCTGAAGCCGAGGCGCTTGTCGATGCTGAAGCCGACGCACTGGTGCTTGCTGAAGCTGACGCACTGGTTGATGCGGAAGCCGAAGCACTCGTTGAGGCTGAAGCTGACGCACTTGTACTTGCTGAAGCCGAAGCACTGGTGCTTGCTGAGGCCGAAGCACTTGTACTTGCTGAAGCTGAGGCGCTTGTGCTTGCTGAAGCTGACGCGCTTGTGCTT
164664 NZ_LR134311.1 Escherichia-coli-strain-NCTC9113-genome-assembly Bacteria 864366-881524 17159 169 21 GCAGCGGAAG GCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAGGCAGCAGAAGCGTCCCTGGCTGCAGCGGAAGCCGCCGTTCAG
10620 NC_008576.1 Magnetococcus-marinus-MC-1 Bacteria 3722368-3739046 16679 111 147 TAGCTGTTGG TAGCTGTTGGTATTGACCAACAGGTTGGCCACCGAATCCTTCACACCGGCCCCGTAGGTCAATGTACCGGTGGTGTACTCATCGACAGCGGACAACTGAGCGATGGAGACCGTATCCGTTACCGAAACATTGACGGCCCCTGTCACGTAGCTGTTGGTATTGGCGACCAAGGCAGCGGCACTATCCTTCAAGCCTGCCCCGTAGGTCAGGGTGCCGGTAGTGGCCGTATCCATGGCAGAGAGCTGCGCCATGGTGGCCACGTCGGTAACGGAGACCACATAGCTGCCCGTAATGTAGCTGTTGGTGTTGGCGGCTAGGGCCGCTGCACCATCCTTCAAACCCGCACCATAGCTCAGGGTACCGGTGGTATCCTGATCAATGGCCGACAACTGCGCCATGGTGGCCGCATCGGTGATGGAGACCGCATAGCTGCCCGTCACATAGCTGTTGGTATTGGCTTCCAGCGCCGCAGCGGCATCTTTCAAACCCGCACCGTAGGTCAACGCACCGGTGGTATCCTGATCAATGGCCGACAGCTGCGCCATGGTGGCCGCATCGGTGATGGAGACCGCATAGCTGCCCGTCACATAGCTGTTGGTATTGGCTTCCAGCGCCGCAGCGGCATCTTTCAAACCCGCACCGTAAGTCAGCGCTCCGGTGGTATCCTGATCAATGGCCGACAACTGCGCCATGGTGGCCGCATCGGTGATGGATACCACATAGCTACCCGTCACATAGCTGTTGGTGTTGGCTACCAGCGCCGCAGCGGCATCTTTCAAGCCCGCACCGTAGGTCAGCGCTCCGGTGGTATCCTGATCAATGGCCGACAACTGCGCCATGGTGGCCGCATCGGTGATGGATACCACATAGCTGCCCGTCACGTAGCTGTTGGTATTGGCATCCAGTGCCGCAACGCTGTCTTTCAAGCCCGCACCGTAGGTCAGGGTGCCGCTGGTGGCGGAATCCATGACCAAAAGTTGCGCCATGGTGGCCGCATCGGTAACGGAGACCACATAGCTGCCCGTAATGTAGCTGTTGGTGTTGGCGGCGAGGGCCGCTGCACCATCCTTCAAGCCCGCACCGTAGCTCAGGGTACCGGTGGTTTCCTGATCAATGGCCGACAACTGCGCCATGGTCACCACATCGGTGATGGAGACCGCATAGCTGCCTGTCACATAGCTGTTGGTATTGGCATCCAGCGCTGCAACGCTATCCTTCAGACCGGCACCGTAGGTCAGCGCTCCGGTGGTATCCTGATCAATGGCCGACAACTGCGCCATGGTGGCCGCATCGGTGATCGAAACCACATAGCTGCCCGTCACATAGCTGTTGGTATTGGCTTCCAGGGCCGCAACGGCATCTTTCAAACCTGCACCGTAGGTCAGTGCTCCGGTGGTATCCTGATCAATGGCCGACAACTGCGCCATGGTGGCCGCATCGGTGATCGAAACCACATAGCTACCCGTCACATAGCTGTTGGTATTGGCTACCAGCGCCGCAGCGGCATCTTTCAAGCCCGCACCGTAGGTCAGCGCTCCGGAGGTATCCTGATCAATGGCCGACAACTGCGCCATGGTGGCCGCATCGGTGATGGATACCAGATAGCTGCCCGTCACGTAGCTGTTGGTATTGGCATCCAGTGCCGCAACGCTGTCTTTCAAGCCCGCACCGTAGGTCAGGGTGCCGCTGGTGGCGGTATCCATGACCGAAAGTTGCGCCATGGTGGCCGCATCGGTAACGGAGACCACATAGCTGCCCGTAATGTAGCTGTTGGTGTTGGCGGCGAGGGCCGCTGCACCATCCTTCAAGCCCGCACCGTAGCTCAGGGTACCGGTGGTATCCTGATCAATGGCCGACAACTGCGCCATGGTCACCACATCGGTGATGGAGACCGCATAGCTGCCTGTCACATAGCTGTTGGTATTGGCATCCAGCGCTGCAACGCTATCCTTCAGACCGGCACCGTAGGTCAGCGCTCCGGTGGTATCCTGATCAATGGCCGACAACTGCGCCATGGTGGCCGCATCGGTGATCGAAACCACATAGCTGCCCGTCACATAGCTGTTGGTATTGGCTTCCAGGGCCGCAACGGCATCTTTCAAACCTGCACCGTAGGTCAGTGCTCCAGTGGTGTCCTGATCAATGGCCGACAACTGCGCCATGGTGGCCGCATCGGTGATCGAAACCACATAGCTACCCGTCACATAGCTGTTGGTATTGGCTACCAGCGCCGCAGCGGCATCTTTCAAACCCGCACCGTAGGTCAGCGCTCCAGTGGTGTCCTGATCAATGGCCGACAACTGCGCCATGGTGGCCGCATCGGTGATCGAAACGAGGTAAGAACCGGTCACGTAGCTGTTGGTATTGGCATCCAGTGCCGCAACACCGTCCTTCAAGCCCGCACCGTAGCTTAGGGTGCCGCTGGTGGCGATATCCATGACCGAAAGTTGCGCCATGGTGGCCGCATCGGTAACGGAGACCACATAGCTGCCCGTAATGTAGCTGTTGGTGTTGGCGGCGAGGGCCGCTGCACCATCCTTCAAGCCTGCACCATAGCTCAGGGTACCGGTGGTATCCTGATCAATGGCCGACAACTGCGCCATGGTCACCACATCGGTGATGGAGACCGCATAGCTGCCCGTTACATAGCTGTTGGTATTGGCTTCCAGCGCTGCAACGCTATCCTTCAGACCCGCACCGTAGGTCAGCGCTCCGGAGGTATCCTGATCAATGGCCGACAACTGCGCCATGGTGGCCGCATCGGTGATCGAAACCACATAACTGCCCGTCACATAGCTGTTGGTATTGGCTTCCAGCGCCGCAGCGGCATCTTTCAAACCCGCACCGTAAGTCAACGCACCGGTGGTATCCTGATCAATGGCCGACAACTGCGCCATGGTGGCCGCATCGGTGATCGAAACCACATAGCTACCCGTCACATAGCTGTTGGTATTGGCTACCAGCGCCGCAGCGGCATCTTTCAAGCCCGCACCGTAGGTCAGCGCTCCAGTGGTATCCTGATCAATGGCCGACAACTGCGCCATGGTGGCCGCATCGGTGATGGAAACGAGGTAAGAACCGGTCACGTAGCTGTTGGTATTGGCATCCAGTGCCGCAACACCGTCCTTCAAGCCCGCACCGTAGCTCAGGGTGCCGCTGGTGGCGGTATCCATGACCGAAAGTTGCGCCATGGTGGCTGCATCGGTAACGGAGACCACATAGCTGCCCGTAATGTAGCTATTGGTGTTGGCGGCTAGGGCCGCTGCACCATCCTTCAAGCCTGCACCATAGCTCAGGGTACCGGTGGTATCCTGATCAATGGCCGACAGCTGTGCCATCGTCACCACATCGGTGATGGAGACCGCATAGCTGCCCGTCACATAGCTGTTGGTATTGGCTTCCAGCGCTGCAACGCTATCCTTCAGACCCGCACCGTAGGTCAGCGCTCCGGTGGTATCCTGATCAATGGCCGACAACTGCGCCATGGTGGCCGCATCGGTGATGGAGACCGCATAGCTGCCCGTCACATAGCTGTTGGTATTGGCTTCCAGCGCCGCAGCGGTATCTTTCAAACCTGCACCGTAGGTCAGCGCTCCGGTGGTGTCCTGATCAATGGCCGACAGCTGCGCCATGGTGGCCGCATCGGTGATCGAAACCACATAGCTGCCCGTCACATAGCTGTTGGTATTGGCTTCCAGGGCCGCAACGCTATCCTTCAAGCCCGCACCGTAGGTCAGGGTACCGGTGGTGTCCTGATCAATGGCCGACAACTGCGCCATGGTCACCACATCGGTGATGGAAACGAGGTAAGAACCGGTCACATAGCTGTTGGTATTGGCTTCCAGCGCCGCGACGCCATCTTTCAGACCTGCACCGTAGGTCAACGCACCGGTGGTATCCTGATCAATGGCCGACAGCTGCGCCATGGTGGCCGCATCGGTGATCGAAACCACATAGCTGCCCGTCACGTAGCTGTTGGTGTTGGCATCAAGCGCCGCTACCCCATCCTTCAAGCCCGCACCGTAGGTCAGCGCACCCGTGGTATCCTGATCAATGGCCGACAGCTGCGCCATGGTGGCCGCATCGGTTATCGAGACCGCATAGCTACCCGTCACATAGCTGTTGGTATTGGCTTCCAGCGCCGCAGCGGCATCTTTCAAACCCGCACCGTAGGTCAGCGCTCCGGTGGTATCCTGATCAATGGCCGACAACTGCGCCATGGTGGCCGCATCGGTGATGGAGACCACATAACTACCCGTCACGTAGCTGTTGGTATTGGCTTCCAGGGCCGCAGCGGCATCTTTCAGACCCGCACCGTAGGTCAACGCACCGGTGGTATCCTGATCAATGGCCGACAGCTGCGCCATGGTGGCCGCATCGGTGATCGAAACCACATAGCTGCCCGTCACATAGCTGTTGGTATTGGCTTCCAGCGCCGCAACGCTATCCTTCAAGCCCGCACCGTAAGTCAGCGCTCCGGTGGTATCCTGATCAATGGCCGACAACTGCGCCATGGTGGCCGCATCGGTGATGGAAACGAGGTAAGAACCGGTCACGTAGCTGTTGGTATTGGCATCCAGTGCCGCAACACCGTCCTTCAAGCCCGCACCGTAGCTTAGGGTGCCGCTGGTGGCGGTATCCATGACCGAAAGTTGCGCCATGGTGGCCGCATCGGTAACGGAGACCACATAGCTGCCCGTGATGTAGCTGTTGGTGTTGGCGGCGAGGGCCGCTGCACCATCCTTCAGACCCGCACCGTAGCTCAGGGTACCGGTGGTATCCTGATCAATGGCCGACAGCTGCGCCATGGTCACCACATCGGTGATGGAGACCGCATAGCTGCCCGTCACATAGCTGTTGGTATTGGCATCCAGCGCTGCAACGCTATCCTTCAAGCCCGCACCGTAGGTCAGCGCTCCGGTGGTATCCTGATCAATGGCCGACAACTGCGCCATGGTGGCCGCATCGGTGATGGAAACGAGGTAAGAACCTGTCACGTAGCTGTTGGTGTTGGCTTCCAGGGCCGCAACGCTATCCTTCAAGCCCGCACCGTAGGTCAGCGCTCCAGTGGTATCCTGATCAATGGCCGACAACTGCGCCATGGTGGCCGCATCGGTGATGGAAACGAGGTAAGAACCGGTCACGTAGCTGTTGGTATTGGCATCCAGTGCCGCAACACCGTCCTTCAAGCCCGCACCGTAGCTTAGGGTGCCGCTGGTGGCGGTATCCATGACCGAAAGTTGCGCCATGGTGGCCGCATCGGTAACGGAGACCACATAGCTGCCCGTAATGTAGCTATTGGTGTTGGCGGCGAGGGCCGCTGCACCATCCTTCAAGCCTGCACCATAGCTCAGGGTACCGGTGGTATCCTGATCAATGGCCGACAACTGCGCCATGGTCACCACATCGGTGATGGAGACCGCATAGCTGCCCGTCACATAGCTGTTGGTATTGGCATCCAGCGCTGCTACCCCATCCTTCAGACCCGCACCGTAGGTCAGCGCTCCGGTGGTATCCTGATCAATGGCCGACAACTGCGCCATGGTGGCCGCATCGGTGATCGAAACCACATAGCTGCCCGTCACATAGCTGTTGGTATTGGCTTCCAGCGCCGCAGCGGCATCTTTCAAACCCGCACCGTAGGTCAACGCACCGGTGGTATCCTGATCAATGGCCGACAGCTGCGCCATGGTGGCCGCATCGGTGATCGAAACCACATAGCTGCCCGTCACGTAGCTGTTGGTATTGGCTACCAGCGCCGCAGCGGCATCTTTCAAGCCCGCACCGTAGGTCAGCGCTCCGGTGGTGTCCTGATCAATGGCCGACAACTGCGCCATGGTGGCCGCATCGGTGATGGAAACGAGGTAAGAACCGGTCACGTAGCTGTTGGTATTGGCATCCAGTGCCGCAACACCGTCCTTCAAGCCCGCACCGTAGGTCAGGGTGCCGCTGGTGGCGGTATCCATGACCGAAAGTTGCGCCATGGTGGCCGCATCGGTAACGGAGACCACATAGCTGCCCGTAATGTAGCTGTTGGTGTTGGCGGCTAGGGCCGCTGCACCATCCTTCAAGCCTGCACCATAGCTCAGGGTACCGGTGGTATCCTGATCAATGGCCGACAGCTGTGCCATCGTCACCACATCGGTGATGGAGACCGCATAGCTGCCCGTCACATAGCTGTTGGTATTGGCATCCAGCGCTGCTACCCCATCCTTCAGACCCGCACCGTAGGTCAGCGCTCCAGAGGTATCCTGATCAATGGCCGACAACTGCGCCATGGTAGCCGCATCGGTGATGGAGACAACATAGCTGCCCGTCACATAGCTATTGGTATTGGCTTCCAGCGCCGCAGCGGTATCTTTCAAACCTGCACCGTAGGTCAGCGCTCCGGTGGTATCCTGATCAATGGCCGACAGCTGCGCCATGGTGGCCGCATCGGTGATGGAAACGAGGTAAGAACCTGTCACGTAGCTGTTGGTGTTGGCTTCCAGGGCCGCAACGCTATCCTTCAAGCCCGCACCGTAGGTCAGCGCTCCAGTGGTATCCTGATCAATGGCCGACAACTGCGCCATGGTGGCCGCATCGGTGATCGAAACGAGGTAAGAACCGGTCACGTAGCTGTTGGTATTGGCATCCAGTGCCGCAACACCGTCCTTCAAGCCCGCACCGTAGGTCAGGGTGCCGCTGGTGGCGGTATCCATGACCGAAAGTTGCGCCATGGTGGCCGCATCGGTAACGGAGACCACATAGCTGCCCGTAATGTAGCTGTTGGTGTTGGCGGCTAGGGCCGCTGCACCATCCTTCAAGCCTGCACCATAGCTCAGGGTACCGCTGGTATCCTGATCAATGGCCGACAACTGCGCCATCGTCACCACATCGGTGATGGAGACCGCATAGCTGCCCGTCACATAGCTGTTGGTATTGGCATCCAGCGCTGCTACACCATCCTTCAGACCCGCACCGTAGGTCAGCGCTCCGGTGGTATCCTGATCAATGGCCGACAACTGCGCCATGGTAGCCGCATCGGTGATCGAAACCACATAGCTACCCGTCACATAGCTGTTGGTATTGGCTTCCAGCGCCGCAACGGCATCTTTCAAACCCGCACCGTAGGTCAACGCACCGGTGGTATCCTGATCAATGGCCGACAGCTGCGCCATGGTGGCCGCATCGGTGATCGAAACCACATAGCTGCCCGTCACGTAGCTGTTGGTATTGGCTACCAGCGCCGCAGCGGCATCTTTCAAGCCCGCACCGTAGGTCAGCGCTCCGGTGGTGTCCTGATCAATGGCCGACAACTGCGCCATGGTGGCCGCATCGGTGATCGAAACGAGGTAAGAACCGGTCACGTAGCTGTTGGTATTGGCATCCAGTGCCGCAACACCGTCCTTCAAGCCCGCACCGTAGGTCAGGGTGCCGCTGGTGGCGGTATCCATGACCGAAAGTTGCGCCATGGTGGCCGCATCGGTAACGGAGACAACATAGCTGCCCGTAATGTAGCTGTTGGTGTTGGCGGCTAGGGCCGCTGCACCATCCTTCAAGCCTGCACCATAGCTCAGGGTACCGGTGGTATCCTGATCAATGGCCGACAACTGCGCCATGGTCACCACATCGGTGATGGAGACCGCATAGCTGCCCGTCACATAGCTGTTGGTATTGGCATCCAGCGCTGCTACCCCATCCTTCAGACCCGCACCGTAGGTCAGCGCTCCGGTGGTATCCTGATCAATGGCCGACAACTGCGCCATGGTGGCCGCATCGGTGATCGAAACCACATAACTGCCCGTCACATAGCTGTTGGTATTGGCTTCCAGCGCCGCAGCGGCATCTTTCAAACCTGCACCGTAGGTCAGTGCTCCAGTGGTGTCCTGATCAATGGCCGACAGCTGCGCCATGGTGGCCGCATCGGTGATGGAGACCACATAGCTGCCCGTCACATAGCTGTTGGTATTGGCTTCCAGCGCCGCAGCGGCATCTTTCAAACCCGCACCGTAGGTCAGCGCTCCAGTGGTATCCTGATCAATGGCCGACAACTGCGCCATGGTGGCCGCATCGGTGATCGAAACGAGGTAAGAACCGGTCACGTAGCTGTTGGTATTGGCATCCAGTGCCGCAACACCGTCCTTCAAGCCCGCACCGTAGGTCAGGGTGCCGCTGGTGGCGGTATCCATGACCGAAAGTTGCGCCATGGTGGCCGCATCGGTAACGGAGACAACATAGCTGCCCGTAATGTAGCTGTTGGTGTTGGCGGCTAGGGCCGCTGCACCATCCTTCAAGCCTGCACCATAGCTCAGGGTACCGGTGGTATCCTGATCAATGGCCGACAACTGCGCCATGGTCACCACATCGGTGATGGAGACCGCATAGCTGCCCGTCACATAGCTGTTGGTATTGGCTTCCAGCGCCGCAGCGGCATCTTTCAAACCCGCACCGTAGGTCAGCGCTCCGGTGGTATCCTGATCAATGGCCGACAACTGCGCCATGGTAGCCGCATCGGTGATCGAGGCCGCATAGCTGCCCGTCACATAGCTGTTGGTATTGGCTTCCAGCGCCGCAGCGGCATCTTTCAAACCTGCACCGTAGGTCAGTGCTCCAGTGGTGTCCTGATCAATGGCCGACAGCTGCGCCATGGTGGCCGCATCGGTGATGGAGACCACATAGCTGCCCGTCACATAGCTGTTGGTATTGGCTTCCAGCGCCGCAGCGGCATCTTTCAAACCCGCACCGTAGGTCAGCGCTCCAGTGGTATCCTGATCAATGGCCGACAACTGCGCCATGGTGGCCGCATCGGTGATCGAAACGAGGTAAGAACCGGTCACGTAGCTGTTGGTATTGGCATCCAGTGCCGCAACACCGTCCTTCAAGCCCGCACCGTAGGTCAGGGTGCCGCTGGTGGCGGTATCCATGACCGAAAGTTGCGCCATGGTGGCCGCATCGGTAACGGAGACAACATAGCTGCCCGTAATGTAGCTGTTGGTGTTGGCGGCTAGGGCCGCTGCACCATCCTTCAAGCCTGCACCATAGCTCAGGGTACCGGTGGTATCCTGATCAATGGCCGACAACTGCGCCATGGTCACCACATCGGTGATGGAGACCGCATAGCTGCCCGTCACATAGCTGTTGGTATTGGCTTCCAGCGCCGCAGCGGCATCTTTCAAACCCGCACCGTAGGTCAGCGCTCCGGTGGTATCCTGATCAATGGCCGACAACTGCGCCATGGTAGCCGCATCGGTGATCGAGGCCGCATAGCTGCCCGTCACATAGCTGTTGGTATTGGCTTCCAGCGCCGCAGCGGCATCTTTCAAACCTGCACCGTAGGTCAGTGCTCCAGTGGTGTCCTGATCAATGGCCGACAGCTGCGCCATGGTGGCCGCATCGGTGATGGAGACCACATAGCTGCCCGTCACATAGCTGTTGGTATTGGCTTCCAGCGCCGCAGCGGCATCTTTCAAACCCGCACCGTAGGTCAGCGCTCCAGTGGTATCCTGATCAATGGCCGACAACTGCGCCATGGTGGCCGCATCGGTGATGGAAACGAGGTAAGAACCGGTCACGTAGCTGTTGGTATTGGCATCCAGTGCCGCAACACCGTCCTTCAAGCCCGCACCGTAGGTCAGGGTGCCGCTGGTGGCGGTATCCATGACCGAAAGTTGCGCCATGGTGGCCGCATCGGTAACGGAGACAACATAGCTGCCCGTAATGTAGCTGTTGGTGTTGGCGGCTAGGGCCGCTGCACCATCCTTCAAGCCTGCACCATAGCTCAGGGTACCGGTGGTATCCTGATCAATGGCCGACAACTGCGCCATGGTCACCACATCGGTGATGGAGACCGCATAGCTGCCCGTCACATAGCTGTTGGTATTGGCTTCCAGCGCTGCTACACCATCCTTCAGACCCGCACCGTAGGTCAGCGCTCCGGTGGTATCCTGATCAATGGCCGACAACTGCGCCATGGTGGCCGCATCGGTGATCGAAACCACATAGTTGCCCGTCACATAGCTGTTGGTATTGGCTTCCAGCGCCGCAGCGGTATCTTTCAAACCTGCACCGTAGGTCAGTGCTCCAGTGGTGTCCTGATCAATGGCCGACAGCTGCGCCATGGTGGCCGCATCGGTGATCGAAACCACATAGCTGCCCGTCACATAGCTGTTGGTATTGGCATCCAGTGCCGCAACACCGTCCTTCAAGCCCGCACCGTAGGTCAGGGTGCCGCTGGTGGCGGTATCCATGACCGAAAGTTGCGCCATGGTGGCCGCATCGGTAACGGAGACAACATAGCTGCCCGTAATGTAGCTGTTGGTGTTGGCGGCTAGGGCCGCTGCACCATCCTTCAAGCCTGCACCATAGCTCAGGGTACCGGTGGTATCCTGATCAATGGCCGACAACTGCGCCATCGTCACCACATCGGTGATGGAGACCGCATAGCTGCCCGTCACATAGCTGTTGGTATTGGCATCCAGCGCTGCAACGCTATCCTTCAGACCGGCACCGTAGGTCAGCGCTCCGGTGGTATCCTGATCAATGGCCGACAACTGCGCCATGGTGGCCGCATCGGTGATCGAAACCACATAGTTGCCCGTCACATAGCTGTTGGTATTGGCTTCCAGCGCCGCAGCGGCATCTTTCAAACCCGCACCGTAGGTCAACGCACCGGTGGTATCCTGATCAATGGCCGACAGCTGCGCCATGGTGGCCGCATCGGTGATGGAGACCACATAGCTGCCCGTCACATAGCTGTTGGTATTGGCTTCCAGCGCCGCAGCGGCATCTTTCAAACCCGCACCGTAGGTCAGCGCTCCAGTGGTATCCTGATCAATGGCCGACAACTGCGCCATGGTGGCCGCATCGGTGATGGAAACGAGGTAAGAACCGGTCACGTAGCTGTTGGTATTGGCATCCAGTGCCGCAACACCGTCCTTCAAGCCCGCACCGTAGCTCAGGGTGCCGCTGGTGGCGGTATCCATGACCGAAAGCTGCGCCATGGTGGCCGCATCGGTAACGGAGACCACATAGCTGCCCGTAATGTAGCTGTTGGTGTTGGCGGCTAGGGCCGCTGCAGCATCCTTCAGACCCGCACCGTAGGTCAGCGCTCCAGTAGTATCCTGATCAATGGCCGACAACTGCGCCATGGTGGCCGCATCGGTTATCGAGACCGCATAGCTGCCTGTCACATAGCTGTTGGTATTGGCATCCAGCGCTACAACGCTATCCTTCAAACCCGCACCGTAGGTCAGCGCTCCGGTGGTATCCTGATCAATGGCCGACAACTGCGCCATGGTAGCCGCATCGGTGATCGAAACCACATAGCTGCCCGTCACATAGCTGTTGGTATTGGCTTCCAGCGCCGCAGCGGCATCTTTCAAACCCGCACCGTAGGTCAACGCACCGGTGGTATCCTGATCAATGGCCGACAGCTGCGCCATGGTGGCCGCATCGGTGATGGAGACCACATAGCTGCCCGTCACATAGCTGTTGGTATTGGTTTCCAGCGCCGCAGCGGCATCTTTCAAACCCGCACCGTAGGTCAGCGCTCCAGTGGTATCCTGGTCAATAGCCGACAACTGCGCCATGGTGGCCGCATCGGTGATGGAGACTGCATAGCTGCCTGTCACGTAGCTGTTGGTATTGGCTTCCAGCGCCGCAACACCGTCCTTCAAGCCCGCACCGTAGCTCAGGGTGCCGCTGGTGGCGGAATCCATGACCGAAAGTTGCGCCATGGTGGCCGCATCGGTAACGGAGACCACATAGCTGCCCGTAATGTAGCTGTTGGTGTTGGCGGCTAGGGCCGCAGCAGCATCCTTCAGACCCGCACCGTAGGTCAGCGCTCCAGTAGTATCCTGATCAATGGCCGACAACTGCGCCATGGTGGCCGCATCGGTGATGGAGACCGCATAGCTGCCGGTCACATAGCTGTTGGTATTGGCTTCCAGCGCCGCAGCGGCATCTTTCAAACCCGCACCGTAGGTCAGCGCTCCGGTGGTATCCTGATCAATGGCCGACAACTGCGCCATGGTAGCCGCATCGGTGATCGAAACCACATAGCTGCCCGTCACATAGCTGTTGGTATTGGCTTCCAGCGCCGCAGCGGCATCTTTCAAACCTGCACCGTAGGTCAACGCACCGGTGGTATCCTGATCAATGGCCGACAGCTGCGCCATGGTGGCCGCATCGGTAACGGAGACCACATAGCTGCCCGTCACATAGCTGTTGGTATTGGCTTCCAGGGCCGCAGCGGTATCTTTCAAACCCGCACCGTAGGTCAGCGCTCCAGTGGTATCCTGATCAATGGCCGACAACTGCGCCATGGTGGCCGCATCGGTAATGGAGACTGCATAGCTGCCTGTCACGTAGCTGTTGGTATTGGCTTCCAGCGCCGCAGCAGCATCCTTCAGACCCGCACCGTAGGTCAGCGCTCCAGTAGTATCCTGATCAATGGCCGACAACTGCGCCATGGTGGCCGCATCGGTAATGGAGACTGCATAACTACCCGTCACATAGCTGTTGGTATTGGCTTCCAGCGCGACAACACCATCCTTCAGACCCGCACCGTAGGTCAGCGCTCCAGTAGTATCCTGATCAATGGCCGACAACTGCGCCATGGTGGCCGCATCGGTTATCGAGACCGCATAGCTGCCCGTCACATAGCTGTTGGTATTGGCTTCCAGCGCCGCAGCGGCATCTTTCAAACCCGCACCGTAGGTCAGCGCTCCGGTGGTATCCTGATCAATGGCCGACAACTGCGCCATGGTAGCCGCATCGGTGATCGAAACCACATAGCTGCCCGTCACATAGCTGTTGGTATTGGCTTCCAGCGCCGCAGCGGCATCTTTCAAACCTGCACCGTAGGTCAACGCACCGGTGGTATCCTGATCAATGGCCGACAGCTGCGCCATGGTGGCCGCATCGGTAACGGAGACCACATAGCTGCCCGTCACATAGCTGTTGGTATTGGCTTCCAGGGCCGCAGCGGTATCTTTCAAACCCGCACCGTAGGTCAGCGCTCCAGTGGTATCCTGATCAATGGCAGACAACTGCGCCATGGTGGCCGCATCGGTAATGGAGACTGCATAGCTGCCTGTCACGTAGCTGTTGGTATTGGCTTCCAGCGCCGCAGCAGCATCCTTCAGACCCGCACCGTAGGTCAGCGCTCCAGTAGTATCCTGATCAATGGCCGACAACTGCGCCATGGTGGCCGCATCGGTTATCGAGACCGCATAGCTGCCTGTCACATAGCTGTTGGTATTGGCTTCCAGCGCGACAACACCATCCTTCAGACCCGCACCGTAGGTCAGCGCTCCAGTAGTATCCTGATCAATGGCCGACAACTGCGCCATGGTGGCCGCATCGGTTATCGAGACCGCATAGCTGCCTGTCACATAGCTGTTGGTATTGGCTTCCAGCGCCGCAGCGGCATCTTTCAAACCCGCACCGTAGGTCAGCGCTCCGGTGGTATCCTGATCAATGGCCGACAACTGCGCCATGGTGGCCGCATCGGTGATGGAAACGAGGTAAGAACCGGTCACGTAGCTGTTGGTATTGGCATCCAGTGCCGCAACACCGTCCTTCAAGCCCGCACCGTAGCTCAGGGTGCCGCTGGTGGCGGTATCCATGACCGAAAGTTGCGCCATGGTGGCCGCATCGGTAACGGAGACCACATAGCTGCCCGTAATGTAGCTATTGGTGTTGGCGGCTAGGGCCGCTGCACTATCCTTCAAGCCTGCACCATAGCTCAGGGTACCGGTGGTATCCTGATCAATGGCCGACAACTGCGCCATGGTGGCCGCATCGGTGATCGAAACCACATAGCTGCCCGTCACATAGCTGTTGGTATTGGCTTCCAGGGCCGCAGCGGTATCTTTCAAACCCGCACCGTAGGTCAGCGCTCCAGTGGTATCCTGATCAATGGCAGACAACTGCGCCATGGTGGCCGCATCGGTGATGGAGACCGCATAACTACCCGTCACATAGCTGTTGGTATTGGTTTCCAGCGCCGCAGCGGCATCTTTCAAACCCGCACCGTAGGTCAACGCTCCGGTGGTATCCTGATCAATGGCCGACAACTGCGCCATGGTGGCCGCATCGGTGATCGAAACCACATAGCTGCCCGTCACATAGCTGTTGGTATTGGTTTCCAGGGCCGCAGCGGCATCTTTCAAACCCGCACCGTAGGTCAGCGCTCCAGTGGTATCCTGATCAATGGCCGACAACTGCGCCATGGTGGCCGCATCGGTGATGGAAACCGCATAACTACCTGTCACATAGCTGTTGGTGTTGGCATCCAGGGCGGTAACACCATCCTTCAAACCCGCACCGTAGATCAGCGCTCCAGTGGTATCCTGATCAATGGCCGACAACTGCGCCATGGTGGCCGCATCCGTAACAGAAACAGCCAACGCACCCGTCACATAGCTGTTTGTGTTGGCGGCCAGCGCTGATGCGCTATCTTTCAATCCGGAACCATAGGTCAACGTGCCAGAAGTTGCCGCATCCATGGCTGACAACTCCGCCATGGTGGCCACATCCGTTACAGAAACAGCATAGGAACCTGTCACATAGCTGTTGGTATTAGCGGCCAGCGCGGCTGCACTGTCCTTTAAGCCGGAACCATAGGTCAACGCACCGGTGGTATCCTGATCAATAGAGGACAACTGCGCCATGGTCACCACATCAGTGATGGAGACAGCATAGCTGCCCGTTACATAGCTGTTGGTGTTGGCATCAAGGGCAGAAACCCCATCCTGTAAGCCCGCACCGTAGGTCAACGCTCCGGAGGTATCCTGATCAATGGCCGACAACTGCGCCATTGTGGCCGCATCGGTGATGGAGACCACATAACTGCCCGTCACATAGCTGTTGGTATTGGCTTCCAGCGCCGCAGCGGCATCTTTCAAACCCGCACCATAAGCCAGCGTACCCGTGGTATCCTGATCAATGGCCGACAACTGCGCCATAGTGGCGGCATCTGTAATGGAGACGGCTAGCGATCCGGTAACATAGCTATTGGTATTGGTTTCCAGTGCCGCCGCAGCATCTTTCAAACCCGCACCGTAGGTCAGTGTGCCCGTGGTATCCTGGTCAATCGAGGATAACTGTGCTATGGATGCCGCATCTGTAACAGAAACGGCCAATGCACCGGTCACA
79950 NZ_CP016987.1 Vibrio-cholerae-strain-FORC_055-isolate-MFDS-chromosome-1 Bacteria 1341420-1357674 16255 65 249 AGCGATAGCG AGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCAAGCGATAGCGACCTGATCACCAAAAATGGCGCGTTGAGCATCGGCAACGTTGAAGATGGCGCGACGGTGGAATACAGCACCGACGGCGAAAACTGGAGCAGCAGCTTCACGCCGGCTGAAGGTGAGAACACCGTTTACGTGCGTCAAACGGACGTGGCAGGCAACACCTCAGGCAGCAGCACCTTAACGTTCACACTCGACACGACCGTGGCGGCGCCGACCGTGAGCCTGACGACAGACAGCGGCTCA
33633 NZ_AP019193.1 Aeromonas-hydrophila-GSH8-2-DNA Bacteria 883545-899188 15644 54 297 TCACCATCAC TCACCATCACCATCACCGGCACCGACGATGCCCCGGTTATCTCGGCCGACACCGGCGCGGTCACCGAGGGAGATCAAACCCCGGTGACCGGCACCCTGACGGCGAGCGACGCGGACAACCCGACCCTGACCTTTGTGGCGGGCAGCGAGGAGCGAGCCTTTGGTCGCTTCGAGGTGGGAACGGACGGCAAGTGGAGCTTCGTGCTGGCGAATAACGCCACCGTCGATGCGCTGACTGCCGGCGAGAAACACATCGAGCAGTTCACCGTGACCCTGAGCGATGGCTCGACCACCAAGGTCACCATCACCATCACCGGCACCGACGATGCCCCGGTTATCTCGGCCGACACCGGCGCGGTCACCGAGGGAGATCAAACCCCGGTGACCGGCACCCTGACGGCGAGCGACGCGGACAACCCGACCCTGACCTTTGTGGCGGGCAGCGAGGAGCGAGCCTTTGGTCGCTTCGAGGTGGGAACGGACGGCAAGTGGAGCTTCGTGCTGGCGAATAACGCCACCGTCGATGCGCTGACTGCCGGCGAGAAACACATCGAGCAGTTCACCGTGACCCTGAGCGATGGCTCGACCACCAAGGTCACCATCACCATCACCGGCACCGACGATGCCCCGGTTATCTCGGCCGACACCGGCGCGGTCACCGAGGGAGATCAAACCCCGGTGACCGGCACCCTGACGGCGAGCGACGCGGACAACCCGACCCTGACCTTTGTGGCGGGCAGCGAGGCGCGAGCCTTTGGTCGCTTCGAGGTGGGAACGGACGGCAAGTGGAGTTTCGTGCTGGCGAATAACGCCACCGTCGATGCGCTGACTGCCGGCGAGAAACACATCGAGCAGTTCACCGTGACCCTGAGCGATGGCTCGACCACCAAGGTCACCATCACCATCACCGGCACCGACGATGCCCCGGTTATCTCGGCCGACACCGGCGCGGTCACCGAGGGAGATCAAACCCCGGTCACCGGCACCCTGACGGCGAGCGACGCGGACAACCCGACCCTGACCTTTGTGGCGGGCAGCGAGGCGCGAGCCTTTGGTCGCTTCGAGGTGGGAACGGACGGCAAGTGGAGTTTCGTGCTGGCGAATAACGCCACCGTCGATGCGCTGACTGCCGGCGAGAAACACATCGAGCAGTTCACCGTGACCCTGAGCGATGGCTCGACCACCAAGGTCACCATCACCATCACCGGCACCGACGATGCCCCGGTTATCTCGGCCGACACCGGCGCGGTCACCGAGGGAGATCAAACCCCGGTCACCGGCACCCTGACGGCGAGCGACGCGGACAACCCGACCCTGACCTTTGTGGCGGGCAGCGAGGCGCGAGCCTTTGGTCGCTTCGAGGTGGGAACGGACGGCAAGTGGAGCTTCGTGCTGGCGAATAACGCCACCGTCGATGCGCTGACTGCCGGCGAGAAACACATCGAGCAGTTCACCGTGACCCTGAGCGATGGCTCGACCACCAAGGTCACCATCACCATCACCGGCACCGACGATGCCCCGGTTATCTCGGCCGACACCGGCGCGGTCACCGAGGGAGATCAAACCCCGGTCACCGGCACCCTGACGGCGAGCGACGCGGACAACCCGACCCTGACCTTTGTGGCGGGCAGCGAGGAGCGAGCCTTTGGTCGCTTCGAGGTGGGAACGGACGGCAAGTGGAGCTTCGTGCTGGCGAATAACGCCACCGTCGATGCGCTGACTGCCGGCGAGAAACACATCGAGCAGTTCACCGTGACCCTGAGCGATGGCTCGACCACCAAGGTCACCATCACCATCACCGGCACCGACGATGCCCCGGTTATCTCGGCCGACACCGGCGCGGTCACCGAGGGAGATCAAACCCCGGTGACCGGCACCCTGACGGCGAGCGACGCGGACAACCCGACCCTGACCTTTGTGGCGGGCAGCGAGGAGCGAGCCTTTGGTCGCTTCGAGGTGGGAACGGACGGCAAGTGGAGTTTCGTGCTGGCGAATAACGCCACCGTCGATGCGCTGACTGCCGGCGAGAAACACATCGAGCAGTTCACCGTGACCCTGAGCGATGGCTCGACCACCAAGGTCACCATCACCATCACCGGCACCGACGATGCCCCGGTTATCTCGGCCGACACCGGCGCGGTCACCGAGGGAGATCAAACCCCGGTCACCGGCACCCTGACGGCGAGCGACGCGGACAACCCGACCCTGACCTTTGTGGCGGGCAGCGAGGAGCGAGCCTTTGGTCGCTTCGAGGTGGGAACGGACGGCAAGTGGAGCTTCGTGCTGGCGAATAACGCCACCGTCGATGCGCTGACTGCCGGCGAGAAACACATCGAGCAGTTCACCGTGACCCTGAGCGATGGCTCGACCACCAAGGTCACCATCACCATCACCGGCACCGACGATGCCCCGGTTATCTCGGCCGACACCGGCGCGGTCACCGAGGGAGATCAAACCCCGGTCACCGGCACCCTGACGGCGAGCGACGCGGACAACCCGACCCTGACCTTTGTGGCGGGCAGCGAGGAGCGAGCCTTTGGTCGCTTCGAGGTGGGAACGGACGGCAAGTGGAGCTTCGTGCTGGCGAATAACGCCACCGTCGATGCGCTGACTGCCGGCGAGAAACACATCGAGCAGTTCACCGTGACCCTGAGCGATGGCTCGACCACCAAGGTCACCATCACCATCACCGGCACCGACGATGCCCCGGTTATCTCGGCCGACACCGGCGCGGTCACCGAGGGAGATCAAACCCCGGTCACCGGCACCCTGACGGCGAGCGACGCGGACAACCCGACCCTGACCTTTGTGGCGGGCAGCGAGGAGCGAGCCTTTGGTCGCTTCGAGGTGGGAACGGACGGCAAGTGGAGCTTCGTGCTGGCGAATAACGCCACCGTCGATGCGCTGACTGCCGGCGAGAAACACATCGAGCAGTTCACCGTGACCCTGAGCGATGGCTCGACCACCAAGGTCACCATCACCATCACCGGCACCGACGATGCCCCGGTTATCTCGGCCGACACCGGCGCGGTCACCGAGGGAGATCAAACCCCGGTCACCGGCACCCTGACGGCGAGCGACGCGGACAACCCGACCCTGACCTTTGTGGCGGGCAGCGAGGAGCGAGCCTTTGGTCGCTTCGAGGTGGGAACGGACGGCAAGTGGAGCTTCGTGCTGGCGAATAACGCCACCGTCGATGCGCTGACTGCCGGCGAGAAACACATCGAGCAGTTCACCGTGACCCTGAGCGATGGCTCGACCACCAAGGTCACCATCACCATCACCGGCACCGACGATGCCCCGGTTATCTCGGCCGACACCGGCGCGGTCACCGAGGGAGATCAAACCCCGGTGACCGGCACCCTGACGGCGAGCGACGCGGACAACCCGACCCTGACCTTTGTGGCGGGCAGCGAGGAGCGAGCCTTTGGTCGCTTCGAGGTGGGAACGGACGGCAAGTGGAGCTTCGTGCTGGCGAATAACGCCACCGTCGATGCGCTGACTGCCGGCGAGAAACACATCGAGCAGTTCACCGTGACCCTGAGCGATGGCTCGACCACCAAGGTCACCATCACCATCACCGGCACCGACGATGCCCCGGTTATCTCGGCCGACACCGGCGCGGTCACCGAGGGAGATCAAACCCCGGTCACCGGCACCCTGACGGCGAGCGACGCGGACAACCCGACCCTGACCTTTGTGGCGGGCAGCGAGGAGCGAGCCTTTGGTCGCTTCGAGGTGGGAACGGACGGCAAGTGGAGCTTCGTGCTGGCGAATAACGCCACCGTCGATGCGCTGACTGCCGGCGAGAAACACATCGAGCAGTTCACCGTGACCCTGAGCGATGGCTCGACCACCAAGGTCACCATCACCATCACCGGCACCGACGATGCCCCGGTTATCTCGGCCGACACCGGCGCGGTCACCGAGGGAGATCAAACCCCGGTCACCGGCACCCTGACGGCGAGCGACGCGGACAACCCGACCCTGACCTTTGTGGCGGGCAGCGAGGAGCGAGCCTTTGGTCGCTTCGAGGTGGGAACGGACGGCAAGTGGAGCTTCGTGCTGGCGAATAACGCCACCGTCGATGCGCTGACTGCCGGCGAGAAACACATCGAGCAGTTCACCGTGACCCTGAGCGATGGCTCGACCACCAAGGTCACCATCACCATCACCGGCACCGACGATGCCCCGGTTATCTCGGCCGACACCGGCGCGGTCACCGAGGGAGATCAAACCCCGGTGACCGGCACCCTGACGGCGAGCGACGCGGACAACCCGACCCTGACCTTTGTGGCGGGCAGCGAGGAGCGAGCCTTTGGTCGCTTCGAGGTGGGAACGGACGGCAAGTGGAGCTTCGTGCTGGCGAATAACGCCACCGTCGATGCGCTGACTGCCGGCGAGAAACACATCGAGCAGTTCACCGTGACCCTGAGCGATGGCTCGACCACCAAGGTCACCATCACCATCACCGGCACCGACGATGCCCCGGTTATCTCGGCCGACACCGGCGCGGTCACCGAGGGAGATCAAACCCCGGTCACCGGCACCCTGACGGCGAGCGACGCGGACAACCCGACCCTGACCTTTGTGGCGGGCAGCGAGGAGCGAGCCTTTGGTCGCTTCGAGGTGGGAACGGACGGCAAGTGGAGCTTCGTGCTGGCGAATAACGCCACCGTCGATGCGCTGACTGCCGGCGAGAAACACATCGAGCAGTTCACCGTGACCCTGAGCGATGGCTCGACCACCAAGGTCACCATCACCATCACCGGCACCGACGATGCCCCGGTTATCTCGGCCGACACCGGCGCGGTCACCGAGGGAGATCAAACCCCGGTCACCGGCACCCTGACGGCGAGCGACGCGGACAACCCGACCCTGACCTTTGTGGCGGGCAGCGAGGAGCGAGCCTTTGGTCGCTTCGAGGTGGGAACGGACGGCAAGTGGAGTTTCGTGCTGGCGAATAACGCCACCGTCGATGCGCTGACTGCCGGCGAGAAACACATCGAGCAGTTCACCGTGACCCTGAGCGATGGCTCGACCACCAAGGTCACCATCACCATCACCGGCACCGACGATGCCCCGGTTATCTCGGCCGACACCGGCGCGGTCACCGAGGGAGATCAAACCCCGGTCACCGGCACCCTGACGGCGAGCGACGCGGACAACCCGACCCTGACCTTTGTGGCGGGCAGCGAGGAGCGAGCCTTTGGTCGCTTCGAGGTGGGAACGGACGGCAAGTGGAGTTTCGTGCTGGCGAATAACGCCACCGTCGATGCGCTGACTGCCGGCGAGAAACACATCGAGCAGTTCACCGTGACCCTGAGCGATGGCTCGACCACCAAGGTCACCATCACCATCACCGGCACCGACGATGCCCCGGTTATCTCGGCCGACACCGGCGCGGTCACCGAGGGAGATCAAACCCCGGTGACCGGCACCCTGACGGCGAGCGACGCGGACAACCCGACCCTGACCTTTGTGGCGGGCAGCGAGGAGCGAGCCTTTGGTCGCTTCGAGGTGGGAACGGACGGCAAGTGGAGCTTCGTGCTGGCGAATAACGCCACCGTCGATGCGCTGACTGCCGGCGAGAAACACATCGAGCAGTTCACCGTGACCCTGAGCGATGGCTCGACCACCAAGGTCACCATCACCATCACCGGCACCGACGATGCCCCGGTTATCTCGGCCGACACCGGCGCGGTCACCGAGGGAGATCAAACCCCGGTCACCGGCACCCTGACGGCGAGCGACGCGGACAACCCGACCCTGACCTTTGTGGCGGGCAGCGAGGAGCGAGCCTTTGGTCGCTTCGAGGTGGGAACGGACGGCAAGTGGAGCTTCGTGCTGGCGAATAACGCCACCGTCGATGCGCTGACTGCCGGCGAGAAACACATCGAGCAGTTCACCGTGACCCTGAGCGATGGCTCGACCACCAAGGTCACCATCACCATCACCGGCACCGACGATGCCCCGGTTATCTCGGCCGACACCGGCGCGGTCACCGAGGGAGATCAAACCCCGGTCACCGGCACCCTGACGGCGAGCGACGCGGACAACCCGACCCTGACCTTTGTGGCGGGCAGCGAGGAGCGAGCCTTTGGTCGCTTCGAGGTGGGAACGGACGGCAAGTGGAGCTTCGTGCTGGCGAATAACGCCACCGTCGATGCGCTGACTGCCGGCGAGAAACACATCGAGCAGTTCACCGTGACCCTGAGCGATGGCTCGACCACCAAGGTCACCATCACCATCACCGGCACCGACGATGCCCCGGTTATCTCGGCCGACACCGGCGCGGTCACCGAGGGAGATCAAACCCCGGTCACCGGCACCCTGACGGCGAGCGACGCGGACAACCCGACCCTGACCTTTGTGGCGGGCAGCGAGGAGCGAGCCTTTGGTCGCTTCGAGGTGGGAACGGACGGCAAGTGGAGCTTCGTGCTGGCGAATAACGCCACCGTCGATGCGCTGACTGCCGGCGAGAAACACATCGAGCAGTTCACCGTGACCCTGAGCGATGGCTCGACCACCAAGGTCACCATCACCATCACCGGCACCGACGATGCCCCGGTTATCTCGGCCGACACCGGCGCGGTCACCGAGGGAGATCAAACCCCGGTGACCGGCACCCTGACGGCGAGCGACGCGGACAACCCGACCCTGACCTTTGTGGCGGGCAGCGAGGAGCGAGCCTTTGGTCGCTTCGAGGTGGGAACGGACGGCAAGTGGAGCTTCGTGCTGGCGAATAACGCCACCGTCGATGCGCTGACTGCCGGCGAGAAACACATCGAGCAGTTCACCGTGACCCTGAGCGATGGCTCGACCACCAAGGTCACCATCACCATCACCGGCACCGACGATGCCCCGGTTATCTCGGCCGACACCGGCGCGGTCACCGAGGGAGATCAAACCCCGGTCACCGGCACCCTGACGGCGAGCGACGCGGACAACCCGACCCTGACCTTTGTGGCGGGCAGCGAGGAGCGAGCCTTTGGTCGCTTCGAGGTGGGAACGGACGGCAAGTGGAGCTTCGTGCTGGCGAATAACGCCACCGTCGATGCGCTGACTGCCGGCGAGAAACACATCGAGCAGTTCACCGTGACCCTGAGCGATGGCTCGACCACCAAGGTCACCATCACCATCACCGGCACCGACGATGCCCCGGTTATCTCGGCCGACACCGGCGCGGTCACCGAGGGAGATCAAACCCCGGTCACCGGCACCCTGACGGCGAGCGACGCGGACAACCCGACCCTGACCTTTGTGGCGGGCAGCGAGGAGCGAGCCTTTGGTCGCTTCGAGGTGGGAACGGACGGCAAGTGGAGCTTCGTGCTGGCGAATAACGCCACCGTCGATGCGCTGACTGCCGGCGAGAAACACATCGAGCAGTTCACCGTGACCCTGAGCGATGGCTCGACCACCAAGGTCACCATCACCATCACCGGCACCGACGATGCCCCGGTTATCTCGGCCGACACCGGCGCGGTCACCGAGGGAGATCAAACCCCGGTGACCGGCACCCTGACGGCGAGCGACGCGGACAACCCGACCCTGACCTTTGTGGCGGGCAGCGAGGAGCGAGCCTTTGGTCGCTTCGAGGTGGGAACGGACGGCAAGTGGAGCTTCGTGCTGGCGAATAACGCCACCGTCGATGCGCTGACTGCCGGCGAGAAACACATCGAGCAGTTCACCGTGACCCTGAGCGATGGCTCGACCACCAAGGTCACCATCACCATCACCGGCACCGACGATGCCCCGGTTATCTCGGCCGACACCGGCGCGGTCACCGAGGGAGATCAAACCCCGGTGACCGGCACCCTGACGGCGAGCGACGCGGACAACCCGACCCTGACCTTTGTGGCGGGCAGCGAGGAGCGAGCCTTTGGTCGCTTCGAGGTGGGAACGGACGGCAAGTGGAGCTTCGTGCTGGCGAATAACGCCACCGTCGATGCGCTGACTGCCGGCGAGAAACACATCGAGCAGTTCACCGTGACCCTGAGCGATGGCTCGACCACCAAGGTCACCATCACCATCACCGGCACCGACGATGCCCCGGTTATCTCGGCCGACACCGGCGCGGTCACCGAGGGAGATCAAACCCCGGTCACCGGCACCCTGACGGCGAGCGACGCGGACAACCCGACCCTGACCTTTGTGGCGGGCAGCGAGGAGCGAGCCTTTGGTCGCTTCGAGGTGGGAACGGACGGCAAGTGGAGCTTCGTGCTGGCGAATAACGCCACCGTCGATGCGCTGACTGCCGGCGAGAAACACATCGAGCAGTTCACCGTGACCCTGAGCGATGGCTCGACCACCAAGGTCACCATCACCATCACCGGCACCGACGATGCCCCGGTTATCTCGGCCGACACCGGCGCGGTCACCGAGGGAGATCAAACCCCGGTCACCGGCACCCTGACGGCGAGCGACGCGGACAACCCGACCCTGACCTTTGTGGCGGGCAGCGAGGAGCGAGCCTTTGGTCGCTTCGAGGTGGGAACGGACGGCAAGTGGAGTTTCGTGCTGGCGAATAACGCCACCGTCGATGCGCTGACTGCCGGCGAGAAACACATCGAGCAGTTCACCGTGACCCTGAGCGATGGCTCGACCACCAAGGTCACCATCACCATCACCGGCACCGACGATGCCCCGGTTATCTCGGCCGACACCGGCGCGGTCACCGAGGGAGATCAAACCCCGGTCACCGGCACCCTGACGGCGAGCGACGCGGACAACCCGACCCTGACCTTTGTGGCGGGCAGCGAGGAGCGAGCCTTTGGTCGCTTCGAGGTGGGAACGGACGGCAAGTGGAGCTTCGTGCTGGCGAATAACGCCACCGTCGATGCGCTGACTGCCGGCGAGAAACACATCGAGCAGTTCACCGTGACCCTGAGCGATGGCTCGACCACCAAGGTCACCATCACCATCACCGGCACCGACGATGCCCCGGTTATCTCGGCCGACACCGGCGCGGTCACCGAGGGAGATCAAACCCCGGTCACCGGCACCCTGACGGCGAGCGACGCGGACAACCCGACCCTGACCTTTGTGGCGGGCAGCGAGGAGCGAGCCTTTGGTCGCTTCGAGGTGGGAACGGACGGCAAGTGGAGCTTCGTGCTGGCGAATAACGCCACCGTCGATGCGCTGACTGCCGGCGAGAAACACATCGAGCAGTTCACCGTGACCCTGAGCGATGGCTCGACCACCAAGGTCACCATCACCATCACCGGCACCGACGATGCCCCGGTTATCTCGGCCGACACCGGCGCGGTCACCGAGGGAGATCAAACCCCGGTCACCGGCACCCTGACGGCGAGCGACGCGGACAACCCGACCCTGACCTTTGTGGCGGGCAGCGAGGAGCGAGCCTTTGGTCGCTTCGAGGTGGGAACGGACGGCAAGTGGAGCTTCGTGCTGGCGAATAACGCCACCGTCGATGCGCTGACTGCCGGCGAGAAACACATCGAGCAGTTCACCGTGACCCTGAGCGATGGCTCGACCACCAAGGTCACCATCACCATCACCGGCACCGACGATGCCCCGGTTATCTCGGCCGACACCGGCGCGGTCACCGAGGGAGATCAAACCCCGGTCACCGGCACCCTGACGGCGAGCGACGCGGACAACCCGACCCTGACCTTTGTGGCGGGCAGCGAGGAGCGAGCCTTTGGTCGCTTCGAGGTGGGAACGGACGGCAAGTGGAGCTTCGTGCTGGCGAATAACGCCACCGTCGATGCGCTGACTGCCGGCGAGAAACACATCGAGCAGTTCACCGTGACCCTGAGCGATGGCTCGACCACCAAGGTCACCATCACCATCACCGGCACCGACGATGCCCCGGTTATCTCGGCCGACACCGGCGCGGTCACCGAGGGAGATCAAACCCCGGTCACCGGCACCCTGACGGCGAGCGACGCGGACAACCCGACCCTGACCTTTGTGGCGGGCAGCGAGGAGCGAGCCTTTGGTCGCTTCGAGGTGGGAACGGACGGCAAGTGGAGCTTCGTGCTGGCGAATAACGCCACCGTCGATGCGCTGACTGCCGGCGAGAAACACATCGAGCAGTTCACCGTGACCCTGAGCGATGGCTCGACCACCAAGGTCACCATCACCATCACCGGCACCGACGATGCCCCGGTTATCTCGGCCGACACCGGCGCGGTCACCGAGGGAGATCAAACCCCGGTCACCGGCACCCTGACGGCGAGCGACGCGGACAACCCGACCCTGACCTTTGTGGCGGGCAGCGAGGAGCGAGCCTTTGGTCGCTTCGAGGTGGGAACGGACGGCAAGTGGAGTTTCGTGCTGGCGAATAACGCCACCGTCGATGCGCTGACTGCCGGCGAGAAACACATCGAGCAGTTCACCGTGACCCTGAGCGATGGCTCGACCACCAAGGTCACCATCACCATCACCGGCACCGACGATGCCCCGGTTATCTCGGCCGACACCGGCGCGGTCACCGAGGGAGATCAAACCCCGGTGACCGGCACCCTGACGGCGAGCGACGCGGACAACCCGACCCTGACCTTTGTGGCGGGCAGCGAGGAGCGAGCCTTTGGTCGCTTCGAGGTGGGAACGGACGGCAAGTGGAGTTTCGTGCTGGCGAATAACGCCACCGTCGATGCGCTGACTGCCGGCGAGAAACACATCGAGCAGTTCACCGTGACCCTGAGCGATGGCTCGACCACCAAGG
40883 NZ_CP008739.1 Pseudomonas-aeruginosa-VRFPA04 Bacteria 3206560-3221987 15428 70 246 GGCAACCCGA GGCAACCCGATAGGGCAGGTCACCGCCGACGGCAGCGGCAACTGGAGCTTCACGCCGGGCACGCCGCTGGCCAACGGTACGGTGATCGTCGCCACGGCCACCGACCCGACCGGCAATACCGGCCCGCAGGCCGCCACCACGGTGGACGCGGTGGCGCCGCCGGCGCCGGTGATCGATCCGAGCAACGGCACGACCATCAGCGGCACCGCGGAGGCCGGGGCCAAGGTGATCCTCACCGACGGCAACGGCAACCCGATCGGCGAAACCACCGCCGACGGCAGCGGCAACTGGACCTTCACGCCCGCCACGCCGCTGGCCAACGGCACGGTGGTCAACGCCGTGGCCCAGGACCCTGCGGGCAATACCGGCCCGCAGGGCAGCACTACCGTGGACGCGGTGGCGCCGAACACGCCTGTGGTCAATCCGAGCAACGGCAACCTGCTCAACGGTACCGCCGAGCCGGGCAGCACCGTGACCTTGACCGACGGCAACGGCAACCCGATCGGCCAGACCACCGCCGATGGCAGCGGCAACTGGAGCTTCACGCCCGGCTCGCAACTGCCCAACGGCACCGTGGTCAACGTGACCGCGAGCGACGCCGCCGGCAATACCAGCCTTCCCGCTACCACGACGGTGGATTCCTCGCTGCCGTCGATCCCGCAGGTGGATCCGAGCAACGGTTCGGTGATCAGCGGCACCGCGGACGCCGGCAACACCATCATCATCACCGATGGCAACGGCAACCCGATTGGCCAGGTCACCGCCGACGGCAGCGGCAACTGGTCCTTCACTCCAGGCATCCCGCTGCCGGATGGCACGGTGGTCAACGTGGTGGCGCGCAGCCCAAGCAATGTCGACAGTGCGCCGGCGGTGATCACGGTGGATGGCGTGGCCCCGGCCGCGCCGGTGATCGACCCGAGCAACGGCAGCGTGATCGCCGGTACCGCGGAAGCCGGTGCGACGGTGATCCTCACCGATGGCGGCGGCAACCCGATCGGCCAGGCCACTGCCGATGGCAGCGGCAACTGGAGCTTCACCCCGGGCACACCGCTGGCCAACGGCTCGGTGGTCAATGCGGTGGCCCAGGACGCCGCCGGCAACACCAGCGGCCCGGCCAGCACCACGGTGGACTCGGTAGCCCCGGCCACCCCGGTGCTCGATCCGAGCAACGGTACGGTGATCAGCGGTACCGCCGAAGCCGGCGCCACGGTGATCCTCACCGATGGCGGCGGCAACCCGATAGGGCAGGCCACCGCCGATGGCAGCGGCAACTGGAGCTTCACTCCGGGCACACCGCTGACCAACGGCACGGTGATCAACGCGGTGGCCCAGGACGCCGCCGGCAACACCAGCGGTCCGGTCAGCACCACGGTGGACGCGGTGGCTCCGGCCACTCCGGTGATCGACCCGAGCAATGGTGTCGAACTCAGCGGCACCGCCGAACCCGGCGTCCGGGTGATCCTCACCGATGGCAATGGCAACCCGATCGGCCAGACCCTCGCCGACGGTAGCGGCAACTGGAGTTTCACGCCGGGCACGCCGCTGGCCAACGGCACGGTGGTCAACGCCGTGGCCCAGGACCCGGCCGGCAATACCAGCGGCCCGGCCAGCACCACGGTGGACACGGTGGCTCCGGCCACGCCGGTGATCAATGCCAGCAACGGCAGCGTGATCACCGGGACCGCCGAGGTCGGCGCCAAGGTGATCCTCACCGATGGCAACGGCAACCCGATCGGCCAGACCACCGCCGATGGCAGCGGCAACTGGAGCTTCACGCCCGGCTCGCAACTGCCCAACGGCACCGTGGTCAACGTGACCGCGAGCGACGCCGCCGGCAATACCAGCCTTCCCGCTACCACGACGGTGGATTCCTCGCTGCCGTCGATCCCGCAGGTGGATCCGAGCAACGGTTCGGTGATCAGCGGCACCGCGGACGCCGGCAACACCATCATCATCACCGATGGCAACGGCAACCCGATTGGCCAGGTCACCGCCGACGGCAGCGGCAACTGGTCCTTCACTCCAGGCATCCCGCTGCCGGATGGCACGGTGGTCAACGTGGTGGCGCGCAGCCCAAGCAATGTCGACAGTGCGCCGGCGGTGATCACGGTGGATGGCGTGGCCCCGGCCGCGCCGGTGATCGACCCGAGCAACGGCAGCGTGATCGCCGGTACCGCGGAAGCCGGTGCGACGGTGATCCTCACCGATGGCGGCGGCAACCCGATCGGCCAGGCCACTGCCGATGGCAGCGGCAACTGGAGCTTCACCCCGGGCACACCGCTGGCCAACGGCTCGGTGGTCAATGCGGTGGCCCAGGACGCCGCCGGCAACACCAGCGGCCCGGCCAGCACCACGGTGGACTCGGTAGCCCCGGCCACCCCGGTGCTCGATCCGAGCAACGGTACGGTGATCAGCGGTACCGCCGAAGCCGGCGCCACGGTGATCCTCACCGATGGCGGCGGCAACCCGATAGGGCAGGCCACCGCCGATGGCAGCGGCAACTGGAGCTTCACTCCGGGCACACCGCTGACCAACGGCACGGTGATCAACGCGGTGGCCCAGGACGCCGCCGGCAACACCAGCGGTCCGGTCAGCACCACGGTGGACGCGGTGGCTCCGGCCACTCCGGTGATCGACCCGAGCAATGGTGTCGAACTCAGCGGCACCGCCGAACCCGGCGTCCGGGTGATCCTCACCGATGGCAATGGCAACCCGATCGGCCAGACCCTCGCCGACGGTAGCGGCAACTGGAGTTTCACGCCGGGCACGCCGCTGGCCAACGGCACGGTGGTCAACGCCGTGGCCCAGGACCCGGCCGGCAATACCAGCGGCCCGGCCAGCACCACGGTGGACACGGTGGCTCCGGCCACGCCGGTGATCAATGCCAGCAACGGCAGCGTGATCACCGGGACCGCCGAGGTCGGCGCCAAGGTGATCCTCACCGATGGCAACGGCAATCCGATCGCCGAGGTCACCGCCGACGGCAGCGGCAACTGGACCTACACCCCGTCCACGCCGATCGCCAACGGTACTGTGGTCAACGTGGTGGCCGAGGACGCCGCCGGTAACAGCAGCCCGCCGGCGACGGTGACCGTCGATTCCAGCGCGCCGCCGGCGCCGGTGATCAACCCGAGCAATGGCGTCGTCATCAGCGGCACCGCCGAGGCCGGTGCCACCGTGACCCTCACCGATGCCGGCGGCAACCCGATAGGGCAGGTCACCGCCGACGGCAGCGGCAACTGGAGCTTCACGCCGGGCACGCCGCTGGCCAACGGTACGGTGATCGTCGCCACGGCCACCGACCCGACCGGCAATACCGGCCCGCAGGCCGCCACCACGGTGGACGCGGTGGCGCCGCCGGCGCCGGTGATCGATCCGAGCAACGGCACGACCATCAGCGGCACCGCGGAGGCCGGGGCCAAGGTGATCCTCACCGACGGCAACGGCAACCCGATCGGCGAAACCACCGCCGACGGCAGCGGCAACTGGACCTTCACGCCCGCCACGCCGCTGGCCAACGGCACGGTGGTCAACGCCGTGGCCCAGGACCCTGCGGGCAATACCGGCCCGCAGGGCAGCACTACCGTGGACGCGGTGGCGCCGAACACGCCTGTGGTCAATCCGAGCAACGGCAACCTGCTCAACGGTACCGCCGAGCCGGGCAGCACCGTGACCTTGACCGACGGCAACGGCAACCCGATCGGCCAGACCACCGCCGATGGCAGCGGCAACTGGAGCTTCACGCCCGGCTCGCAACTGCCCAACGGCACCGTGGTCAACGTGACCGCGAGCGACGCCGCCGGCAATACCAGCCTTCCCGCTACCACGACGGTGGATTCCTCGCTGCCGTCGATCCCGCAGGTGGATCCGAGCAACGGTTCGGTGATCAGCGGCACCGCGGACGCCGGCAACACCATCATCATCACCGATGGCAACGGCAACCCGATTGGCCAGGTCACCGCCGACGGCAGCGGCAACTGGTCCTTCACTCCAGGCATCCCGCTGCCGGATGGCACGGTGGTCAACGTGGTGGCGCGCAGCCCAAGCAATGTCGACAGTGCGCCGGCGGTGATCACGGTGGATGGCGTGGCCCCGGCCGCGCCGGTGATCGACCCGAGCAACGGCAGCGTGATCGCCGGTACCGCGGAAGCCGGTGCGACGGTGATCCTCACCGATGGCGGCGGCAACCCGATCGGCCAGGCCACTGCCGATGGCAGCGGCAACTGGAGCTTCACCCCGGGCACACCGCTGGCCAACGGCTCGGTGGTCAATGCGGTGGCCCAGGACGCCGCCGGCAACACCAGCGGCCCGGCCAGCACCACGGTGGACTCGGTAGCCCCGGCCACCCCGGTGCTCGATCCGAGCAACGGTACGGTGATCAGCGGTACCGCCGAAGCCGGCGCCACGGTGATCCTCACCGATGGCGGCGGCAACCCGATAGGGCAGGCCACCGCCGATGGCAGCGGCAACTGGAGCTTCACTCCGGGCACACCGCTGACCAACGGCACGGTGATCAACGCGGTGGCCCAGGACGCCGCCGGCAACACCAGCGGTCCGGTCAGCACCACGGTGGACGCGGTGGCTCCGGCCACTCCGGTGATCGACCCGAGCAATGGTGTCGAACTCAGCGGCACCGCCGAACCCGGCGTCCGGGTGATCCTCACCGATGGCAATGGCAACCCGATCGGCCAGACCCTCGCCGACGGTAGCGGCAACTGGAGTTTCACGCCGGGCACGCCGCTGGCCAACGGCACGGTGGTCAACGCCGTGGCCCAGGACCCGGCCGGCAATACCAGCGGCCCGGCCAGCACCACGGTGGACACGGTGGCTCCGGCCACGCCGGTGATCAATGCCAGCAACGGCAGCGTGATCACCGGGACCGCCGAGGTCGGCGCCAAGGTGATCCTCACCGATGGCAACGGCAACCCGATCGGCGAAACCACCGCCGACGGCAGCGGCAACTGGACCTTCACGCCCGCCACGCCGCTGGCCAACGGCACGGTGGTCAACGCCGTGGCCCAGGACCCTGCGGGCAATACCGGCCCGCAGGGCAGCACTACCGTGGACGCGGTGGCGCCGAACACGCCTGTGGTCAATCCGAGCAACGGCAACCTGCTCAACGGTACCGCCGAGCCGGGCAGCACCGTGACCTTGACCGACGGCAACGGCAACCCGATCGGCCAGACCACCGCCGATGGCAGCGGCAACTGGAGCTTCACGCCCGGCTCGCAACTGCCCAACGGCACCGTGGTCAACGTGACCGCGAGCGACGCCGCCGGCAATACCAGCCTTCCCGCTACCACGACGGTGGATTCCTCGCTGCCGTCGATCCCGCAGGTGGATCCGAGCAACGGTTCGGTGATCAGCGGCACCGCGGACGCCGGCAACACCATCATCATCACCGATGGCAACGGCAACCCGATTGGCCAGGTCACCGCCGACGGCAGCGGCAACTGGTCCTTCACTCCAGGCATCCCGCTGCCGGATGGCACGGTGGTCAACGTGGTGGCGCGCAGCCCAAGCAATGTCGACAGTGCGCCGGCGGTGATCACGGTGGATGGCGTGGCCCCGGCCGCGCCGGTGATCGACCCGAGCAACGGCAGCGTGATCGCCGGTACCGCGGAAGCCGGTGCGACGGTGATCCTCACCGATGGCGGCGGCAACCCGATCGGCCAGGCCACTGCCGATGGCAGCGGCAACTGGAGCTTCACCCCGGGCACACCGCTGGCCAACGGCTCGGTGGTCAATGCGGTGGCCCAGGACGCCGCCGGCAACACCAGCGGCCCGGCCAGCACCACGGTGGACTCGGTAGCCCCGGCCACCCCGGTGCTCGATCCGAGCAACGGTACGGTGATCAGCGGTACCGCCGAAGCCGGCGCCACGGTGATCCTCACCGATGGCGGCGGCAACCCGATAGGGCAGGCCACCGCCGATGGCAGCGGCAACTGGAGCTTCACTCCGGGCACACCGCTGACCAACGGCACGGTGATCAACGCGGTGGCCCAGGACGCCGCCGGCAACACCAGCGGTCCGGTCAGCACCACGGTGGACGCGGTGGCTCCGGCCACTCCGGTGATCGACCCGAGCAATGGTGTCGAACTCAGCGGCACCGCCGAACCCGGCGTCCGGGTGATCCTCACCGATGGCAATGGCAACCCGATCGGCCAGACCCTCGCCGACGGTAGCGGCAACTGGAGTTTCACGCCGGGCACGCCGCTGGCCAACGGCACGGTGGTCAACGCCGTGGCCCAGGACCCGGCCGGCAATACCAGCGGCCCGGCCAGCACCACGGTGGACACGGTGGCTCCGGCCACGCCGGTGATCAATGCCAGCAACGGCAGCGTGATCACCGGGACCGCCGAGGTCGGCGCCAAGGTGATCCTCACCGATGGCAACGGCAACCCGATAGGGCAGGTCACCGCCGACGGCAGCGGCAACTGGAGCTTCACGCCGGGCACGCCGCTGGCCAACGGTACGGTGATCGTCGCCACGGCCACCGACCCGACCGGCAATACCGGCCCGCAGGCCGCCACCACGGTGGACGCGGTGGCGCCGCCGGCGCCGGTGATCGATCCGAGCAACGGCACGACCATCAGCGGCACCGCGGAGGCCGGGGCCAAGGTGATCCTCACCGACGGCAACGGCAACCCGATCGGCGAAACCACCGCCGACGGCAGCGGCAACTGGACCTTCACGCCCGCCACGCCGCTGGCCAACGGCACGGTGGTCAACGCCGTGGCCCAGGACCCTGCGGGCAATACCGGCCCGCAGGGCAGCACTACCGTGGACGCGGTGGCGCCGAACACGCCTGTGGTCAATCCGAGCAACGGCAACCTGCTCAACGGTACCGCCGAGCCGGGCAGCACCGTGACCTTGACCGACGGCAACGGCAACCCGATCGGCCAGACCACCGCCGATGGCAGCGGCAACTGGAGCTTCACGCCCGGCTCGCAACTGCCCAACGGCACCGTGGTCAACGTGACCGCGAGCGACGCCGCCGGCAATACCAGCCTTCCCGCTACCACGACGGTGGATTCCTCGCTGCCGTCGATCCCGCAGGTGGATCCGAGCAACGGTTCGGTGATCAGCGGCACCGCGGACGCCGGCAACACCATCATCATCACCGATGGCAACGGCAACCCGATTGGCCAGGTCACCGCCGACGGCAGCGGCAACTGGTCCTTCACTCCAGGCATCCCGCTGCCGGATGGCACGGTGGTCAACGTGGTGGCGCGCAGCCCAAGCAATGTCGACAGTGCGCCGGCGGTGATCACGGTGGATGGCGTGGCCCCGGCCGCGCCGGTGATCGACCCGAGCAACGGCAGCGTGATCGCCGGTACCGCGGAAGCCGGTGCGACGGTGATCCTCACCGATGGCGGCGGCAACCCGATCGGCCAGGCCACTGCCGATGGCAGCGGCAACTGGAGCTTCACCCCGGGCACACCGCTGGCCAACGGCTCGGTGGTCAATGCGGTGGCCCAGGACGCCGCCGGCAACACCAGCGGCCCGGCCAGCACCACGGTGGACTCGGTAGCCCCGGCCACCCCGGTGCTCGATCCGAGCAACGGTACGGTGATCAGCGGTACCGCCGAAGCCGGCGCCACGGTGATCCTCACCGATGGCGGCGGCAACCCGATAGGGCAGGCCACCGCCGATGGCAGCGGCAACTGGAGCTTCACTCCGGGCACACCGCTGACCAACGGCACGGTGATCAACGCGGTGGCCCAGGACGCCGCCGGCAACACCAGCGGTCCGGTCAGCACCACGGTGGACGCGGTGGCTCCGGCCACTCCGGTGATCGACCCGAGCAATGGTGTCGAACTCAGCGGCACCGCCGAACCCGGCGTCCGGGTGATCCTCACCGATGGCAATGGCAACCCGATCGGCCAGACCCTCGCCGACGGTAGCGGCAACTGGAGTTTCACGCCGGGCACGCCGCTGGCCAACGGCACGGTGGTCAACGCCGTGGCCCAGGACCCGGCCGGCAATACCAGCGGCCCGGCCAGCACCACGGTGGACACGGTGGCTCCGGCCACGCCGGTGATCAATGCCAGCAACGGCAGCGTGATCACCGGGACCGCCGAGGTCGGCGCCAAGGTGATCCTCACCGATGGCAACGGCAACCCGATTGGCCAGGTCACCGCCGACGGCAGCGGCAACTGGTCCTTCACTCCAGGCATCCCGCTGCCGGATGGCACGGTGGTCAACGTGGTGGCGCGCAGCCCAAGCAATGTCGACAGTGCGCCGGCGGTGATCACGGTGGATGGCGTGGCCCCGGCCGCGCCGGTGATCGACCCGAGCAACGGCAGCGTGATCGCCGGTACCGCGGAAGCCGGTGCGACGGTGATCCTCACCGATGGCGGCGGCAACCCGATCGGCCAGGCCACTGCCGATGGCAGCGGCAACTGGAGCTTCACCCCGGGCACACCGCTGGCCAACGGCTCGGTGGTCAATGCGGTGGCCCAGGACGCCGCCGGCAACACCAGCGGCCCGGCCAGCACCACGGTGGACTCGGTAGCCCCGGCCACCCCGGTGCTCGATCCGAGCAACGGTACGGTGATCAGCGGTACCGCCGAAGCCGGCGCCACGGTGATCCTCACCGATGGCGGCGGCAACCCGATAGGGCAGGCCACCGCCGATGGCAGCGGCAACTGGAGCTTCACTCCGGGCACACCGCTGACCAACGGCACGGTGATCAACGCGGTGGCCCAGGACGCCGCCGGCAACACCAGCGGTCCGGTCAGCACCACGGTGGACGCGGTGGCTCCGGCCACTCCGGTGATCGACCCGAGCAATGGTGTCGAACTCAGCGGCACCGCCGAACCCGGCGTCCGGGTGATCCTCACCGATGGCAATGGCAACCCGATCGGCCAGACCCTCGCCGACGGTAGCGGCAACTGGAGTTTCACGCCGGGCACGCCGCTGGCCAACGGCACGGTGGTCAACGCCGTGGCCCAGGACCCGGCCGGCAATACCAGCGGCCCGGCCAGCACCACGGTGGACACGGTGGCTCCGGCCACGCCGGTGATCAATGCCAGCAACGGCAGCGTGATCACCGGGACCGCCGAGGTCGGCGCCAAGGTGATCCTCACCGATGGCAACGGCAATCCGATCGCCGAGGTCACCGCCGACGGCAGCGGCAACTGGACCTACACCCCGTCCACGCCGATCGCCAACGGTACTGTGGTCAACGTGGTGGCCGAGGACGCCGCCGGTAACAGCAGCCCGCCGGCGACGGTGACCGTCGATTCCAGCGCGCCGCCGGCGCCGGTGATCAACCCGAGCAATGGCGTCGTCATCAGCGGCACCGCCGAGGCCGGTGCCACCGTGACCCTCACCGATGCCGGCGGCAACCCGATAGGGCAGGTCACCGCCGACGGCAGCGGCAACTGGAGCTTCACGCCGGGCACGCCGCTGGCCAACGGTACGGTGATCGTCGCCACGGCCACCGACCCGACCGGCAATACCGGCCCGCAGGCCGCCACCACGGTGGACGCGGTGGCGCCGCCGGCGCCGGTGATCGATCCGAGCAACGGCACGACCATCAGCGGCACCGCGGAGGCCGGGGCCAAGGTGATCCTCACCGACGGCAACGGCAACCCGATCGGCGAAACCACCGCCGACGGCAGCGGCAACTGGACCTTCACGCCCGCCACGCCGCTGGCCAACGGCACGGTGGTCAACGCCGTGGCCCAGGACCCTGCGGGCAATACCGGCCCGCAGGGCAGCACTACCGTGGACGCGGTGGCGCCGAACACGCCTGTGGTCAATCCGAGCAACGGCAACCTGCTCAACGGTACCGCCGAGCCGGGCAGCACCGTGACCTTGACCGACGGCAACGGCAACCCGATCGGCCAGACCACCGCCGATGGCAGCGGCAACTGGAGCTTCACGCCCGGCTCGCAACTGCCCAACGGCACCGTGGTCAACGTGACCGCGAGCGACGCCGCCGGCAATACCAGCCTTCCCGCTACCACGACGGTGGATTCCTCGCTGCCGTCGATCCCGCAGGTGGATCCGAGCAACGGTTCGGTGATCAGCGGCACCGCGGACGCCGGCAACACCATCATCATCACCGATGGCAACGGCAACCCGATTGGCCAGGTCACCGCCGACGGCAGCGGCAACTGGTCCTTCACTCCAGGCATCCCGCTGCCGGATGGCACGGTGGTCAACGTGGTGGCGCGCAGCCCAAGCAATGTCGACAGTGCGCCGGCGGTGATCACGGTGGATGGCGTGGCCCCGGCCGCGCCGGTGATCGACCCGAGCAACGGCAGCGTGATCGCCGGTACCGCGGAAGCCGGTGCGACGGTGATCCTCACCGATGGCGGCGGCAACCCGATCGGCCAGGCCACTGCCGATGGCAGCGGCAACTGGAGCTTCACCCCGGGCACACCGCTGGCCAACGGCTCGGTGGTCAATGCGGTGGCCCAGGACGCCGCCGGCAACACCAGCGGCCCGGCCAGCACCACGGTGGACTCGGTAGCCCCGGCCACCCCGGTGCTCGATCCGAGCAACGGTACGGTGATCAGCGGTACCGCCGAAGCCGGCGCCACGGTGATCCTCACCGATGGCGGCGGCAACCCGATAGGGCAGGCCACCGCCGATGGCAGCGGCAACTGGAGCTTCACTCCGGGCACACCGCTGACCAACGGCACGGTGATCAACGCGGTGGCCCAGGACGCCGCCGGCAACACCAGCGGTCCGGTCAGCACCACGGTGGACGCGGTGGCTCCGGCCACTCCGGTGATCGACCCGAGCAATGGTGTCGAACTCAGCGGCACCGCCGAACCCGGCGTCCGGGTGATCCTCACCGATGGCAATGGCAACCCGATCGGCCAGACCCTCGCCGACGGTAGCGGCAACTGGAGTTTCACGCCGGGCACGCCGCTGGCCAACGGCACGGTGGTCAACGCCGTGGCCCAGGACCCGGCCGGCAATACCAGCGGCCCGGCCAGCACCACGGTGGACACGGTGGCTCCGGCCACGCCGGTGATCAATGCCAGCAACGGCAGCGTGATCACCGGGACCGCCGAGGTCGGCGCCAAGGTGATCCTCACCGATGGCAAC
47251 NZ_CP009488.1 Burkholderia-ubonensis-MSMB22-chromosome-I Bacteria 2450805-2466180 15376 61 252 TTCACGCTCG TTCACGCTCGATACGTCGGCTGCCGCGCCCGGTGTCGCGCTCGCCGTCGATTCGGGCAGCAGCGCTTCCGACCACGTCACCAATGTCGGCACGCTGAATGTAACCGGCATCGAAACCGGCGCCACCGTGCAGTACAGCGTCGACAACGGTGCGCACTGGAGCACCAGCTTCAGTGCGGTCGAAGGCGTGAACAATGTGCAGGTCCGGCAGATCGATGTCGCCGGCAATGCGTCGTCGGCGACCTCGTTCAGCTTCACGCTCGATACGTCGGCTGCCGCGCCCGGCGTCGCGCTGACCACCGATTCGGGCAGCAGCGCTGTTGACCACATCACCAACGTCGGCACGCTGAACCTCACCGGCATCGAAACCGGCGCCACCGTGCAGTACAGCGTCGACAACGGCGCCCATTGGAACACCAGCTTCAGCGCGGTCGAAGGCGTGAACAACGTGCAGGTCCGGCAGATCGACGTCGCCGGCAACACGTCGTCGGCGACCTCGTTCAGCTTCACGCTCGACACGTCGGCTGCCGCCCCCGGTGTCGCGCTCGCCGTCGATTCCGGCAGCAGTGCTGTTGATCATGTCACCAACGTCGGCACGCTGAATGTGACCGGAGTCGAGAGTGGCGCCACCGTGCAGTACAGCGTCGACAATGGCGCCCATTGGAACACCAGCTTCAGCGCGGTCGAAGGCGTGAACAACGTGCAGGTCCGGCAGATCGACGTCGCCGGCAACACGTCGTCCGCAACCTCGTTCAGCTTCACGCTCGATACGTCGGCCGCCGCCCCCGGTGTCGCGCTGACCACCGATTCCGGCAGCAACGCGTCCGACCACGTTACCAACGTCGGTACGTTGAATGTGACCGGAGTCGAGAGTGGCGCGACCGTGCAGTACAGCGTCGACAGCGGTGCGCACTGGAACACCAGCTTCAGCGCGGTCGAAGGCGTGAACGATGTGCAGGTCCGGCAGATCGATGTCGCGGGCAACACGTCGTCCGCAACCTCGTTCAGCTTCACGCTCGATACGTCGGCCGCCGCCCCCGGTGTCGCGCTGACCACCGATTCGGGCAGCAACGCGTCCGACCACATTACCAACGTCGGCACGCTGAACCTCACCGGCGTCGAAGCCGGCGCGACCGTCGAATACTCGACCGACGGCGGCCATACGTGGAGCGCCAGTTTCAGCGCCGTCGAAGGCCTGAACGACATCCAGGTCCGCCAGATCGACGTCGCGGGCAACACGTCGTCGGCGACCTCGTTCAGCTTCACGCTCGATACCTCGGCCGCCGCCCCCGGCGTCGCCCTGACCACCGATTCGGGCAGCAGCGCCTCCGATCACATCACCAACGTCGGTACGTTGAATGTGACCGGCGTCGAGAGTGGCGCGACCGTGCAGTACAGCGTCGACAACGGCGCGCACTGGAGCACCAGCTTCAGTGCGGTCGAAGGCGTGAACAACGTGCAGGTCCGGCAGATCGACGTCGCCGGCAACACGTCGTCGGCGACCTCGTTCAGCTTCACGCTCGACACGTCGGCTGCCGCCCCCGGCGTCGCGCTGACCACCGATTCCGGCAGCAGCGCGTCCGACCACGTCACCAACGTCGGTACGTTGAACCTGTCCGGCATCGAAACCGGCGCCACCGTGCAGTACAGCGTCGACAACGGCGCCCATTGGAGCACCAGCTTCGGTACCCTAGAAGGCGTGAACAACGTGCAGGTCCGCCAGATCGACGTCGCGGGCAACACGTCATCGGCGACCTCGTTCAGCTTCACGCTCGATACGTCGGCCGCCGCCCCCGGTGTCGCGCTGACCACCGATTCGGGCAGCAGCACCTCCGACCACATCACCAACGTCGGCACGCTGAATGTGACCGGAGTCGAGAGTGGCGCCACCGTGCAGTACAGCGTCGACAACGGCGCCCATTGGAGCACCAGCTTCAGCGCGGTCGAAGGCGTGAACAACGTGCAGGTCCGGCAGATCGACGTCGCCGGCAACACGTCGTCGGCGACCTCGTTCAGCTTCACGCTCGACACGTCGGCCGCCGCCCCCGGCGTCGCGCTGACCACCGACTCCGGCAGCAGCGCGTCCGACCACGTCACCAACGTCGGCACGCTGAACCTCACCAGCATCGAAACCGGCGCCACCGTGCAGTACAGCGTCGACAACGGTGCCCATTGGAGCACCAGCTTCGGTGCCCTAGAAGGCGTGAACAACGTGCAGGTCCGCCAGATCGACGTCGCGGGCAACACGTCGTCGGCGACCTCGTTCAGCTTCACGCTCGATACGTCGGCTGCCGCCCCCGGCGTCGCCCTGACCACCGATTCGGGCAGCAGCGCCTCCGATCACATCACCAACGTCGGTACGTTGAACCTGTCCGGCGTCGAAACCGGCGCCACTGTCGAATATTCGATCGACGGCGGCCATACGTGGAGCACCAGCTTCAGCGCCGTCGAAGGTCTGAACGATGTGCAGGTCCGGCAGACCGACATCGCCGGCAATACGTCCGACCCGACCTCGTTCAGCTTCACGCTCGACACGTCGGCTGCCGCCCCCGGCGTCGCGCTCGCCACCGACTCCGGCAGCAGCGCGTCCGACCACGTCACCAACGTCGGCACGTTGAACCTGTCCGGCGTCGAAACCGGCGCCACTGTCGAATACTCGACCGACGGCGGCCATACGTGGAGCACCAGCTTCAGCGCCGTCGAAGGTCTGAACGACGTGCAGGTCCGCCAGACCGATATCGCCGGCAACACGTCGTCGGCAACCTCGTTCAGCTTCACGCTCGATACGTCGGCTGCCGCGCCCGGCGTCGCGCTGACCACCGACTCCGGCAGCAGCGCGTCCGACCACGTCACCAACGTCGGCACGCTGAATGTGACCGGAGTCGAGAGTGGCGCGACCGTGCAGTACAGCGTCGACAATGGTGCCCATTGGAACACCAGCTTCAGCGCCGTCGAAGGTCTGAACGACGTGCAGGTCCGCCAGACCGATATCGCCGGCAACACGTCGTCGGCGACCTCGTTCAGCTTCACGCTCGATACGTCGGCTGCCGCCCCCGGCGTCGCGCTGACCACCGACTCCGGCAGCAGTGCTGTTGATCATGTCACCAACGTCGGCACGCTGAATGTGACCGGAGTCGAGAGTGGCGCGACCGTGCAGTACAGCGTCGACAATGGTGCCCATTGGAACACCAGCTTCAGCGCGGTCGAAGGCGTGAACAACGTGCAGGTCCGGCAGATCGACGTCGCCGGCAACACGTCGTCCGCAACGTCGTTCAGCTTCACGCTCGATACGTCGGCTGCCGCACCCGGTGTCGCGCTGACCACCGATTCGGGCAGCAGCGCCTCCGACCACGTCACCAACGTCGGCACGCTGAACCTCACCGGCATCGAAACCGGCGCCACCGTGCAGTACAGCGTCGACAATGGCGCCCATTGGAACACCAGCTTCAGCGCGGTCGAAGGCGTGAACGATGTGCAGGTCCGGCAGATCGATGTCGCGGGCAACACGTCGTCCGCAACCTCGTTCAGCTTCACGCTCGATACGTCGGCCGCCGCCCCCGGTGTCGCGCTGACCACCGATTCCGGCAGCAACGCGTCCGACCACATTACCAACGTCGGCACGCTGAACCTCACCGGCATCGAAACCGGCGCCACCGTGCAGTACAGCGTCGACAATGGCGCCCATTGGAACACCAGCTTCAGCGCGGTCGAAGGCGTGAACGATGTGCAGGTCCGGCAGATCGATGTCGCGGGCAACACGTCGTCCGCAACCTCGTTCAGCTTCACGCTCGATACGTCGGCCGCCGCCCCCGGTGTCGCGCTGACCACCGATTCCGGCAGCAACGCGTCCGACCACATTACCAACGTCGGCACGCTGAACCTCACCGGCGTCGAAGCCGGCGCGACCGTCGAATACTCGACCGACGGCGGCCATACGTGGAGCGCCAGTTTCAGCGCCGTCGAAGGCCTGAACGACATCCAGGTCCGGCAGATCGATGTCGCGGGCAACACGTCGTCGGCGACCTCGTTCGGCTTCACGCTCGATACCTCGGCCGCCGCCCCCGGTGTCGCGCTGACCACCGATTCGGGCAGCAGCGCGTCCGACCACGTCACCAACGTCGGCACGCTGAACCTGTCCGGTGTCGAAACCGGCGCCACTGTCGAATATTCGATCGATGGTGGTCACACCTGGAGCACCAGCTTCAGCGCCACCGAAGGCCTGAACGAAGTGCAAGTCCGGCAGACCGATATCGCCGGCAATACGTCCGACCCGACCTCGTTCAGCTTCACGCTCGACACGTCGGCCGCCGCCCCCGGCGTCGCCCTGACCACCGATTCCGGCAGCAGCGCGTCCGACCACGTCACCAACGTCGGCACGCTGAACCTGTCCGGTGTCGAAACCGGCGCCACTGTCGAATATTCGATCGATGGTGGTCACACCTGGAGCACCAGCTTCAGCGCCGTCGAAGGCCTGAACGATGTGCAGGTCCGTCAGACCGACATCGCCGGCAACACGTCGTCGGCGACCTCGTTCAGTTTCACGCTCGATACGTCGGCTGCCGCCCCTGGCGTCGCGCTGACCACCGACTCCGGCAGCAGCGCTGTTGATCACATCACCAACGTCGGCACGCTGAACCTGTCCGGGGTCGAAACCGGCGCCACTGTCGAATATTCGATCGACGGCGGCCATACGTGGAGCACCAGCTTCAGCGCGGTCGAAGGCGCGAACGACGTCCAGGTCCGTCAGACCGACATCGCCGGCAATACGTCGTCGGCGACGTCGTTCAGCTTCACGCTCGATACGTCGGCTGCCGCGCCCAGTGTCGCGCTGACCACCGACTCCGGCAGCAGCGCGTCCGATCACATCACCAACGTCGGTACGCTGAACCTCACCGGCATCGAAACCGGCGCGACCGTGCAGTACAGCGTCGATAACGGTGCACACTGGAGCACCAGCTTCAGTGCGGTCGAAGGCGCGAACGACGTCCAGGTCCGCCAGATCGACGTCGCCGGCAACACGTCAGCGGCGACCTCGTTCAGCTTCACGCTCGATACGTCGGCTGCCGCCCCTGGCGTCGCGCTGACCACCGATTCGGGCAGCAGCGCCTCCGACCACATCACCAACGTCGGTACGCTGAACCTCACCGGCGTCGAGAATGGCGCGACCGTGCAGTACAGCGTCGACAACGGTGCGCACTGGAGCACCAGCTTCAGCGCCGTCGAAGGCCTGAACGACGTGCAGGTCCGCCAGACCGACATCGCCGGCAATACGTCCGACCCGACCTCGTTCAGCTTCACGCTCGACACGTCGGCCGCCGCCCCCGGCGTCGCCCTGACCACCGACTCCGGCAGCAGCGCGTCCGACCACATCACCAACGTCGGCACGTTGAACCTGTCCGGCATCGAAACCGGCGCCACCGTGCAGTACAGCGTCGACAACGGTGCCCATTGGAGCACCAGCTTCGGTGCCCTAGAAGGCGTGAACAACGTGCAGGTCCGCCAGATCGACGTCGCCGGCAACACGTCGTCGGCGACCTCGTTCAGCTTCACGCTCGATACGTCGGCCGCCGCCCCCGGCGTCGCCCTGACCACCGATTCGGGCAGCAGCACCTCCGACCACATCACCAACGTCGGCACGCTGAATGTGACCGGAGTCGAGAGTGGCGCCACCGTGCAGTACAGCGTCGACAATGGTGCCCATTGGAACACCAGCTTCAGCGCCACCGAAGGCCCGAACGATGTGCAGGTCCGGCAGACCGATATCGCCGGCAATACGTCCGACCCAACCTCGTTCAGCTTCACGCTCGACACGTCGGCCGCCGCCCCCGGCGTCGCGCTGACCACCGATTCCGGCAGCAGCGCGTCCGACCACGTCACCAACGTCGGCACGCTGAACCTGTCCGGTGTCGAAACCGGCGCCACTGTCGAATATTCGATCGATGGTGGTCACACGTGGAGCACCAGCTTCAGCGCGACCGAAGGTCTGAACGACATCCAGGTCCGTCAGACCGACATCGCCGGCAACACGTCCGACCCGACCTCGTTCAGCTTCACGCTCGATACGTCGGCCGCCGCCCCCGGTGTGGCGCTCGCCACCGATTCCGGCAGCAGCGCTGTTGACCACATCACCAACGTCGGCACGTTGAACCTGTCCGGTGTCGAAACCGGCGCCACCGTCGAATATTCGATCGATGGCGGTCACACGTGGAGCACCAGCTTCAGCGCGACCGAAGGCCTGAACGACATCCAGGTCCGGCAGACCGACATCGCCGGCAACACGTCGTCGGCGACCTCGTTCAGTTTCACGCTCGATACGTCGGCTGCCGCCCCTGGCGTCGCGCTGACCACCGACTCCGGCAGCAGCGCTGTTGATCACATCACCAACGTCGGCACGCTGAACCTGTCCGGGGTCGAAACCGGCGCCACCGTCGAATACTCGACCGATGGCGGTCACACGTGGAGCACCAGCTTCAGCGCGACCGAAGGCTTGAACGACATTCAGGTCCGGCAGACCGATATCGCCGGCAACACGTCGTCGGCGACCTCGTTCAGCTTCACGCTCGACACGTCGGCTGCCGCCCCCGGTGTCGCGCTGACCACCGACTCCGGCAGCAGCGCTGTTGACCACATCACCAACGTCGGCACGCTGAACCTGTCCGGGGTCGAAAGCGGCGCCACTGTCGAATATTCGACCGATGGCGGTCACACGTGGAGCACCAGCTTCAGCGCGACCGAAGGTCTGAACGACGTGCAGGTCCGGCAGACCGATATCGCCGGCAACACATCGTCGGCGACCTCGTTCAGTTTCACGCTCGATACGTCGGCTGCCGCCCCCGGCGTCACCCTGACCACCGATTCGGGCAGCAGCGCGTCCGACCACGTCACCAACGTCGGCACGCTGAACCTGTCCGGTGTCGAAACCGGCGCGACCGTCGAATATTCGACCGATGGCGGTCACACGTGGAGCACCAGCTTCAGCGCGACCGAAGGTCTGAACGACATCCAGGTCCGTCAGACCGACATCGCCGGCAACACGTCGTCGGCGACCTCGTTCAGCTTCACGCTCGATACGTCGGCTGCCGCGCCCGGCGTCGCGCTGACCACCGATTCGGGCAGCAGCGCTGTTGACCACATCACCAATGTCGGCACGCTGAACCTCACCGGTGTCGAAACCGGCGCCACTGTCGAATATTCGATCGATGGTGGTCACACCTGGAACACCAGCTTCAGCGCGGTCGAAGGCCTGAACGATGTGCAGGTCCGGCAAACCGATATCGCCGGCAACACGTCGTCGGCGACCTCGTTCAGTTTCACGCTCGATACGTCGGCTGCCGCGCCCGGCGTCGCGCTGACCACCGATTCGGGCAGCAGCGCTGTTGACCACGTCACCAACGTCGGCACGTTGAACCTGACCGGCGTCGAAACCGGCGCCACCGTCGAATATTCGATCGATGGCGGCCATACGTGGAGCACCAGCTTCAGCGCCGTCGAAGGCCTGAACGACGTGCAGGTCCGGCAGACCGACATCGCCGGCAACACGTCGTCGGCGACCTCGTTCAGTTTCACGCTCGATACGTCGGCTGCCACCCCCGGCGTCGCGCTGACCACCGACTCCGGCAGCAGCGCCTCCGACCACGTCACCAACGTCGGCACGTTGAACCTGTCCGGCGTCGAAACCGGCGCCACTGTCGAATATTCGATCGACGGCGGCCATACGTGGAGCACCAGCTTCAGCGCCGTCGAAGGTCTGAACGATGTGCAAGTCCGGCAGACCGATATCGCCGGCAACACGTCGTCGGCGACCTCGTTCAGCTTCACGCTCGATACGTCGGCTGCCGCGCCCGGCGTCGCGCTGACCACCGATTCCGGCAGCAGCGCGTCCGACCACGTCACCAACGTCGGTACGCTGAATGTGACCGGGGTCGAGAGTGGTGCGACCGTGCAGTACAGCGTCGACAACGGTGCCCATTGGAGCACCAGCTTCAGCGCCGTCGAAGGCGTGAACAACGTGCAGGTCCGCCAGACCGACATCGCCGGCAATACGTCCGACCCGACCTCGTTCAGCTTCACGCTCGACACGTCGGCCGCCGCCCCCGGCGTCGCCCTGACCACCGACTCCGGCAGCAGCGCGTCAGACCACGTTACCAATGTCGGCACGTTGAACCTGTCCGGTGTCGAAACGGGCGCCACCGTCGAATATTCGATCGATGGTGGTCACACGTGGAGCACCAGCTTCAGCGCGACCGAAGGTCTGAACGACGTGCAGGTCCGTCAGACCGACATCGCCGGCAACACGTCGTCGGCGACCTCGTTCAGCTTCACGCTCGACACGTCGGCTGCCGCCCCCGGCGTCGCGCTGACCACCGATTCCGGCAGCAGCGCGTCCGACCACGTCACCAACGTCGGCACGCTGAACCTGTCCGGTGTCGAAACCGGCGCCACTGTCGAATATTCGATCGATGGTGGTCACACCTGGAGCACCAGCTTCAGCGCCACCGAAGGCCTGAACGATGTGCAAGTCCGGCAGACCGATATCGCCGGCAATACGTCCGACCCGACCTCGTTCAGCTTCACGCTCGACACGTCGGCTGCCGCCCCCGGCGTCGCGCTGACCACCGATTCCGGCAGCAGCGCGTCCGACCACGTCACCAACGTCGGCACGCTGAACCTGTCCGGTGTCGAAACCGGCGCCACTGTCGAATATTCGATCGATGGTGGTCACACCTGGAGCACCAGCTTCAGCGCCACCGAAGGCCTGAACGATGTGCAAGTCCGGCAGACCGATATCGCCGGCAATACGTCCGACCCGACCTCGTTCAGCTTCACGCTCGACACGTCGGCCGCCGCCCCCGGCGTCGCCCTGACCACCGATTCCGGCAGCAGCGCGTCCGACCACGTCACCAACGTCGGCACGCTGAACCTGTCCGGTGTCGAAACCGGCGCCACTGTCGAATATTCGATCGATGGTGGTCACACCTGGAGCACCAGCTTCAGCGCGACCGAAGGTCTGAACGATGTGCAGGTCCGTCAGACCGACGTCGCCGGCAACACGTCGTCGGCGACCTCGTTCAGTTTCACGCTCGATACGTCGGCTGCCGCCCCTGGCGTCGCGCTGACCACCGACTCCGGCAGCAGCGCTGTTGATCACATCACCAACGTCGGCACGCTGAACCTGTCCGGGGTCGAAACCGGCGCCACCATCGAATACTCGACCGATGGCGGTCACACGTGGAGCACCAGCTTCAGCGCGACCGAAGGCTTGAACGACATTCAGGTCCGGCAGACCGATATCGCCGGCAACACGTCGTCGGCGACCTCGTTCAGCTTCACGCTCGACACGTCGGCTGCCGCCCCCGGTGTCGCGCTGACCACCGACTCCGGCAGCAGCGCTGTTGACCACATCACCAACGTCGGCACGCTGAACCTGTCCGGGGTCGAAAGCGGCGCCACTGTCGAATATTCGACCGATGGCGGTCACACGTGGAGCACCAGCTTCAGCGCGACCGAAGGTCTGAACGACGTGCAGGTCCGGCAGACCGACATCGCCGGCAACACGTCGTCGGCGACCTCGTTCAGTTTCACGCTCGATACGTCGGCTGCCACCCCCGGCGTCGCGCTGACCACCGACTCCGGCAGCAGCGCCTCCGACCACGTCACCAACGTCGGCACGTTGAACCTGTCCGGCGTCGAAAGCGGCGCCACTGTCGAATATTCGATCGATGGTGGTCACACCTGGAGCGCCAGTTTCAGCGCGACCGAAGGCCTGAACGATGTGCAGGTCCGGCAGATCGATGTCGCCGGCAACACGTCGTCGGCGACCTCGTTCAGCTTCACGCTCGACACGTCGGCCGCCGCCCCCGGCGTCGCGCTGACCACCGACTCCGGCAGCAGCGCTGTTGACCACATCACCAACGTCGGCACGCTGAACCTGACCGGCGTCGAAACCGGCGCCACCGTCGAATACTCGACCGACGGCGGCCATACCTGGAGCGCCAGCTTCAGCGCGACCGAAGGCCTGAACGATGTGCAGGTCCGGCAGATCGATGTCGCCGGCAACACGTCGTCGGCGACCTCGTTCAGCTTCACGCTCGATACGTCGGCCGCCGCCCCCGGCGTCGCGCTGACCACCGATTCGGGCAGCAGCGCATCCGACCACATCACCAACGTCGGCACGCTGAACCTGTCCGGGGTCGAAAGCGGCGCCACTGTCGAATATTCGATCGATGGTGGTCACACGTGGAGCACCAGCTTCAGCGCCACCGAAGGTCTGAACGACGTGCAGGTCCGTCAGACCGATATCGCCGGCAACACATCGTCGGCAACCTCGTTCAGCTTCACGCTCGACACGTCGGCTGCCGCCCCCGGTGTCGCGCTGACCACCGATTCCGGCAGCAGCGCGTCCGACCACGTCACCAATGTCGGCACGCTGAACCTGTCCGGCATCGAAACCGGCGCCACCGTGCAGTACAGCGTCGACAACGGCGTCCATTGGAACACCAGTTTCAGCGCGACCGAAGGCCTGAACGACGTGCAGGTCCGTCAGACCGATATCGCCGGCAACACATCGTCGGCAACCTCGTTCAGCTTCACGCTCGACACGTCGGCTGCCGCCCCCGGTGTCGCGCTGACCACCGATTCCGGCAGCAGCGCGTCCGACCACGTCACCAATGTCGGCACGCTGAACCTGTCCGGCATCGAAACCGGCGCCACCGTGCAGTACAGCGTCGATAACGGCGTCCATTGGAACACCAGTTTCAGCGCGACCGAAGGCCTGAACGACGTGCAGGTCCGCCAGACCGATATCGCCGGCAACACATCGTCGGCAACCTCGTTCAGCTTCACGCTCGACACGTCGGCTGCCGCCCCCGGTGTCGCGCTGACCACCGATTCCGGCAGCAGCGCGTCCGACCACGTCACCAATGTCGGCACGCTGAACCTGTCCGGCATCGAAACCGGCGCCACCGTGCAGTACAGCGTCGACAACGGCGTCCATTGGAACACCAGTTTCAGCGCGACCGAAGGCCTGAACGACGTGCAGGTCCGTCAGACCGATATCGCCGGCAACACATCGTCGGCAACCTCGTTCAGCTTCACGCTCGACACGTCGGCTGCCGCCCCCGGTGTCGCGCTGACCACCGATTCCGGCAGCAGCGCGTCCGACCACGTCACCAATGTCGGCACGCTGAACCTGTCCGGGGTCGAAAGCGGCGCCACTGTCGAATATTCGATCGATGGTGGTCACACGTGGAGCACCAGCTTCAGCGCGACCGAAGGTCTGAACGACGTGCAGGTCCGTCAGACCGACATCGCCGGCAACACGTCGTCGGCGACCTCGTTCAGTTTCACGCTCGACACGTCGGCCACCGCCCCCGGCGTCGCACTGACCACCGACTCCGGCAGCAGCGCGTCCGACCACGTCACCAATGTCGGCACGCTGAACCTGTCCGGTGTCGAAAGCGGCGCCACTGTCGAATATTCGATCGATGGTGGTCACACCTGGAGCGCCAGTTTCAGCGCGACCGAAGGCCTGAACGATGTGCAGGTCCGGCAGATCGATGTCGCCGGCAACACGTCGTCGGCGACCTCGTTCAGCTTCACGCTCGACACGTCGGCCGCCGCCCCCGGCGTCGCGCTGACCACCGACTCCGGCAGCAGCGCTGTTGACCACATCACCAACGTCGGCACGCTGAACCTGACCGGCGTCGAAACCGGCGCCACCGTCGAATACTCGACCGACGGCGGCCATACCTGGAGCGCCAGCTTCAGCGCCACCGAAGGTCTGAACGACGTGCAGGTCCGTCAGACCGACATCGCCGGCAATACGTCCGACCCGACCTCGTTCAGCTTCACGCTCGACACGTCGGCCGCCGCCCCCGGTGTCGCGCTGACCACCGACTCCGGCAGCAGCGCTGTTGACCACATCACCAACGTCGGCACGCTGAACCTGTCCGGGGTCGAAAGCGGCGCCACTGTCGAATATTCGATCGATGGTGGTCACACGTGGAGCACCAGCTTCAGCGCCACCGAAGGTCTGAACGACGTGCAGGTCCGTCAGACCGATATCGCCGGCAACACATCGTCGGCAACCTCGTTCAGCTTCACGCTCGACACGTCGGCTGCCGCCCCCGGTGTCGCGCTGACCACCGATTCCGGCAGCAGCGCGTCCGACCACGTCACCAACGTCGGCACGCTGAATGTGACCGGAGTCGAGAGTGGCGCCACCGTGCAGTACAGCGTCGACAACGGCGCGCACTGGAGCACCACCTTCAGCGCGGTCGAAGGCACGAACAACGTCCAGGTCCGGCAGATCGACGTCGCGGGCAACACGTCGTCGGCGACCTCGTTCAGCTTCACGCTCGATACGTCAGCCGCCGCCCCCGGCGTCGCGCTGACCACCGACTCCGGCAGCAGCGCGTCCGACCACGTCACCAACGTCGGTACGCTGAATGTGACCGGAGTCGAGAGTGGCGCGACCGTGCAGTACAGCGTCGACAACGGCGCGCACTGGAGCACCAGCTTCAGTGCGGTCGAAGGCGTGAACAACGTGCAGGTCCGGCAGATCGACGTCGCCGGCAACACGTCGTCGGCGACCTCCTTCAGCTTCACGCTCGACACGTCGGCTGCCGCGCCCGGCGTCGCGCTGACCACCGATTCGGGCAGCAGCGCATCCGACCACATCACCAACGTCGGCACGCTAAGCTTGACCGGCATCGAAACCGGCGCCACCGTGCAGTACAGCATCGACAACGGCGCCCATTGGAACACCAGCTTCAGCGCCGTCGAAGGCGTGAACAACGTCCAGGTGCGCCAGATCGACGTCGCCGGCAACACGTCGTCGGCGACCTCGTTCAGCTTCACGCTCGATACGTCGGCCGCCGCCCCCGGCGTCGCGCTGACCACCGATTCGGGCAGCAGCGCATCCGACCACATCACCAACGTCGGTACGTTGAATGTGACCGGAGTCGAGAGTGGCGCGACCGTGCAGTACAGCGTCGACAACGGCGCGCACTGGAGCACCAGCTTCAGCGCGGTCGAAGGCGTGAACAACGTGCAGGTCCGGCAGATCGACGTCGCCGGCAACACGTCGTCGGCGACCTCGTTCAGCTTCACGCTCGATACGTCGGCCGCCGCCCCCGGCGTCGCGCTGACCACCGATTCGGGCAGCAGCGCGTCCGACCACATCACCAACGTCGGCACGCTAAGCTTGACCGGCATCGAAACCGGCGCCACCGTGCAGTACAGCGTCGACAACGGCGCCCATTGGAACACCAGCTTCAGCGCCGTCGAAGGCGTGAACAACGTCCAGGTGCGCCAGATCGACGTCGCCGGCAACACGTCGTCGGCGACCTCGTTCAGCTTCACGCTCGATACGTCGGCCGCCGCCCCCGGCGTCGCGCTGACCACCGATTCGGGCAGCAGCGCATCCGACCACATCACCAACGTCGGTACGTTGAATGTGACCGGAGTCGAGAGTGGCGCGACCGTGCAGTACAGCGTCGACAACGGCGCGCACTGGAGCACCAGCTTCAGCGCGGTCGAAGGCGTGAACAACGTGCAGGTCCGGCAGATCGACGTCGCCGGCAACACGTCGTCGGCGACCTCGTTCAGCTTCACGCTCGATACGTCGGCCGCCGCCCCCGGCGTCGCGCTGACCACCGATTCGGGCAGCAGCGCGTCCGACCACATCACCAACGTCGGCACGCTAAGCTTGACCGGCATCGAAACCGGCGCGACCGTGCAGTACAGCATCGACAACGGCGCGCACTGGAGCACCAGCTTCAGCGCCGTCGAAGGCGTGAACAACGTACAGGTGCGCCAGATCGACGTCGCCGGCAACACGTCGTCGGCGACCTCGTTCAGCTTCACGCTCGATACGTCGGCCGCCGCCCCCGGCGTCGCGCTGACCACCGATTCGGGCAGCAGCACCTCCGACCACATCACCAACGTCGGCACGCTAAGCTTGACCGGCATCGAAACCGGCGCGACCGTGCAGTACAGCATCGACAACGGCGCCCACTGGAACACCAGCTTCAGCGCCGTCGAAGGCGTGAACAACGTACAGGTGCGCCAGATCGACGTCGCCGGCAACACGTCGTCGGCGACCTCGTTCAGCTTCACGCTCGATACCTCGGCCGCCGCCCCCGGCGTCGCGCTGACCACCGATTCGGGCAGCAGCGCATCCGACCACGTCACCAATGTCGGCACGTTGAACCTGACGGGCGTCGAGAATGGCGCGACCGTGCAGTACAGCGTCGACAACGGCGCGCACTGGAGCACCAGCTTCAGCGCCGTCGAAGGCACGAACAACGTCCAGGTGCGCCAGATCGACGTCGCCGGCAACACGTCGTCGGCGACCTCGTTCAGCTTCACGCTCGATACGTCGGCCGCCGCCCCCGGCGTCGCGCTGACCACCGATTCCGGCAGCAGTGCTGTTGATCACATCACCAACGTCGGCACGCTGAATGTGACCGGAGTCGAGAGTGGCGCCACCGTGCAGTACAGCGTCGACAATGGTGCCCATTGGAACACCAGCTTCAGCGCGGTCGAAGGCGTGAACAACGTACAGGTCCGCCAGATCGACGTCGCCGGCAACACGTCGTCGGCGACCTCGTTCAGCTTCACGCTCGATACGTCGGCCGCCGCCCCCGGCGTCGCCCTAACCACCGATTCGGGCAGCAGCACCTCCGACCACATCACCAACGTCGGCACGCTAAGCTTGACCGGCATCGAAACCGGCGCCACCGTGCAGTACAGCATCGACAACGGCACCCATTGGAACACCAGCTTCAGCGCGGTCGAAGGCGTGAACAACGTACAGGTGCGCCAGATCGACGTCGCGGGCAACACGTCGTCGGCGACCTCGTTCAGCTTCACGCTCGACACGTCGGCCGCCGCCCCCGGCGTCGCGCTGACCACCGACTCCGGCAGCAGCGCGTCCGATCACATCACCAACGTCGGTACGTTGAACCTCACCGGCATCGAAACCGGCGCCACCGTGCAGTACAGCATCGACAACGGCGCCCATTGGAACACCAGCTTCAGCGCCGTCGAAGGCGTGAACAACGTACAGGTGCGCCAGATCGACGTGGCAGGCAACATCTCGAACGCGACCAGTTTCAAT
123990 NZ_CP028561.1 Acinetobacter-sp Bacteria 2710932-2726000 15069 251 60 TTCTAAGCTG TTCTAAGCTGCCTATACGGCAGTGGACGGCATGTCTCAATCAGCATTAGCAAAAAAGGCTTTCTAAGCTGCCTATATGGCAGTGAACTTGTTGGTGTGTTATCAGGTGGAATAGTATCATTTCTAAGCTGCCTGTATGGCAGTGAACCTATACACCAGTAGAAACGTATTATTCAGCATTTTCTAAGCTGCCTGTATGGCAGTGAACACAAAGCTGAGTTTAATTTTTCAGTATCAACTTTTCTAAGCTGCCTGTATGGCAGTGAACACTCACCATCTTTATGGAAGCCTGCAAACACATTTCTAAGCTGCCTGTATGGCAGTGAACTCAAAGAGCTTGCAAACTCGATCTGGTCGCAATTTCTAAGCTGCCTGTATGGCAGTGAACTTGGAAGCGATTGGGCATTACTTGTTGGGTAATTTCTAAGCTGCCTGTATGGCAGTGAACGATCAACCCATGTGCCATCTTCTAATTTTGTTTTTCTAAGCTGCCTGTATGGCAGTGAACAAGGTCTCGAAGTTGGGGTAGGGTGAGTTCTTTTTCTAAGCTGCCTGTATGGCAGTGAACTGATGTTCGCAGTTTTCGGATTGCTATTTATCTTTCTAAGCTGCCTGTATGGCAGTGAACGAAAAGCATTTGCAGCTGAAACCAAAGCACGTTTTCTAAGCTGCCTGTATGGCAGTGAACTTTTAGTTTCAAGCCCTGATTTAACAGCAACATTTCTAAGCTGCCTGTATGGCAGTGAACCAGTTAATGCATATTTAGAGAATATTCGTTACTTTCTAAGCTGCCTGTATGGCAGTGAACACAACAGCCCGATAATTGGTATGGACCAGTGATTTCTAAGCTGCCTGTATGGCAGTGAACTGTTGCATTTGATTACTGGTACACCTGGTGCATTTCTAAGCTGCCTGTATGGCAGTGAACGGCTTTTTGCTGCATTAGAGCGACGATATTCATTTCTAAGCTGCCTGTATGGCAGTGAACAAATACTTTTTACAATCGGAACATATTTATTATTTCTAAGCTGCCTGTATGGCAGTGAACTTTACGAAAAAGATGGGAAGAAATTCGATATTTTTCTAAGCTGCCTGTATGGCAGTGAACGTTTAAGACAATATTTAACACGAAATTTGTAATTTCTAAGCTGCCTGTATGGCAGTGAACAAGCTGAACATATCCGCGACCATAATATAAATTTTCTAAGCTGCCTGTATGGCAGTGAACAAAATGTGCGTCAATCTACACATGGATGAATTTTTCTAAGCTGCCTGTATGGCAGTGAACATGGCGCGTCAGTTTATCCGAATTGGTCAACATTTCTAAGCTGCCTGTATGGCAGTGAACCTGCTTTGCTTACAATTGTTTGTACTTTTTTATTTCTAAGCTGCCTGTATGGCAGTGAACACTGGCGAACCAAGCCGCGGCGATGCGTAAGTTTTCTAAGCTGCCTGTATGGCAGTGAACGGCTTTAAAAAACTTGCATCATTAATCAAATATTTCTAAGCTGCCTGTATGGCAGTGAACACAACAAAATACGTATTTAATGCGATGGAAACTTTCTAAGCTGCCTGTATGGCAGTGAACAACCAGCACCACAGCCGATCCGCACAATCAATTTTCTAAGCTGCCTGTATGGCAGTGAACATTTAGTTTTTCGTGGACCATCTTTAGACAAATTTCTAAGCTGCCTGTATGGCAGTGAACGCGACTTTAACAAGGCTATTGGAAAGCTTGGTTTTCTAAGCTGCCTGTATGGCAGTGAACTGTATGGTCTTTCAGGTGGTTCAGGTTTTTTGTTTCTAAGCTGCCTGTATGGCAGTGAACCTGACCGTGAACTCGCCGTCGCCACTGGTCCCTTTCTAAGCTGCCTGTATGGCAGTGAACTATTATTCCAATCAATAGAGCCATTTTCAATTTTTCTAAGCTGCCTGTATGGCAGTGAACTGCTCTAAATCGCTCTAGCTGCTTAATTGTAGTTTCTAAGCTGCCTGTATGGCAGTGAACGGATGCTCTAATTCTCCCGTTTATAATCATACTTTCTAAGCTGCCTGTATGGCAGTGAACCAGATATATCTTTAAGCTTCCCTGCTTTCTGTTTTCTAAGCTGCCTGTATGGCAGTGAACTCAAGCCAGCAATTATTGCATCTGCATATATTTTTCTAAGCTGCCTGTATGGCAGTGAATACCCAACTTATCTAGGCTTGTTAAGTATCTCATTTCTAAGCTGCCTGTATGGCAGTGAACTAATCCCTTTTTCTAGCTCCAATGTTTACATGTTTCTAAGCTGCCTGTATGGCAGTGAACATTTGTTGTGTAATTGTCCAACCGCCTAAAGATTTCTAAGCTGCCTGTATGGCAGTGAACATTAAAAACCTCAAAAAGTGCTCGGATGACGATTTCTAAGCTGCCTGTATGGCAGTGAACCCCCAAGGATCGGAGTCGTTACACGGCCATGCTTTCTAAGCTGCCTGTATGGCAGTGAACGTGGCTTTGACATAGCTTTTAGTATTGTTTTATTTCTAAGCTGCCTGTATGGCAGTGAACAAGCAAGTACCGATACAATGACAAGCTTTTTTTTTCTAAGCTGCCTGTATGGCAGTGAACATCGAGCCACAAAAAATCATAATCACTGATGATTTCTAAGCTGCCTGTATGGCAGTGAACACGCTAGCAGCTTGTGAACCTACAACTTGATTTTTCTAAGCTGCCTGTATGGCAGTGAACTGGCTGGAGTTTTAGGCGGTGCAGCAATTACATTTCTAAGCTGCCTGTATGGCAGTGAACTGAAATTATGTCAGATTCACGACTGATCAACTTTTCTAAGCTGCCTGTATGGCAGTGAACTATTAGGAAATAGGGTATGAGATCAATGGTTATTTCTAAGCTGCCTGTATGGCAGTGAACGGGTAGAACAACTCACTATAAATGATTTGTTCTTTCTAAGCTGCCTGTATGGCAGTGAACAACAACCTCCCTCGCCTTATCAATACCATGCTTTTCTAAGCTGCCTGTATGGCAGTGAACAGTTGTTACCAGGTCGTAACGGTATTGATGAATTTCTAAGCTGCCTGTATGGCAGTGAACGTTGATTTTGGGATTGAGCAAAATAGTTAAACTTTCTAAGCTGCCTGTATGGCAGTGAACTATATCAAATCACTTTTACGACTGACGATGATTTTCTAAGCTGCCTGTATGGCAGTGAACTAAGTATTATGCATACACTCAACAAGGTACTATTTCTAAGCTGCCTGTATGGCAGTGAACTAAGACTTAGCAAAGCTACTTTAAGACAATATTTTCTAAGCTGCCTGTATGGCAGTGAACAATCAGGTGCATTAAAAGCAGCAGCTCGTTTTTTTCTAAGCTGCCTGTATGGCAGTGAACTTTGTGATCGAAATGTTGCTCATGATATTCAATTTCTAAGCTGCCTGTATGGCAGTGAACTGCAGCCCAAGTCATTAGTTGCTGACCTGCATTTTCTAAGCTGCCTGTATGGCAGTGAACGGTCAGGTTTGCTTAGGGTGAATTGATAACCATTTCTAAGCTGCCTGTATGGCAGTGAACATTTGATGTAGGTGAATCAACATTGATTGTTGTTTCTAAGCTGCCTGTATGGCAGTGAACGATCAATCGATATGATGTCGTAAAACTGACTTTTTCTAAGCTGCCTGTATGGCAGTGAACCAACATATGCAGGAAGTACAGCAACAGTTTTTTTTCTAAGCTGCCTGTATGGCAGTGAACGCTATGAAGCAAGAGACGACTACACACCCTTCTTTCTAAGCTGCCTGTATGGCAGTGAACATAAACAACCGCTAAAAACACGATGATTGACATTTCTAAGCTGCCTGTATGGCAGTGAACCCACCATATACATCTAGTCAATATTTTTGGTTTTTCTAAGCTGCCTGTATGGCAGTGAACCACAAACTTTGAAAGCCCATTCACAGAAGACATTTCTAAGCTGCCTGTATGGCAGTGAACCTGCTTCAAATTCGATTGCACCAATACCTAAATTTCTAAGCTGCCTGTATGGCAGTGAACTACTTCGTAATCTTCCCGTAAATTACTTGATATTTCTAAGCTGCCTGTATGGCAGTGAACTAGCAGACTCGTAGTATTGATACAGTCGTTTATTTCTAAGCTGCCTGTATGGCAGTGAACGGTTTTGAGCAAATGTTGTTTTACCCATTGATTTTCTAAGCTGCCTGTATGGCAGTGAACGATAAACAACAACTTGATACTTATCTTCCAGATTTCTAAGCTGCCTGTATGGCAGTGAACCTTCTTTTGGACAAGCAGTTGGGGAAACATTATTTCTAAGCTGCCTGTATGGCAGTGAACTTATTCCAAGTGATAAAGCCAAGCATTGGAAGTTTCTAAGCTGCCTGTATGGCAGTGAACTCATAGAACAAATAGATATAGGTAATCAGAGATTTCTAAGCTGCCTGTATGGCAGTGAACTGTTTGTTGCCGTTGGTGACGATTTCCATATCTTTCTAAGCTGCCTGTATGGCAGTGAACTTTAACCCTTTCAACGTAACCAATGTCGACAATTTCTAAGCTGCCTGTATGGCAGTGAACCAGCAGAAACGTTAGCAATATCCTGTCCCCAATTTCTAAGCTGCCTGTATGGCAGTGAACGCCTACATGGGTGATGAATATGCTAGCTATTTTTTCTAAGCTGCCTGTATGGCAGTGAACGGAAATAATTTATTTAATAAAATATCCAAAAATTTCTAAGCTGCCTGTATGGCAGTGAACAGATGTTGCGTTCTACTGGAGTCATTTCAATTTTTCTAAGCTGCCTGTATGGCAGTGAACAAGAAAGCTGCTTTGACCCACTTAAAGACAACTTTCTAAGCTGCCTGTATGGCAGTGAACCATAGGGATCAGTTTTATCACATTTAGGAGGATTTCTAAGCTGCCTGTATGGCAGTGAACACCTTCGCATCTATGAAGACATTGCACCTATATTTCTAAGCTGCCTGTATGGCAGTGAACCATCCTCAGTTTATTGGGGTTCAACATTTAAATTTCTAAGCTGCCTGTATGGCAGTGAACGTGTGCGCTGAATTTTGACATCCTCAATTTGATTTCTAAGCTGCCTGTATGGCAGTGAACTGCCTGCAACACGTTCTTGGTGGTCATTTAAATTTCTAAGCTGCCTGTATGGCAGTGAACTTGCCAAGCATGCCAACTGAACTTTTTATAAATTTCTAAGCTGCCTGTATGGCAGTGAACTCAATGCCAACGGTGAAAAAAAGATGATGTATTTTCTAAGCTGCCTGTATGGCAGTGAACACACCGTGGTTAAACTGGTCGAGTATTTTAAGTTTCTAAGCTGCCTGTATGGCAGTGAACCGTTTCGGTCGTGTTAATTCTGTTGCTCGTTGTTTCTAAGCTGCCTGTATGGCAGTGAACAATAATCGGGCTGTAACCCTCCAACATATACATTTCTAAGCTGCCTGTATGGCAGTGAACGGCAACGAAACCGACTGCATTTTAATTTGTGATTTCTAAGCTGCCTGTATGGCAGTGAACTATATGACACTAACCAAAAACGTGCTTATGAATTTCTAAGCTGCCTGTATGGCAGTGAACCATTTTAGTTTTTACAAGTTTTTTAGCGCTCATTTCTAAGCTGCCTGTATGGCAGTGAACCGAGTGCGTCTACAGGCTTGAAATCAATCACTTTTCTAAGCTGCCTGTATGGCAGTGAACTTAATATTATTCAGCAGAAGCCTAAAGGCACTTTTCTAAGCTGCCTGTATGGCAGTGAACTACCTTAGCCATTTCAGGCGCAATACGGTCTATTTCTAAGCTGCCTGTATGGCAGTGAACAAAGCGATATTGCGGTACTCAATAAAGATCATTTTCTAAGCTGCCTGTATGGCAGTGAACGATAAATATCTAAGATGAGCCGATCCATTTGATTTCTAAGCTGCCTGTATGGCAGTGAACTGCTAACTCAATATTTAAGAGATTTTTTCGGGTTTCTAAGCTGCCTGTATGGCAGTGAACCTACAGATGGCACAACCGCAATTACTGCTGTTTTTCTAAGCTGCCTGTATGGCAGTGAACTCTTTGGTTTTGCATCCCCAAGCATAGACATATTTCTAAGCTGCCTGTATGGCAGTGAACATATTGATGTAGTCGCTATACAAAAAGAATTATTTCTAAGCTGCCTGTATGGCAGTGAACTTGAAGCATACGAAAAAGTTGCATTGGTTGAATTTCTAAGCTGCCTGTATGGCAGTGAACCAGGATTGGTATCACTCCTTCCATTCGTGAATTTTCTAAGCTGCCTGTATGGCAGTGAACAGCCCAACGTCCCGCAGTTCCGCTACCGTTCGTTTCTAAGCTGCCTGTATGGCAGTGAACTGACGACCTTATTTATTTTTATGCTAGATCATTTTCTAAGCTGCCTGTATGGCAGTGAACCCGATGCTTCGTTCACAAACGAAAGGTTTTTATTTCTAAGCTGCCTGTATGGCAGTGAACTACCACCTAAGCGAATGGATTGCATGGTGATTTTTCTAAGCTGCCTGTATGGCAGTGAACACCGTGCTACCAATACAAGTGCTGCTATTGCATTTCTAAGCTGCCTGTATGGCAGTGAACATTTCATCATCAAATGGTTTATTAGGGTTATATTTCTAAGCTGCCTGTATGGCAGTGAACCCTAACTTATGAAGTAACAGCAAAGCCAGTTTTTTCTAAGCTGCCTGTATGGCAGTGAACATAAAGACATAGAACAAAAAACCGATGAAGAATTTCTAAGCTGCCTGTATGGCAGTGAACAATAAAGTATCTATAGGAAAGGCGCAGTAATGTTTCTAAGCTGCCTGTATGGCAGTGAACAAGTACAGCTTTTCAGAGGTGAGGGCGGTGTCTTTCTAAGCTGCCTGTATGGCAGTGAACATATTCAATATTCGGGGCACGATTGCCACACTTTTCTAAGCTGCCTGTATGGCAGTGAACCCTGATTAGGCTGCTGTCTGAAGTAGTCAAATTTTCTAAGCTGCCTGTATGGCAGTGAACCCTGATTAGGCTGCTGTCTGAAGTAGTCAAATTTTCTAAGCTGCCTGTATGGCAGTGAACATTCAATATCCATCCTCCCCTCCGTTGTGGTCTTTCTAAGCTGCCTGTATGGCAGTGAACTACAGTGATAAGGCAAGGGATACAAATAAAGATTTCTAAGCTGCCTGTATGGCAGTGAACCCGCTCTTGAAAGGTTAATGTGTTCGATCCTATTTCTAAGCTGCCTGTATGGCAGTGAACCTTCGCAAGTTGCAAAAGTTCTTGCTCGTGGTTTTCTAAGCTGCCTGTATGGCAGTGAACTCTCTCTATAACATTTCCTATTTTCTGTAATTTTTCTAAGCTGCCTGTATGGCAGTGAACGGTAAACGCTTTTTGTGGGTATCAATAGTTGTTTTCTAAGCTGCCTGTATGGCAGTGAACTATGAAATTGGTTCAGGTCACGAATTAAAAACTTTCTAAGCTGCCTGTATGGCAGTGAACTAAGTGCAAACTTGCAAGCAGGCGCTCAAGTATTTCTAAGCTGCCTGTATGGCAGTGAACTTGCATCAATTGATGAAGCAGCATTAGCCATTTTTCTAAGCTGCCTGTATGGCAGTGAACCCATTTGAAACTCCAAAAACTAAGCCCCGTCATTTCTAAGCTGCCTGTATGGCAGTGAACTTTCAAAAACTACTGCTCAGAGCATCCCGAATTTTCTAAGCTGCCTGTATGGCAGTGAACTACAGTGATAAGGCAAGGGATACAAATAAAGATTTCTAAGCTGCCTGTATGGCAGTGAACCCGCTCTTGAAAGGTTAATGTGTTCGATCCTATTTCTAAGCTGCCTGTATGGCAGTGAACTTTGCAGAAGTATTCGATGCTGAACTAGATAATTTCTAAGCTGCCTGTATGGCAGTGAACTTGTGAAGTCTGTAGCAGCTGCTGGCCAATCATTTCTAAGCTGCCTGTATGGCAGTGAACGGTAGTACGGTTGAACCGCATGGGGGTAGTACTTTCTAAGCTGCCTGTATGGCAGTGAACGATAGAGGTTTTTCCTGTTGATTAAACTTGTGTTTCTAAGCTGCCTGTATGGCAGTGAACATTCTGAAAAAGAAAAAGAACAGGGCGCTATTTTTCTAAGCTGCCTGTATGGCAGTGAACGAGATCTGAACGACTGATTCACCGTTTACAACTTTCTAAGCTGCCTGTATGGCAGTGAACGTGTAACAAGAGAATCTCGAATGTATGAACTATTTCTAAGCTGCCTGTATGGCAGTGAACCCAATATTCGTGGACATTCTGAATTAACAGATTTTCTAAGCTGCCTGTATGGCAGTGAACTGCTGATTTAATCTTCATGCTTCGTAACAACGTTTCTAAGCTGCCTGTATGGCAGTGAACAATTTGAAATCGGGGAGTCCACGCTTTCTAATTTTCTAAGCTGCCTGTATGGCAGTGAACGTTGATAAACCTGATGGATAAGTCCGCATAACTTTCTAAGCTGCCTGTATGGCAGTGAACAGATTTATTTCATGCACTTCAACAAGTGTAAATTTCTAAGCTGCCTGTATGGCAGTGAACCACCTTTGAAAGCTTTTGCTCTTTGAAGTAGTTTTCTAAGCTGCCTGTATGGCAGTGAACATTAGGACTGGTGTAATCTTCGGGATAGTCTATTTCTAAGCTGCCTGTATGGCAGTGAACACTGCCCCTCATATACAGGCGTTGCAGCAATATTTCTAAGCTGCCTGTATGGCAGTGAACTAAGATCCTAGCAGAGCAATATAACTTGATTATTTCTAAGCTGCCTGTATGGCAGTGAACTTGAGCGTCGTACAGATCAACGATTTGCAAGTTTTCTAAGCTGCCTGTATGGCAGTGAACAAGTGGAAAGGTGAATACTTTTGCATTCGCACTTTCTAAGCTGCCTGTATGGCAGTGAACCATCGGTGCAGCTGAACGCTTGGATGCTATGTTTTCTAAGCTGCCTGTATGGCAGTGAACAGGAAGAGGCTTTTAGAAGCGCATCTACAGTATTTCTAAGCTGCCTGTATGGCAGTGAACGAGCAATTGATGGGACTTTGATCGTTCAGCAATTTCTAAGCTGCCTGTATGGCAGTGAACACGACCTGTACTTGGATTTCAGCTATCAGTACTTTCTAAGCTGCCTGTATGGCAGTGAACCAATGGCGGTTTTTTTATGTCTGGAGAAAATATTTCTAAGCTGCCTGTATGGCAGTGAACATTCTGAAGTAATTAAAAAGCCCTCTGAGTGATTTCTAAGCTGCCTGTATGGCAGTGAACATGTTCACAAAAGCAACAGGGCTAAAAATTGATTTCTAAGCTGCCTGTATGGCAGTGAACGTCTTTTCTTGACTATGAAGATCGAGATTTATTTTCTAAGCTGCCTGTATGGCAGTGAACGTTACATTAATTCTCAAGTAATATCTCAAATGTTTCTAAGCTGCCTGTATGGCAGTGAACACGAAAACATACTTGCGAAATCACTGATAATGTTTCTAAGCTGCCTGTATGGCAGTGAACAGTGATCAATATCAATCCTGATAATCGTGGATTTTCTAAGCTGCCTGTATGGCAGTGAACAAGCCGCAGATCCATAATTGAACCTGTCATAATTTCTAAGCTGCCTGTATGGCAGTGAACCCTTACGTTGGACCATACCTTGCACCCGTTATTTTCTAAGCTGCCTGTATGGCAGTGAACGCAGGGTTGAAGCAAATGGAATGGCTGATGCTTTTCTAAGCTGCCTGTATGGCAGTGAACATGAAAATGGCGATCCTGTTTTAAATGAAAATTTTCTAAGCTGCCTGTATGGCAGTGAACTTTAAGAAAATTACACGTCATCACGACTATTTTTTCTAAGCTGCCTGTATGGCAGTGAACCTCCGCCAGCGAATGTTGTAGTTACTGCTAGATTTCTAAGCTGCCTGTATGGCAGTGAACGTTGTTTTGCCTGAAATGAAAGCAGATATGGATTTCTAAGCTGCCTGTATGGCAGTGAACGAAACATTCGGCAAATGATGTTTAACAAAGATTTTCTAAGCTGCCTGTATGGCAGTGAACGTAAAACAGCTAGTGTTCAGACCGAGACAAATTTTCTAAGCTGCCTGTATGGCAGTGAACCTTTACTAGGTAAAGTGGTTAGCGCTTTACTATTTCTAAGCTGCCTGTATGGCAGTGAACTATTTAAAATTGCATATTCAGTGACATTTATTTTTCTAAGCTGCCTGTATGGCAGTGAACGCATTTCTTCAGTTGTTGAAGTAACCGAAATATTTCTAAGCTGCCTGTATGGCAGTGAACTTCTGTTTTGTAGGCGTTGTAGGCGTCTAATATTTCTAAGCTGCCTGTATGGCAGTGAACGGCATACTCACTTTATGATCTGATCATTTGTATTTCTAAGCTGCCTGTATGGCAGTGAACATAATAACTGTTGCTTTGCCGATGGATAGCTTTTTCTAAGCTGCCTGTATGGCAGTGAACGGGTCGCATAGATTACCTTTTCTTTTTCTGTTTTTCTAAGCTGCCTGTATGGCAGTGAACATTTGGTGAATATAAGATTTTCATGTGGTACATTTCTAAGCTGCCTGTATGGCAGTGAACGTTTTAATTAATTTTTTGACTGCTTTGTACTATTTCTAAGCTGCCTGTATGGCAGTGAACCCAGAGTGATAAATCACAAAGGTTTTTAAATCTTTCTAAGCTGCCTGTATGGCAGTGAACTAATTACTCGCATTGCGAAGTGGTTAGAGCAATTTCTAAGCTGCCTGTATGGCAGTGAACGTTCAATCCATAATCCGTGAATCAAGCCGTTTTTTCTAAGCTGCCTGTATGGCAGTGAACAGCATGAGCAATGACAGGGTTTGGATTGATTTTTTCTAAGCTGCCTGTATGGCAGTGAACATCGATCAATTTTATGTCACGCCATTCTACTATTTCTAAGCTGCCTGTATGGCAGTGAACTGAAATTATTTTATCTCTATATTTCCCGTTCATTTCTAAGCTGCCTGTATGGCAGTGAACAGCAACATCAAACGATTGTTGATGGCGAAATATTTCTAAGCTGCCTGTATGGCAGTGAACTCTTTTCTCCAGATAATAAAAAACCGCCAAAATTTCTAAGCTGCCTGTATGGCAGTGAACCTGCATACGCCGCAGCATTTGCGATTCAAAAATTTCTAAGCTGCCTGTATGGCAGTGAACCGCAGAAGATTATCTGATGAGTATGGTCGGGATTTCTAAGCTGCCTGTATGGCAGTGAACGTTGAATTATATAGTGGAGGATTTTGCCCATTTTTCTAAGCTGCCTGTATGGCAGTGAACGAATAAATCTGCGCAATTTATCCAAAAAGTAATTTCTAAGCTGCCTGTATGGCAGTGAACTCATTACCCTTTCGGCTGTTCTCACTAACAATTTTCTAAGCTGCCTGTATGGCAGTGAACATCAATAAGATAGAAGTCTTCATCATTAACTATTTCTAAGCTGCCTGTATGGCAGTGAACTTAGTTTTTTGGATTATGTCGACGATTACACTTTTCTAAGCTGCCTGTATGGCAGTGAACCTTTAACTGTTCAACTTTTGAAAGTGCTTTAATTTCTAAGCTGCCTGTATGGCAGTGAACTACCCATCTAATATAGCAGCTATAGTAAAGGATTTCTAAGCTGCCTGTATGGCAGTGAACTTATTGCAGCATCAATAGCACGTTTTTGGTATTTTCTAAGCTGCCTGTATGGCAGTGAACTTCTTTCATCATTCCTGACATCGAAACAATCTTTTCTAAGCTGCCTGTATGGCAGTGAACGGTTCACAAGAGTTTACAGTTCCATACATCATTTTCTAAGCTGCCTGTATGGCAGTGAACTAAGCCGTTGATTGCTGCAAATGTATCAACTGTTTCTAAGCTGCCTGTATGGCAGTGAACCAGGATTGAAAGCAAAACTTGATGAACTTCTTTTTCTAAGCTGCCTGTATGGCAGTGAACTGTAACCAAATGCATTGATAAAAGTTTGAAGTTTTCTAAGCTGCCTGTATGGCAGTGAACTAATAAATGGGATAACTTGAGAGCATCTAATATTTCTAAGCTGCCTGTATGGCAGTGAACTTATTTTGTTTTGGTGTCTATCTAGCCATAAATTTCTAAGCTGCCTGTATGGCAGTGAACGAGAAACGCAAGAATCTCAAATCTGCATCAATTTTCTAAGCTGCCTGTATGGCAGTGAACAATAACTATTGTTAATCTTGATGTTCGCAGGCTTTCTAAGCTGCCTGTATGGCAGTGAACTTTTAAGCTTGGTAAAATCAATGCCGTCCGTTTTTCTAAGCTGCCTGTATGGCAGTGAACAGCTGAACAGCTTAAAGACAATGCAACACAATTTTCTAAGCTGCCTGTATGGCAGTGAACTGAAGCACATCATGTTGCAGACCAAAACATGTTTTCTAAGCTGCCTGTATGGCAGTGAACTTAAAGATATTTTTCCTAATGCTCGTTTTATTTTTCTAAGCTGCCTGTATGGCAGTGAACTCAATGAAAACTGCCTTTTCTCCGTTCGGCTTTTTCTAAGCTGCCTGTATGGCAGTGAACAATGAAAACTGCCTTTTCTCCGTTCGGCTTTGTTTCTAAGCTGCCTGTATGGCAGTGAACAGGGTAAAACTGATTTTACAATCGACTCACTTTTTCTAAGCTGCCTGTATGGCAGTGAACGGTGCGGCGGATCAGTTTCCGCGATGGAATAATTTCTAAGCTGCCTGTATGGCAGTGAACGAAGAAGCTAGAAGTGCGGCGGATGAGTGGGATTTCTAAGCTGCCTGTATGGCAGTGAACTGATCGAGTGAATAGTGACATTGTGCTGAATTTTTCTAAGCTGCCTGTATGGCAGTGAACCCACTGAAACAAAATTAGCTGTCATTTATGGATTTCTAAGCTGCCTGTATGGCAGTGAACAAGGAAGCTGCAAAGGCTTCAATTGATGAAATTTTCTAAGCTGCCTGTATGGCAGTGAACTCAAGCATGTTACAGATACCACATATTTATGTTTTCTAAGCTGCCTGTATGGCAGTGAACTTTTCACCACAACTGGCATCACTTTTTGCAGATTTCTAAGCTGCCTGTATGGCAGTGAACTTTATACCGTTACGCCTGAACAAATTGGAACATTTCTAAGCTGCCTGTATGGCAGTGAACACTTTTAAGAATAAGAATACCTATTCTGCATATTTCTAAGCTGCCTGTATGGCAGTGAACTATTCCTTACCAATGACCGCAACGGCGATACTTTTCTAAGCTGCCTGTATGGCAGTGAACCATAATAAAAATAATAATAAAGAGGTCAGTATTTTCTAAGCTGCCTGTATGGCAGTGAACACTGTGACTCTTCTATAGCAGAGATCTATATATTTCTAAGCTGCCTGTATGGCAGTGAACCCCTTATGTCATGGGCGCATCGTGTGAAGTTTTTTCTAAGCTGCCTGTATGGCAGTGAACTAAAACAACAGATAGTTACGACTCGAACAACTTTTCTAAGCTGCCTGTATGGCAGTGAACTTCCAGAGGAAGGGAGCTGGTGGCTCGATAAATTTCTAAGCTGCCTGTATGGCAGTGAACACCATTTTCCCCCGCGCCCGCTGCCGCTAAATTTTCTAAGCTGCCTGTATGGCAGTGAACAAAAGTTTTAAGTTTGCTTTAAATTGCGCTTCTTTCTAAGCTGCCTGTATGGCAGTGAACGTTAATTGAATGAGCTGTGCAACCCGATAAGATTTCTAAGCTGCCTGTATGGCAGTGAACGCACTGTACCCGAAGCGACTGAGACAACGGATTTTCTAAGCTGCCTGTATGGCAGTGAACTGCGAGCGCAACTTGTTCTAGTGTTTCATTGTTTTCTAAGCTGCCTGTATGGCAGTGAACGCTTCTACAAGAAGTTTGGCTTTGAACATACATTTCTAAGCTGCCTGTATGGCAGTGAACTATTCATCAGAACATTCAAAACTATTTGCTCTTTTCTAAGCTGCCTGTATGGCAGTGAACTTATCAACTTTGCCTTTAGTCTTGGTTTTTGATTTCTAAGCTGCCTGTATGGCAGTGAACCACTAAATAATCCAAGCTCAATGGCAGTAGGATTTCTAAGCTGCCTGTATGGCAGTGAACATTTGTACGAATCTCTCAATCCTACAGTGAATTTTCTAAGCTGCCTGTATGGCAGTGAACAATTCTGGGCAGAACTTGTCCTCAATGGAATCTTTCTAAGCTGCCTGTATGGCAGTGAACGTGCAGCCCGATGCCATATGTACTATAACCACTTTCTAAGCTGCCTGTATGGCAGTGAACTCAGGATTGAAGAGGGTTATGCACCGATTGAGTTTCTAAGCTGCCTGTATGGCAGTGAACCTTCTCGTATGGGTCGTATTCGTGATGCATTATTTCTAAGCTGCCTGTATGGCAGTGAACCGTTACACGGTGGCATAGTTCGCCTGCACGTTTTTCTAAGCTGCCTGTATGGCAGTGAACAGTCACCTCAAATCGCTGTAGGCTTGCGATATT
75723 NZ_CP015950.1 Legionella-pneumophila-strain-E4_N Bacteria 685896-700932 15037 28 537 GGATGGGGAT GGATGGGGATGGGGACACGGCGACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGTGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCGGAGACGATTGGTGTACTTTCCGACACCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGGCGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACAGCCACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGCGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGATGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACAGCCACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGCGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGATGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACAGCCACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGTGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCGGAGACGATTGGTGTACTTTCCGACACCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGATGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACGGCGACCGCCAGCGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGCGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGATGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACGGCGACCGCCAGCGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGCGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGGCGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACAGCCACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGCGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGATGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACGGCGACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGTGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCGGAGACGATTGGTGTACTTTCCGACACCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGGCGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACAGCCACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGCGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGATGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACGGCGACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGCGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCTTTCGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGGCGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACAGCCACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGCGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGATGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACGGCGACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGTGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCGGAGACGATTGGTGTACTTTCCGACACCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGGCGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACAGCCACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGCGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGATGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACGGCGACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGCGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCGGAGACGATTGGTGTACTTTCCGACACCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACAACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGGCGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACAGCCACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGCGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACAACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGATGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACGGCGACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGCGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGGCGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACAGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACAGCCACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGCGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGATGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACGGCGACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGCGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACAACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGGTGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGATCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACGGCGACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGCGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACAACGGTGACCACTTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAATATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGATGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACAGGCCTGGTCTTTTTAAACGCCACCGCAGTGACGACGGATGGGGATGGGGATACGGCGACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGTGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCTGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCAGGGATTACCACAGGCAACACCATCTTTTCATTGGATGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACGGCGACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGTGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCGGAGACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACAACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGAGCGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACGGCGACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGTGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCGGAGACGATTGGTGTACTTTCCGACACCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCAGGGATTACCACAGGCAACACCATCTTTTCATTGGGCGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACGGCGACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGCGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGGCGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACAGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACGGCGACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGTGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGATGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACAGGCCTGGTCTTTTTAAACGCCACCGCAGTGACGACGGATGGGGATGGGGATACGGCGACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGTGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGATGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACAGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGATACGGCGACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGTGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACAACGGTGACCACTTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGATGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTAAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACAGCCACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGTGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCGGAGACGATTGGTGTACTTTCCGACACCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGGCGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACAGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACAGCCACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGCGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCAGGGATTACCACAGGCAACACCATCTTTTCATTGGGCGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTAAACGCCACCGCAGTGACGAC
75703 NZ_CP015946.1 Legionella-pneumophila-strain-E1_P-chromosome Bacteria 685896-700930 15035 28 537 GGATGGGGAT GGATGGGGATGGGGACACGGCGACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGTGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCGGAGACGATTGGTGTACTTTCCGACACCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGGCGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACAGCCACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGCGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGATGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACAGCCACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGCGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGATGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACAGCCACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGTGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCGGAGACGATTGGTGTACTTTCCGACACCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGATGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACGGCGACCGCCAGCGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGCGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGATGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACGGCGACCGCCAGCGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGCGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGGCGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACAGCCACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGCGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGATGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACGGCGACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGTGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCGGAGACGATTGGTGTACTTTCCGACACCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGGCGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACAGCCACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGCGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGATGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACGGCGACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGCGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCGGAGACGATTGGTGTACTTTCCGACACCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACAACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGGCGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACAGCCACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGCGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACAACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGATGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACAGCCACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGCGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGATGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACGGCGACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGCGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCGGAGACGATTGGTGTACTTTCCGACACCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACAACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGGCGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACAGCCACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGCGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACAACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGATGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACGGCGACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGCGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGGCGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACAGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACAGCCACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGCGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGATGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACGGCGACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGCGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACAACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGGTGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGATCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACGGCGACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGCGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACAACGGTGACCACTTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAATATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGATGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACAGGCCTGGTCTTTTTAAACGCCACCGCAGTGACGACGGATGGGGATGGGGATACGGCGACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGTGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCTGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCAGGGATTACCACAGGCAACACCATCTTTTCATTGGATGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACGGCGACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGTGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCGGAGACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACAACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGAGCGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACGGCGACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGTGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCGGAGACGATTGGTGTACTTTCCGACACCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCAGGGATTACCACAGGCAACACCATCTTTTCATTGGGCGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACGGCGACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGCGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGGCGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACAGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACGGCGACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGTGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGATGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACAGGCCTGGTCTTTTTAAACGCCACCGCAGTGACGACGGATGGGGATGGGGATACGGCGACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGTGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGATGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACAGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGATACGGCGACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGTGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACAACGGTGACCACTTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGATGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTAAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACAGCCACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGTGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCGGAGACGATTGGTGTACTTTCCGACACCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGGCGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACAGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACAGCCACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGCGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCAGGGATTACCACAGGCAACACCATCTTTTCATTGGGCGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTAAACGCCACCGCAGTGACGAC
11069 NC_008786.1 Verminephrobacter-eiseniae-EF01-2 Bacteria 1612297-1627218 14922 248 60 TTTCTGAGCT TTTCTGAGCTGCCTATCCGGCAGTGAACGACTGAATGCCGCGCCCTGATCCGTCAGATATTTTCTGAGCTGCCTATCCGGCAGTGAACGTGAATGTGAAGGGGCGCCCAGTGCGCGGGCTTTTCTGAGCTGCCTATCCGGCAGTGAACGCAAAATCGCTGTTGGCGACCATCTTTCCGAATTTCTGAGCTGCCTATCCGGCAGTGAACTGTTGAGCGATAATCTATCGAAAGACGGGACATTTCTGAGCTGCCTATCCGGCAGTGAACACCGGATACAGTTCGACGCCGGTGATTTGCTCTTTCTGAGCTGCCTATCCGGCAGTGAACGCCGAGTGTATGGGTTGTTGGCGAACCAGCATTTTCTGAGCTGCCTATCCGGCAGTGAACAGATTCGACGAACAAGCGAAAGACAGTGCCGCTTTCTGAGCTGCCTATCCGGCAGTGAACACATGGCAGGATACAAAGTTTTACACTTTTGGTTTCTGAGCTGCCTATCCGGCAGTGAACACTGGCCGCTGGGCGAGCCGCAATCTTGGCTTTTTCTGAGCTGCCTATCCGGCAGTGAACTTCCTCGGTTGGGCTGATCAAGGGATTGGGGTTTTCTGAGCTGCCTATCCGGCAGTGAACGCAGTACGTGTCTCGCGCCTACCTGCCCTGCCTTTCTGAGCTGCCTATCCGGCAGTGAACGCGCACGTTCTTGCAGATAATCTGTGGGTTTTTTTCTGAGCTGCCTATCCGGCAGTGAACGATTCGTACTTGAATAACGTCCTTTTCGTCAATTTCTGAGCTGCCTATCCGGCAGTGAACAAATCACCGGCGTCGAACTGTATCCGGTGACGTTTCTGAGCTGCCTATCCGGCAGTGAACACCGATGCCGCACGTTGCGAAGCAGCGATGATTTTCTGAGCTGCCTATCCGGCAGTGAACTCATCAATATGCGCAGCGACAGCGGCCCTGCATTTCTGAGCTGCCTATCCGGCAGTGAACTTGATTGACGTGTTGATCAATCGACAAACAAATTTCTGAGCTGCCTATCCGGCAGTGAACGCATGGTCATGAATGAAGAACAGATCGCACGCTTTCTGAGCTGCCTATCCGGCAGTGAACCGCGCAAGATCGTCGCGCAGCGCCACCTGGTGTTTCTGAGCTGCCTATCCGGCAGTGAACGAGCCGGTCGAGTTTCCAGATTACGAGCGTGTTTTCTGAGCTGCCTATCCGGCAGTGAACGTAGATAACATTCATGTCAATCTCCCAAAAATTTTCTGAGCTGCCTATCCGGCAGTGAACAGGGTTGTTGCTGAACTGGGATGATCTTGCTCTTTCTGAGCTGCCTATCCGGCAGTGAACTAGAAGCGCTGCACGGCATCCACGGCCGCGATTTTCTGAGCTGCCTATCCGGCAGTGAACAACCAGGACACACCAAAGCCCATGACGAACCCTTTCTGAGCTGCCTATCCGGCAGTGAACACGCCAGCGGATGGGCGTGGATGCGTGCGCGTTTTCTGAGCTGCCTATCCGGCAGTGAACAATAAGCAACGCTGTCCACTCTTGCGGGAGGGTTTCTGAGCTGCCTATCCGGCAGTGAACCCAGAATGCGGGCCTCAACCCGCATTCGGTTCTTTCTGAGCTGCCTATCCGGCAGTGAACTTATTTCGCGAATTGTCGGAAGTTTCTTTTTCTTTCTGAGCTGCCTATCCGGCAGTGAACAGTAGAAACCCTATAGACATGACGTTTTTGGTTTTCTGAGCTGCCTATCCGGCAGTGAACGCACACGCACGTGCACGCACGTGAGCGCGCCGTTTCTGAGCTGCCTATCCGGCAGTGAACGCATGGTCATGAATGAAGAACAGATCGTACGCTTTCTGAGCTGCCTATCCGGCAGTGAACGGCACGAAGATGGACCGTCCTGGTCTGAATATTTTCTGAGCTGCCTATCCGGCAGTGAACCCAAAACCCGATCACTTTGCATTTCACCCAGTTTTCTGAGCTGCCTATCCGGCAGTGAACACGTGTTGATCAATCGAAACCAACTTTTTTTATTTCTGAGCTGCCTATCCGGCAGTGAACGATCTTTTTTTCTCTTTCCAGCGAATCCGCTATTTCTGAGCTGCCTATCCGGCAGTGAACACTTGGCATCACGGCCCTATCGCCGCCAGGAGTTTCTGAGCTGCCTATCCGGCAGTGAACTTGCCGAATCTAAGTAGAAACCCTGATGACATTTTCTGAGCTGCCTATCCGGCAGTGAACGTGCTGAGCAGCAGCGGTTCATCGTCCGCTTCTTTCTGAGCTGCCTATCCGGCAGTGAACTTGTTTCAGGAGAGCGTTTCGCGTCTGGTATTTTTCTGAGCTGCCTATCCGGCAGTGAACGCAACCAATTTTTGCCGCCAAAATGTCAATATTTTCTGAGCTGCCTATCCGGCAGTGAACCGAAATCCGAATTCGCGTGCAAGGCCCCGGACTTTCTGAGCTGCCTATCCGGCAGTGAACAATGATGCACTTTGGTGCCTTGATTCTTTCGATTTCTGAGCTGCCTATCCGGCAGTGAACCGCGCAAGATCGTCGCGCAGCGCCACCTGGTGTTTCTGAGCTGCCTATCCGGCAGTGAACAATCGACGGAGAAAAGATCAAGATTCCAGGATTTTCTGAGCTGCCTATCCGGCAGTGAACGCGGATATGCATTGATCAGCGGCGGAGACTATTTTCTGAGCTGCCTATCCGGCAGTGAACAGGAAGGCCGTAGCGCGGCTTTCGACCATTCATTTCTGAGCTGCCTATCCGGCAGTGAACTTCTGCATTCACGCGACTGACGAGACCGACCCTTTCTGAGCTGCCTATCCGGCAGTGAACGGCCCACGGTTTGACAGATCGACAGCGGCAGTTTTCTGAGCTGCCTATCCGGCAGTGAACGGCACGAAGCTGGACCGTCCTGGGCTGAATATTTTCTGAGCTGCCTATCCGGCAGTGAACCTGGACGATATTGTTCGAATAACCAAAGGATTTTTCTGAGCTGCCTATCCGGCAGTGAACACCTCAAATAAGCAACGCCGTCCACTCTTGCGTTTCTGAGCTGCCTATCCGGCAGTGAACTCACATACCTGCGCCGTGGATGTCTTCGATTCTTTCTGAGCTGCCTATCCGGCAGTGAACATCAATGACTTAGCAGACCCCGTCAGCTGGTCTTTCTGAGCTGCCTATCCGGCAGTGAACAATCGACGGAGAAAAGATCAAGATTCCCGGATTTTCTGAGCTGCCTATCCGGCAGTGAACCCAGAATGCGGGCCTCAACCCGCATTCGGTTCTTTCTGAGCTGCCTATCCGGCAGTGAACTGGGATGATCTTGCTCGACAAGAAATTCACTCTTTCTGAGCTGCCTATCCGGCAGTGAACTGCGGTACACCGGAGGCGGGGGCTTTCAAATTTTTCTGAGCTGCCTATCCGGCAGTGAACATTTTCTCCAAAAGTTTCATTATCAAGTAGCCTTTCTGAGCTGCCTATCCGGCAGTGAACAATGGTCGAAAGCCGCGCTACGGCCTTCCTACTTTCTGAGCTGCCTATCCGGCAGTGAACGCCGGAGGTAATAGTTTGCGGCGATTCGGAATTTTCTGAGCTGCCTATCCGGCAGTGAACTACGTCGACCCGAAGACCGGCGCCACCTGGACTTTCTGAGCTGCCTATCCGGCAGTGAACGCATGGTCATGAATGAAGAACAGATCGCACGCTTTCTGAGCTGCCTATCCGGCAGTGAACGGTAAACCCGTATAATCCGTCCCTCATATGATTTTCTGAGCTGCCTATCCGGCAGTGAACTGGATACTGGCGTGTACAAAACGTGACTGAGCTTTCTGAGCTGCCTATCCGGCAGTGAACCGCGCCGAGCGCGACGACGGCTACAAGCAGATTTTCTGAGCTGCCTATCCGGCAGTGAACAACAACGACCAGGGCTACGACCGGCTCGACCTTTTCTGAGCTGCCTATCCGGCAGTGAACCGGTGATGCAGGACGGGCTTGCGTTGATCGAGTTTCTGAGCTGCCTATCCGGCAGTGAACGGGCTGCGCGCAAGATCGTCGCGCAGCGGGCTTTTCTGAGCTGCCTATCCGGCAGTGAACGTATATCACTCATATATCAGCCGTATTCATTCTTTCTGAGCTGCCTATCCGGCAGTGAACTTCAGTGTCGCGCCGCTCGCCAGCATTTCCCTTTTCTGAGCTGCCTATCCGGCAGTGAACGCGTGGTGCCGGCGGCAATGGTGATGCACGCCTTTCTGAGCTGCCTATCCGGCAGTGAACTCAGATTCCCGCTCACGCAGCGCCTGCGCGCATTTCTGAGCTGCCTATCCGGCAGTGAACTTTGCGGTGACCGGCGAATCGTGCTGCATCTCTTTCTGAGCTGCCTATCCGGCAGTGAACACTTTCTGATGCAGTGAAACTGGGGCCGTCGGTTTCTGAGCTGCCTATCCGGCAGTGAACGATAGTAGTCTGATGGCCTTGCCTGGCTTTCTTTTCTGAGCTGCCTATCCGGCAGTGAACTCAAGCGCCAGCGCAGCGCTCTCGATGAGCGCTTTCTGAGCTGCCTATCCGGCAGTGAACCGCAGATTATCTGCAAGCACATGCGCGGCAGCTTTCTGAGCTGCCTATCCGGCAGTGAACATCAGGGCGAAGGTAGGGGATAGTAGTCTGATTTTCTGAGCTGCCTATCCGGCAGTGAACACGAAGCCGGAGATTGATTATGTTTCGGTTCTTTTCTGAGCTGCCTATCCGGCAGTGAACGCAGCGTCAGGGGCGTGATCGTGCCACGGCATTTTCTGAGCTGCCTATCCGGCAGTGAACGTCCGTTGATAAAAACGATGCTGATCAAGCGCTTTCTGAGCTGCCTATCCGGCAGTGAACGTCAATACCACACAATAGAATCTGCTGCCAACTTTCTGAGCTGCCTATCCGGCAGTGAACGGCCGTCGAAGGCGACATCCGGCCTACGGGCATTTCTGAGCTGCCTATCCGGCAGTGAACCCGCCACCAGGCGCTCGTAGGCGGCGGTTTCATTTCTGAGCTGCCTATCCGGCAGTGAACAGTTGCTTGGCCTTGCTCCAAGACTTCGGGACTTTCTGAGCTGCCTATCCGGCAGTGAACGGTAAACCCGTATAATCCGTCTCTCATATGATTTTCTGAGCTGCCTATCCGGCAGTGAACGTGTACGTGAAGGGGCGCCCAGTGCGCGGGCTTTTCTGAGCTGCCTATCCGGCAGTGAACCAGCATCATACCATCGTCGTCATGCGTGATCATTTCTGAGCTGCCTATCCGGCAGTGAACAGCTGATTATGTTGCGTGAAGATCACGATGACTTTCTGAGCTGCCTATCCGGCAGTGAACTCGATGGGCGTCTATCCCTTCGCGCTCATACTTTTCTGAGCTGCCTATCCGGCAGTGAACGGGTTTTCCCTGCACCGGGTTTTCCCCTAGTATTTCTGAGCTGCCTATCCGGCAGTGAACCTCGGGAAGCGGCAAGGCCGGCGCTCCAGGTATTTCTGAGCTGCCTATCCGGCAGTGAACTAATCGGTGGGCATATTCAAGCATTTTCGCTTTTTCTGAGCTGCCTATCCGGCAGTGAACAGAAGGCCCTAGAAGGCCAGGGAAGGCCATCATTTCTGAGCTGCCTATCCGGCAGTGAACAAATGCGCCTTGCGCCACCCCGTCCGCCGTAGTTTCTGAGCTGCCTATCCGGCAGTGAACAGTCCCGCCACCGGGCTACTCACAATCTCGTTTTTCTGAGCTGCCTATCCGGCAGTGAACGCAAGGGGCATGACATGCCACTAGTAACCATCTTTCTGAGCTGCCTATCCGGCAGTGAACCGCGCCCAGGGCCGCGTCGGCGGGCGGCGCATTTTCTGAGCTGCCTATCCGGCAGTGAACGGCAGGGTCAATCGCACCTACACCGACATCGCTTTCTGAGCTGCCTATCCGGCAGTGAACGGAATTGAAAGAAGGCGACACGCTCGTAATCTTTTCTGAGCTGCCTATCCGGCAGTGAACTTTGAATGTACGCCACGTTTCCACCTCCGCCATTTCTGAGCTGCCTATCCGGCAGTGAACCGATTGACGTGTTGATCAATCGAAAATTTAGGTTTCTGAGCTGCCTATCCGGCAGTGAACGCCTGGCCGCTGCGCGCGCCCAGGGCCGCGTCTTTCTGAGCTGCCTATCCGGCAGTGAACCCGGCGGCTCTTGACACTTCCCGCGCTCATCGTTTCTGAGCTGCCTATCCGGCAGTGAACTAGGAAGGCCGTAGCGCCGCTTTCGACCGTTCTTTCTGAGCTGCCTATCCGGCAGTGAACATTCTTTCGAAGGGGTCGGTGCGGTTCATGATTTTCTGAGCTGCCTATCCGGCAGTGAACTTGCAGATTATCAGCAATAACCGCCGCGCCGGTTTCTGAGCTGCCTATCCGGCAGTGAACGGCTATATTCGCTGCGGCAGAAAGCGGGGGCTTTTCTGAGCTGCCTATCCGGCAGTGAACCAGATAATCGTCCCACATTTTGTCGAGCGCCGTTTCTGAGCTGCCTATCCGGCAGTGAACTAATACGCCCGGCCTGTATGTATCTGCGTCGCTTTCTGAGCTGCCTATCCGGCAGTGAACATTGCGATGACGGTGCAGGTTTTTGCGCTTCTTTTCTGAGCTGCCTATCCGGCAGTGAACCGATTGTTCGCTTGTTTGTCGAAGCGAGTAGTTTTCTGAGCTGCCTATCCGGCAGTGAACGGCCTTCTAGGGCCTTCTGGCGCGGCAGGGCATTTCTGAGCTGCCTATCCGGCAGTGAACAATGTCTCCGCGCGCGGAAGGCGGTTGAAAGATTTCTGAGCTGCCTATCCGGCAGTGAACTGTTGGTGATCCCACCTGGTGCCTGCGGGTGCTTTCTGAGCTGCCTATCCGGCAGTGAACGCCGCCATTCCCCGGCATCGCCCGGGCCGTGTTTTCTGAGCTGCCTATCCGGCAGTGAACACAGCCAACTAACCAACCCGAGCCGGCCTCCGTTTCTGAGCTGCCTATCCGGCAGTGAACGTGCCGATGTTGATTCTTTTGAAGGGGTCGGTTTTCTGAGCTGCCTATCCGGCAGTGAACCGCATCGGCGGGCGGCGCATGGTCATGAATGATTTCTGAGCTGCCTATCCGGCAGTGAACACCAAGCCGGTTCGCCGAATACCCAAACGCTTTTTCTGAGCTGCCTATCCGGCAGTGAACTAACTGAGAATATCGACACCAGCACCTGCATCTTTCTGAGCTGCCTATCCGGCAGTGAACCTCTCGTTTATACTTTTCCGCCGCTCCGTTGTTTTCTGAGCTGCCTATCCGGCAGTGAACCATACACAGAAACTACAGAAATTGGCGCGTACTTTCTGAGCTGCCTATCCGGCAGTGAACACCAAGCCGGTTCGCCGAATACCCAAACGCTTTTTCTGAGCTGCCTATCCGGCAGTGAACATGTCATGTCATTATGAACTAGCAGCAATTTCTTTCTGAGCTGCCTATCCGGCAGTGAACGGGTCAGGGTCAGGGTCAGCGCAGCGCCGCCTTTTCTGAGCTGCCTATCCGGCAGTGAACAGCTGCCGCGCCTGGTCAGCGGTCTGGACACCTTTCTGAGCTGCCTATCCGGCAGTGAACATGTAGCACTCCCAAAAACGTCATGTCTATAGTTTCTGAGCTGCCTATCCGGCAGTGAACAGCTGCGCGATGAGCTGACCGACGTGCAAGCTTTTCTGAGCTGCCTATCCGGCAGTGAACTGACCGGCAAGCTGCCGCGCCGTGCTGCTGCTTTTCTGAGCTGCCTATCCGGCAGTGAACGGGATGTGTTAGAGCCAAGCGTTTGGGTATGTTTTCTGAGCTGCCTATCCGGCAGTGAACGGCACCTCCCCGTCGTTTGAAGACAGCACCCCTTTCTGAGCTGCCTATCCGGCAGTGAACGGAATTGAAAGAAGGCGACACGCTTGTAATCTTTTCTGAGCTGCCTATCCGGCAGTGAACTTCTACAGACTACTTTGTACGAATCGAAATCTTTTCTGAGCTGCCTATCCGGCAGTGAACTTTTACTAGGCTTTCCGAAGTGATCATCCTGTTTTCTGAGCTGCCTATCCGGCAGTGAACACGGCCCTATCGCCGCCAGGAGGCCGTAGGAATTTCTGAGCTGCCTATCCGGCAGTGAACGTATATCACTCATATATCAGCCGTATTCATTCTTTCTGAGCTGCCTATCCGGCAGTGAACGCCCGCGCCATCGGCATAATCTTCAGCGACGATTTCTGAGCTGCCTATCCGGCAGTGAACTACGCCATATTCCCCCATACACCGGGCGGATATTTCTGAGCTGCCTATCCGGCAGTGAACGCGGCGACGGCCTCGCGGCATGCGCGGTGCGCTTTCTGAGCTGCCTATCCGGCAGTGAACGCGCTGCTGGGCGCTGAATGGGCGCCGCTGGTTTTCTGAGCTGCCTATCCGGCAGTGAACGGTGCGCAATCGCTGACCAGGTCGCCATGAGCTTTCTGAGCTGCCTATCCGGCAGTGAACCTTTCTAGCGGCCCGTGGCAGGTAGAAGGGCCTTTCTGAGCTGCCTATCCGGCAGTGAACGTGCTACTCATAATCGCGTGGGCTTTGGATATTTTCTGAGCTGCCTATCCGGCAGTGAACCGCCGGTTCTTGCTGTTGCGCTCGTCTTGATCTTTCTGAGCTGCCTATCCGGCAGTGAACAAGTGTCAAAAGACGACGACAGTATGCGTCTTTTTCTGAGCTGCCTATCCGGCAGTGAACCGCTGCGACTCGTCGCTGAAGATTATGCCGCGTTTCTGAGCTGCCTATCCGGCAGTGAACGGCGGGTAAGCACGCAGAATCTGATTCGCGAATTTCTGAGCTGCCTATCCGGCAGTGAACTAGCCCGGGCGTATTCATTGTCCACGCCATAGTTTCTGAGCTGCCTATCCGGCAGTGAACCCCGGGGCTTGCAAGTCCACCGGGACATGTATTTTCTGAGCTGCCTATCCGGCAGTGAACGCCCGCGCCATCGGCATAATCTTCAGCGACAATTTCTGAGCTGCCTATCCGGCAGTGAACAGGTTGCGAAGTTTTACACTTTAGGGGCTTGCTTTCTGAGCTGCCTATCCGGCAGTGAACGAATGCTGGCACGCTTCGCATTTTGACGGGGCTTTCTGAGCTGCCTATCCGGCAGTGAACCGGGCTGCTGCAAAGGCGCTGGCGCGGCAACCTTTCTGAGCTGCCTATCCGGCAGTGAACCGCACGCACGTGCAGATGCAGGTCAAGGTCAATTTCTGAGCTGCCTATCCGGCAGTGAACAATGTGTTTCGCGACAGCGTCGCGATATGCGTTTTCTGAGCTGCCTATCCGGCAGTGAACATCGTCCAGAATGCGGGCCGCAACCCGCATTCTTTCTGAGCTGCCTATCCGGCAGTGAACAATGATGCCCGCGCGGCGCTTGCCGCCAAGGATTTCTGAGCTGCCTATCCGGCAGTGAACGCGGGCTGTGGAAACACATGGCCCGCATCATTTTTCTGAGCTGCCTATCCGGCAGTGAACACCAAGCCGATTCGCCGTATACCCAAACGCTTTTTCTGAGCTGCCTATCCGGCAGTGAACAAGCCGCAGCGACCCGCAGCGGGTCAGCATCGTTTCTGAGCTGCCTATCCGGCAGTGAACGAAGGAGTAAAATCATGAGCGAATATGTGAGCTTTCTGAGCTGCCTATCCGGCAGTGAACGGGGAAAATGCGGATTTCGATTCGTACAAAGTTTTCTGAGCTGCCTATCCGGCAGTGAACCGCCATTTGCTGCCCAGCAGCGCCAGGGCATCTTTCTGAGCTGCCTATCCGGCAGTGAACAATAAGCAACGCTGTTCGCTCTGTCGGGCGGTTTTCTGAGCTGCCTATCCGGCAGTGAACGCGCGCCCAGGGCCGCATCGGCGGGCGGCGCATTTCTGAGCTGCCTATCCGGCAGTGAACTGGAGGCATTCTTTCTGCCGACCTGCTCGGATTTTCTGAGCTGCCTATCCGGCAGTGAACAGTGACCTGCCGCTTCAATACCAGGTGCAGATTTTCTGAGCTGCCTATCCGGCAGTGAACAAATCAGGGCTTATCCCATAATCACCCGCGATTTTCTGAGCTGCCTATCCGGCAGTGAACCTGCTCGCCGCCCGCTAGCTGCGGCCCGACGTTTTCTGAGCTGCCTATCCGGCAGTGAACCGTGCAACCGGTCTTGCGTTTCCCCATCGTGATTTCTGAGCTGCCTATCCGGCAGTGAACTGCAGCAGATGCCACATCGCACATCATGAGAATTTCTGAGCTGCCTATCCGGCAGTGAACTTTTACGTTGAAATCGGCCAAACCGCCATGTTTTTCTGAGCTGCCTATCCGGCAGTGAACGCGCTGCGCGAAAGTCACAGAGATATGCAGCTTTTCTGAGCTGCCTATCCGGCAGTGAACGCCAGCAAGTACTACGGCGTGCCCCGCGTTGTTTTCTGAGCTGCCTATCCGGCAGTGAACAGGCCGGCAATTGTCCGATCACGCATCTGACCTTTCTGAGCTGCCTATCCGGCAGTGAACGATATATTGGTCAATTCTGTACCGCGCAGGCTTTTCTGAGCTGCCTATCCGGCAGTGAACTTCCGTCAAAAGTCCGCACGTCATCCCAAATTTTTCTGAGCTGCCTATCCGGCAGTGAACACGATCTGGATTGCCCAGTTCGTGGGCAAAGATTTCTGAGCTGCCTATCCGGCAGTGAACCACTGGCGCGCAGTCTGATGCATTCACGATCTTTTCTGAGCTGCCTATCCGGCAGTGAACCCAGAATGCGGGCCTCAACCCGCATTCGGTTCTTTCTGAGCTGCCTATCCGGCAGTGAACGCTGCACGCACCGAGGCCGCGCGCTGCGCCGATTTCTGAGCTGCCTATCCGGCAGTGAACAGTTTTCAAATGGAAATACGGAGACGACGAATTTTCTGAGCTGCCTATCCGGCAGTGAACAGACAGCCCCATTCCGCATCGAACCCGAGTTCTTTCTGAGCTGCCTATCCGGCAGTGAACAATATCAAAGTGATCTTTTCGGCCATGAAGATTTTCTGAGCTGCCTATCCGGCAGTGAACAGTTGGAACCCCCGGCGCGCCACCGACGCGGTTTTCTGAGCTGCCTATCCGGCAGTGAACCTTGATTGCAATATTCGACAAGCTGAATACTTTTTCTGAGCTGCCTATCCGGCAGTGAACGGCATCAGTCACGTACGTGCTGCACGCAACGATTTCTGAGCTGCCTATCCGGCAGTGAACGCAGTCTGTATCTTCTTTCTCGACGGGATTTTTTTCTGAGCTGCCTATCCGGCAGTGAACGCGCTAAGGGCCGCATCGGCGGGCGGCGCATGTTTCTGAGCTGCCTATCCGGCAGTGAACTAACTGATAATATCGACACAAGCACATGCATCTTTCTGAGCTGCCTATCCGGCAGTGAACGATGATTCGTGCTAGTCTGACAGCAGATCGTATTTCTGAGCTGCCTATCCGGCAGTGAACGATTAATGACAGCTTCGCTATCGAAAGCTATCTTTCTGAGCTGCCTATCCGGCAGTGAACTGGGATGATCTTGCGCTGCAAGAATTGCGATCTTTCTGAGCTGCCTATCCGGCAGTGAACATCTGGCATGACCGCCGGGGGCTAGCGATAGTTTTCTGAGCTGCCTATCCGGCAGTGAACGCAACGGCTCGATCAGAGGCGGCGGCGGATGGTTTCTGAGCTGCCTATCCGGCAGTGAACCGCACCGATGCCGCGCGCTGCACCGATGCCCTTTTCTGAGCTGCCTATCCGGCAGTGAACTGCCGGTCGACCTTGGTGCGCATGCTCAACGCTTTCTGAGCTGCCTATCCGGCAGTGAACAGTTGGAACCCCCGGCGCGCCACCGACGCGGTTTTCTGAGCTGCCTATCCGGCAGTGAACTATGAGATAATGCCGGGCTTCGGCCCGGCAATTTTCTGAGCTGCCTATCCGGCAGTGAACGCGGGGCAGTTCGGGCGGTGGGTGTACGTGAATTTCTGAGCTGCCTATCCGGCAGTGAACATGGCGATGGGCTTGGCCCTGGGGTTCGGCACTTTCTGAGCTGCCTATCCGGCAGTGAACGATTTCTTGATTAGTGAGCATGATTTTCCCCTTTTCTGAGCTGCCTATCCGGCAGTGAACGTTCCTTCGTTGAAAGGCGTAGATCGTATCAATTTCTGAGCTGCCTATCCGGCAGTGAACGAATGTACGCCACGTTTCCACCGCCGCCGGGTTTTCTGAGCTGCCTATCCGGCAGTGAACACTGTAGCACCCCAAAAACGTCACGTCTATAGTTTCTGAGCTGCCTATCCGGCAGTGAACAACCGTGGGCCGCATCCCCGGCCACGGCACCTTTTCTGAGCTGCCTATCCGGCAGTGAACGACATGACATGACATCCAGCCCGCCCTGCGCGTTTCTGAGCTGCCTATCCGGCAGTGAACCGATAAAATCACGCGCATTTTCTTCGCTGAGTTTTCTGAGCTGCCTATCCGGCAGTGAACATTCGCAATCTGCGCAGCAATCTATCGGCAAATTTCTGAGCTGCCTATCCGGCAGTGAACCGTGCGGCAATCTTGCCCTGGCTTTCCAACGATTTCTGAGCTGCCTATCCGGCAGTGAACGCGGATATTCATTGATCAGCGGCGGAGATTATTTTCTGAGCTGCCTATCCGGCAGTGAACCCGATTATCATTATCAGGACATTCTATTATAATTTCTGAGCTGCCTATCCGGCAGTGAACATGCCAAAGCGGCTGGAGAAATCTGCTGCGCG
23426 NC_017454.1 Geobacter-sulfurreducens-KN400 Bacteria 1485509-1500158 14650 239 61 GTGTTCCCCG GTGTTCCCCGCATGCGCGGGGATGAACCGATGGCACGGGTGAGGAGTTCCTGCAGCATCTCGTGTTCCCCGCATGCGCGGGGATGAACCGCTCCAGAAACAGCTCCTGGACGTCCAGAAGGAGTGTTCCCCGCATGCGCGGGGATGAACCGCCGTCGCCCTCCTTGGCGCGAACGGCGTTCATGTGTTCCCCGCATGCGCGGGGATGAACCGTTCAAGGCAGTCATGCGGTGGTCATCGGCCACGTGTTCCCCGCATGCGCGGGGATGAACCGGCTTTCTCGGGATGAGATGCTGGTGGCTTTGAGTGTTCCCCGCATGCGCGGGGATGAACCGCGACTTATCAAAACTGACAGGATTCCCGGTACGTGTTCCCCGCATGCGCGGGGATGAACCGCCACTTGGCGGGATTGCCACTTATGACCACCTGTGTTCCCCGCATGCGCGGGGATGAACCGACATTGAAGGCCGGGACATCGAACATTATTGAGTGTTCCCCGCATGCGCGGGGATGAACCGGTGCGTGATTTTGATCGGCTGTCTTTGACAGCGTGTTCCCCGCATGCGCGGGGATGAACCGAGTTTCATGACTTTTTCCTGCGCTGGGGTTAAGTGTTCCCCGCATGCGCGGGGATGAACCGTTGATGCACGCGAGGGCGCCAGAGCCTTTGCGGTGTTCCCCGCATGCGCGGGGATGAACCGTGATAGGCAACGACACGGCCGGTTTTTGGGTCGTGTTCCCCGCATGCGCGGGGATGAACCGGCTGATGGACGTACTCCAACGTCTTGGGCCCGGTGTTCCCCGCATGCGCGGGGATGAACCGGTGGAGTTGACGGTGTAGAGCTTGGCCGAACCGTGTTCCCCGCATGCGCGGGGATGAACCGTGACGGGAAAATGTCATAATGTGGTTGGCGATGTGTTCCCCGCATGCGCGGGGATGAACCGGCCAAATTCGCAAAAAACGCCACCACGTAAGGGTGTTCCCCGCATGCGCGGGGATGAACCGTGGGCGGACACCCGGGAGGCCGACGGGAACTAGTGTTCCCCGCATGCGCGGGGATGAACCGGCACGGAGGTTACGGAAATGATCAGACTGTTTGTGTTCCCCGCATGCGCGGGGATGAACCGGCAATGTCGGCCACGGGGATGGCCTTGCAGCAGTGTTCCCCGCATGCGCGGGGATGAACCGGCCGAAGAAGAGATCAAGAGGTTTCAACGCACGTGTTCCCCGCATGCGCGGGGATGAACCGGCAAATTATCAGGTAACATCTGATCAGGTCAAGTGTTCCCCGCATGCGCGGGGATGAACCGTCGTGGTTGCGATTTTGAATAGCGGCGTTGCTGTGTTCCCCGCATGCGCGGGGATGAACCGTTGAGCAGTAGGAGAACCACCAGGAAACCATAGTGTTCCCCGCATGCGCGGGGATGAACCGGTCTGGTCCGAGGCGGCCTCGGCCGCCGGGGTGTGTTCCCCGCATGCGCGGGGATGAACCGGTGACCTTGCCGTAGGTGCTGCCTGCGGGGTTGTGTTCCCCGCATGCGCGGGGATGAACCGAAAACCCTCTCCCCTGCCGCCCTAGCGGCCCGGTGTTCCCCGCATGCGCGGGGATGAACCGCGTTCCGGCGCGCTGCTGGTCCAGGTTGGCCAGTGTTCCCCGCATGCGCGGGGATGAACCGACCCTGGCGGACACCGGCGTCAGGTTCAAAAAGTGTTCCCCGCATGCGCGGGGATGAACCGCTCAAATGCTGGCCCCTCCGGGAGCATGGGGCGTGTTCCCCGCATGCGCGGGGATGAACCGCTTCAATATCGGTACTCGACCGCTCATTTTTGGTGTTCCCCGCATGCGCGGGGATGAACCGTCACTCGGCGCCTGGGCCGCTCCCCCTCATCCGTGTTCCCCGCATGCGCGGGGATGAACCGCCCTCGTGGGCGATGGCGCCGGAGGCGGCCAGGTGTTCCCCGCATGCGCGGGGATGAACCGCCCGGAGTGATTTTGCGGGGGCCATGATCATAGTGTTCCCCGCATGCGCGGGGATGAACCGGTAGTCTGCGTTGAGGCAGACATCAAATGGCTGTGTTCCCCGCATGCGCGGGGATGAACCGCCCAACCAGAAACCCCGCGACGAGCACCTTCGGTGTTCCCCGCATGCGCGGGGATGAACCGATGCCGATTTGGCGGGGTAGCGGTCGTTATGAGTGTTCCCCGCATGCGCGGGGATGAACCGGTGTCGGTGGCAGAACCCTTGACGATGACGTAGTGTTCCCCGCATGCGCGGGGATGAACCGTGGCCAACCTCGCCACCATTCCCAAGCGCGGCGTGTTCCCCGCATGCGCGGGGATGAACCGGAGACCGTTGACGCAGCCCTGGCCATGGAGCGGTGTTCCCCGCATGCGCGGGGATGAACCGGCGGCCCGGGAACGAACCGCAGCTGACAAGGCGTGTTCCCCGCATGCGCGGGGATGAACCGAAAACGCTCCAGCTCACCGGGGCGCTGAGGGGGTGTTCCCCGCATGCGCGGGGATGAACCGACCGAAGTGGTCGAGACGGCTGCGGCGATCGGGTGTTCCCCGCATGCGCGGGGATGAACCGGACCGAGAAACGCGAGGAATGCAGGCATTTACGTGTTCCCCGCATGCGCGGGGATGAACCGCCGCCGCAAAGTTATCATGCGGCGGCAGTCTCGTGTTCCCCGCATGCGCGGGGATGAACCGTTGTCTTTTTCCTTTGAAGTTTTGGGCATATTGTGTTCCCCGCATGCGCGGGGATGAACCGTTCGGCGGCATGGCGGGGCGGGGGCGCAAAGTGTGTTCCCCGCATGCGCGGGGATGAACCGACGATTCCTCCGGTGCGGTAGATGTGTTGGTAGTGTTCCCCGCATGCGCGGGGATGAACCGCTCGGCGCTCTGCAACTCAAAGCCGCTGCCTCGTGTTCCCCGCATGCGCGGGGATGAACCGTAGTAGAACCGAGCCGCTCTCTGGATATCGGTGTGTTCCCCGCATGCGCGGGGATGAACCGCGGCGGCTGCCGTGATGAGGCTGATTTCCGGCGTGTTCCCCGCATGCGCGGGGATGAACCGCTGAGTGCGCCGGGCTTGGTTGGGGTCCTCCAGTGTTCCCCGCATGCGCGGGGATGAACCGGCACGGCGGCAACGGTTGGAGGCTGCGCGCCAGTGTTCCCCGCATGCGCGGGGATGAACCGGCGTAGCCATGGGCAAGCGCAGCGACCTGGAAGTGTTCCCCGCATGCGCGGGGATGAACCGCTCCAGCCGCAGGCGATGCTCGGCCTTGCCCAGTGTTCCCCGCATGCGCGGGGATGAACCGGTGTTGACCGGGACGCCAGCACGCCAGCCCCCGTGTTCCCCGCATGCGCGGGGATGAACCGGTCATGGTCTGCTCGTGCCGGCAATGGGGACAGTGTTCCCCGCATGCGCGGGGATGAACCGGTGCAGTTGAGGGTCCAATGATCAACGCATTCGTGTTCCCCGCATGCGCGGGGATGAACCGTCAGAAACGGCGGGGTAGCCGCATTCCACCACGTGTTCCCCGCATGCGCGGGGATGAACCGGAGACCCACGCCATGGCAAACACCCTTACCGGGTGTTCCCCGCATGCGCGGGGATGAACCGTTCCGGTAGAAAGTCACGTATTGCCGGTCCTAGTGTTCCCCGCATGCGCGGGGATGAACCGGCCCGCCATGAAAACCCTGACCCTGACCCTGAGTGTTCCCCGCATGCGCGGGGATGAACCGTCGGTGGGGCCTTTGGCATCGGTGGGACGCTCGTGTTCCCCGCATGCGCGGGGATGAACCGACGATTCCTCCGGTGCGGTAGATGTGTTGGTAGTGTTCCCCGCATGCGCGGGGATGAACCGCGGCTCACCAAGGGGCATCAGATTCCACGATTGTGTTCCCCGCATGCGCGGGGATGAACCGCGCATAGCCGTTATGTCACTCTGCAACATTGCGTGTTCCCCGCATGCGCGGGGATGAACCGCTGCCGCGGGAACTCCACTGCCATCCGCTCCTGTGTTCCCCGCATGCGCGGGGATGAACCGGCACCCGCGCCGCAATGCCCGTCATGGCCGGAGTGTTCCCCGCATGCGCGGGGATGAACCGCAAAAAACATAAACACATGGCACAAATGCTTGGTGTTCCCCGCATGCGCGGGGATGAACCGATCGCCATGAAGGTTACGTCCACCGGTAGCCAGTGTTCCCCGCATGCGCGGGGATGAACCGGCTGCGAGGATGTCGTTCTGGATCTCGGTCAGGTGTTCCCCGCATGCGCGGGGATGAACCGTTAAACTCGCCACGCTTGAAGACGTCGTCAGCGTGTTCCCCGCATGCGCGGGGATGAACCGATTACGCCCTGGCTCTCAACCAGGCCCAGAACGTGTTCCCCGCATGCGCGGGGATGAACCGGTGGTGTCGGATGATGAAGGGGGGCAGTGATGGTGTTCCCCGCATGCGCGGGGATGAACCGAGGCGAAGGTCGCCGCCATGTTCGGCAATAGCGTGTTCCCCGCATGCGCGGGGATGAACCGGGACAAAATCGCCATAGCCTGTCAGGAAATGAGTGTTCCCCGCATGCGCGGGGATGAACCGGCCTTTGCCAAGCAAATTCAGTACGATCCATCGTGTTCCCCGCATGCGCGGGGATGAACCGGAGGCTGCCGTGGCACTTACTGAGCGAACCATGTGTTCCCCGCATGCGCGGGGATGAACCGCGGCGGAATCCATTGCCGAGGAAACGTTCGGGGTGTTCCCCGCATGCGCGGGGATGAACCGTTGTAATTGTATTTTATAGCCCGGATATGGAAGTGTTCCCCGCATGCGCGGGGATGAACCGGTCAGGCGGTCCCGCCAGTCGCGGACGGTCCCGTGTTCCCCGCATGCGCGGGGATGAACCGGCGATTGTGTCGGGCGACCCGATAGCGGCGAGGTGTTCCCCGCATGCGCGGGGATGAACCGGCCCACCCCACCCATGATCCCGGTCTGTGTTGGTGTTCCCCGCATGCGCGGGGATGAACCGGTCAGGTTGCTTTGAGTAGTTATGACGATTCCGTGTTCCCCGCATGCGCGGGGATGAACCGGAGCAGCAATTTCGGCAGCAGTCAATGCCAAAGTGTTCCCCGCATGCGCGGGGATGAACCGGGAAAATCGGCGCCAAATCAAAATTGTTTTGAGTGTTCCCCGCATGCGCGGGGATGAACCGATGCTCACTCAATTTTTGTTCGGTCGTCTGCCGTGTTCCCCGCATGCGCGGGGATGAACCGAACATTGGAGGGAAAATCACATGGTAGAGAATGTGTTCCCCGCATGCGCGGGGATGAACCGCGTCAATTGAATCAGTCGCGTTTGAAAAGGACGTGTTCCCCGCATGCGCGGGGATGAACCGGTAATCAGCGACTACGTGACCAAGGGCGATGCGTGTTCCCCGCATGCGCGGGGATGAACCGGTATTCCCGCTGCAGTCGGCCAAATAGTGGTCGTGTTCCCCGCATGCGCGGGGATGAACCGCTCGGCTGGAATGTGCTTTTAATCGCTCACAGGTGTTCCCCGCATGCGCGGGGATGAACCGTTGCAGTCGGACGCGGGCACGCCGATCAGGCAGTGTTCCCCGCATGCGCGGGGATGAACCGGAACACGCGAGCGACCTGAATCATTTTTTCACGTGTTCCCCGCATGCGCGGGGATGAACCGGCGGATCGGCAGCCACCCCGTGGCCGCCCACTGTGTTCCCCGCATGCGCGGGGATGAACCGGTTACGTGGCGCTGAATCCGGCCACCTACAGCGTGTTCCCCGCATGCGCGGGGATGAACCGCGGTATCGCCATTTCCTGCGAAATTGTCGGAGGTGTTCCCCGCATGCGCGGGGATGAACCGTATCCGCCAGAAGGTTTCGAGGCTGTGGTGCAGTGTTCCCCGCATGCGCGGGGATGAACCGTTTCTTCTCTTCAGCGTATTTTAACACGTCCCGTGTTCCCCGCATGCGCGGGGATGAACCGCATGTGCCAGACGCACTGTACAGCGAGTACATGTGTTCCCCGCATGCGCGGGGATGAACCGGCTGTCGAGAAGGCGATACTTGACCTCTATGCGTGTTCCCCGCATGCGCGGGGATGAACCGGTGTAAGTGTTACAAACCCATTGTACAGACTAGTGTTCCCCGCATGCGCGGGGATGAACCGTAGCTATAAAACTGCGTAAACAGGCGCACGAAGTGTTCCCCGCATGCGCGGGGATGAACCGAGGTGGGAGCGCGTCTCTGGGATGTGGCATGGGTGTTCCCCGCATGCGCGGGGATGAACCGCTGGTCTATCTCGGTTGGGAGGTGGAACGTAGGTGTTCCCCGCATGCGCGGGGATGAACCGTGAATGAAGCGCAATACCTTGTCGATATGGACGTGTTCCCCGCATGCGCGGGGATGAACCGATTTACGTAGGCTGGCAGCGCCTTCTCGACAAGTGTTCCCCGCATGCGCGGGGATGAACCGATGAACAGCTCGCTGTTTCGCAGGACAGCACTGTGTTCCCCGCATGCGCGGGGATGAACCGCACAAAAAAAGGGGGCCAATTAGCCCCCATAAGTGTTCCCCGCATGCGCGGGGATGAACCGTACCTAGACGGCAGCAGCCGGCGGCAGGGAGAGTGTTCCCCGCATGCGCGGGGATGAACCGGCATAACAGCTTGAGGCTTTGCGGGCATCACCGTGTTCCCCGCATGCGCGGGGATGAACCGTTACCGTCCCGCATCATGGAGCGCAGCGGCTCGTGTTCCCCGCATGCGCGGGGATGAACCGAACGATTGACTTTCGAAACATGACAGAGCAATGTGTTCCCCGCATGCGCGGGGATGAACCGGGTATAGCTCTTCAAATCTTCCGGACGATGAGGTGTTCCCCGCATGCGCGGGGATGAACCGAAGAAGCGCAATGTGATCCTCTCGGCGATCATGTGTTCCCCGCATGCGCGGGGATGAACCGTGGAACCGGCAGCAACTAACCGAGTTTATCACGTGTTCCCCGCATGCGCGGGGATGAACCGATCGTGGCGAACGCTTTGGCGAACGATTGAATGTGTTCCCCGCATGCGCGGGGATGAACCGGTGCAGTTGAGGGTCCAATGATCAACGCATTCGTGTTCCCCGCATGCGCGGGGATGAACCGCTCACTGGCTCGGCACCGCAGCGGCCATTGGCGTGTTCCCCGCATGCGCGGGGATGAACCGGTGGGCTCCATACTGCGACCGCGCACTAGAACGTGTTCCCCGCATGCGCGGGGATGAACCGGCCACCGACGGCATCGACCTGGATGATTTCGAGTGTTCCCCGCATGCGCGGGGATGAACCGAACCCTGGAGATGGAAACGGCTGCCGCCGGTGGTGTTCCCCGCATGCGCGGGGATGAACCGCGCCTCTCCGACCACTTCACCCTGCGAGAGATGTGTTCCCCGCATGCGCGGGGATGAACCGGTACCGGAGGAGTATGCCGATTTCACCGCTCCGTGTTCCCCGCATGCGCGGGGATGAACCGGCAATGGTGGACGAGCTCGGTATAGGTAACCAGTGTTCCCCGCATGCGCGGGGATGAACCGATCGCCGCCATGTTCGGCAACTCGGCCGAGGAGTGTTCCCCGCATGCGCGGGGATGAACCGTAGCTTACCCTTACGTGTTGCCTTGATGATTTGTGTTCCCCGCATGCGCGGGGATGAACCGGTTGATTAGATTGTGCATTGGATTGTTGTGCTGTGTTCCCCGCATGCGCGGGGATGAACCGGGGGGCGACGATGACGCGTGAAGACCTGCTCGGTGTTCCCCGCATGCGCGGGGATGAACCGATATGGCGCCAGATGGGGTCGTCATGCCGGAAGTGTTCCCCGCATGCGCGGGGATGAACCGCCGATTTCGTTCCGGTAAATGTGTTTTGCTTAGTGTTCCCCGCATGCGCGGGGATGAACCGCGACGGTGCCGCTCTTGGAGACTACGCCGATCGTGTTCCCCGCATGCGCGGGGATGAACCCTTCGGTCCCTTCCGAAGAGGGGCCTCAACAACGTGTTCCCCGCATGCGCGGGGATGAACCGTCAATGAACTGGCCCGCTCCTGAGAGGGTTATGTGTTCCCCGCATGCGCGGGGATGAACCGGGTGTGGTCGCCAGGACCGCCGGATTGATCGGGTGTTCCCCGCATGCGCGGGGATGAACCGGCGTTCGGGGGGAAATAGGATCAATGGAAGGCGTGTTCCCCGCATGCGCGGGGATGAACCGAAAGGGGAGGGGGAGAGCAGCATGAAATGTGAGTGTTCCCCGCATGCGCGGGGATGAACCGCTCCGGCTTATCATCAGGAGCACTACCACAGCGTGTTCCCCGCATGCGCGGGGATGAACCGGCATTCTCAGTCTTGAGGACGGCGCCCACTTCGTGTTCCCCGCATGCGCGGGGATGAACCGTGGCTATCTGCCCTGTGGGGTGCTGGCCCTATGTGTTCCCCGCATGCGCGGGGATGAACCGGCCATCGCGCAATTCTGAAGTTATATCAGAAAGTGTTCCCCGCATGCGCGGGGATGAACCGATGCTGTCAACGGCCTGCCGTTGGTAGGGACGGTGTTCCCCGCATGCGCGGGGATGAACCGTGGTCACTGACCTGTGGTACCTTGATGGTTGGGTGTTCCCCGCATGCGCGGGGATGAACCGAACAGCGGAAGCGTTTCCCGTGGATGAATGATGTGTTCCCCGCATGCGCGGGGATGAACCGCTGGCCGAAGAGCTGCACAAGACGTACGGCGAGTGTTCCCCGCATGCGCGGGGATGAACCGCGCGCCGGTACCGGAGGTGCCATTGATGTAGAGTGTTCCCCGCATGCGCGGGGATGAACCGGTGCGCTCGCCCTCGGGTTCGGCTTTGGCACGGTGTTCCCCGCATGCGCGGGGATGAACCGGCACTGGTTATGCTCCAGGATGAGGGGAACAGGTGTTCCCCGCATGCGCGGGGATGAACCGCTCGGACGCAAGCCTTACTCGGTGGATTCCTTGTGTTCCCCGCATGCGCGGGGATGAACCGGCCGAACCGATGCTCGTGGTCGAGGAGATCGCGTGTTCCCCGCATGCGCGGGGATGAACCGCGCCTTCTTCAGGGGGAAGCTCAATATCCCCAGTGTTCCCCGCATGCGCGGGGATGAACCGATGGTTACTGGGTCTCATGTGCGTACCTCTCTGTGTTCCCCGCATGCGCGGGGATGAACCGTTCTATGTAATAGGGGGTGTGGGGTCAGACTCGTGTTCCCCGCATGCGCGGGGATGAACCGACTATCACGTCGCCCAGTGCCGGCAGGAGGGTGTGTTCCCCGCATGCGCGGGGATGAACCGGCGGCTTCATCGGCCGCGTCGCGGGGGAGCCCGTGTTCCCCGCATGCGCGGGGATGAACCGCAGGATGGCGGCGCCACTTCCTTCATAAATGTGTGTTCCCCGCATGCGCGGGGATGAACCGATGCCGACCGATTCGGCCTGGATCCGGACCAGGTGTTCCCCGCATGCGCGGGGATGAACCGTATCAACATCTTATAACCACGAATACACGTATGTGTTCCCCGCATGCGCGGGGATGAACCGTACTGTTTTTAACTCTTACAGTGCTCGTCTCGGTGTTCCCCGCATGCGCGGGGATGAACCGTTCGGGAACAACATTAGGCTCTAAAGAACCGTGTGTTCCCCGCATGCGCGGGGATGAACCGGGGGCTATAGCGGGCCTGAAGGCCGCCGGGTTGTGTTCCCCGCATGCGCGGGGATGAACCGGAGGTAACTGATGGAACAAGCATCGGGCGGTAGTGTTCCCCGCATGCGCGGGGATGAACCGGTCGTACTCGATATCCAGAAAGAGGCCAACGAGTGTTCCCCGCATGCGCGGGGATGAACCGGTCGCTCCACCCATCACCCCATGACAAGGATGGTGTTCCCCGCATGCGCGGGGATGAACCGGCGAATGGCTACAGCGGCGGCGTGCGTTGAACGTGTTCCCCGCATGCGCGGGGATGAACCGATGCACTTTGCCAACGATAAGCGTCCCCGCCGGTGTTCCCCGCATGCGCGGGGATGAACCGGACATCCACCGCCTCCTCCGCGACGGGTTCAGGTGTTCCCCGCATGCGCGGGGATGAACCGACAATGTTTTCCCCTCCTTTCTGTGTGTTGCCGTGTTCCCCGCATGCGCGGGGATGAACCGGCCGCCCAGCTCGGGCAGGCCGAGGAGGCCGTGTGTTCCCCGCATGCGCGGGGATGAACCGGTCTTCGCGCTATCGATCACGGGTATGGTCGAGTGTTCCCCGCATGCGCGGGGATGAACCGAAGTTGGCGCTTCCCCGGTGGGTGGTGAGCACGTGTTCCCCGCATGCGCGGGGATGAACCGTTGGATCTGTGGGGGTGATGGCGTGACGATATGTGTTTCCCGCATGCGCGGGGATGAACCGCCGAGATTCCGCCATTTGACCGAACCTCATGAGTGTTCCCCGCATGCGCGGGGATGAACCGCGCCAGGCATACGTGAATATGGCCCGGACAAAGTGTTCCCCGCATGCGCGGGGATGAACCGAGACGAGCAATGGCGGGAAGGATTATGTCTCGGTGTTCCCCGCATGCGCGGGGATGAACCGCCCCATGACCACTGACAGCGCCATCATCGACGGTGTTCCCCGCATGCGCGGGGATGAACCGGTCGGGTCAGCCACCAAGATCGGCGTAGCCTCGTGTTCCCCGCATGCGCGGGGATGAACCGCTGGATTTTCCGGGCGTTGACTGCGACGCCTGGTGTTCCCCGCATGCGCGGGGATGAACCGTCGAGAAGAAGAAGGAAGCGCTCAACCACTTCGTGTTCCCCGCATGCGCGGGGATGAACCGCCTGGACAACAACAGGGGGCACATTATGAACAGTGTTCCCCGCATGCGCGGGGATGAACCGGCCGTCCGTGGCTGCACGAATTCGAGACATTCGTGTTCCCCGCATGCGCGGGGATGAACCGAGCTAGGCGACATCTCGTCTTTTGTCCGTGCCGTGTTCCCCGCATGCGCGGGGATGAACCGCTGGAGTTGGAGAGCAACGAACGCCTCGCCCAGTGTTCCCCGCATGCGCGGGGATGAACCGCACTGGGGGTGGATATTTCACGGCCCACCATCGTGTTCCCCGCATGCGCGGGGATGAACCGGAATCTTCGACTGGTTCAGGGAGTGGTAATGAGTGTTCCCCGCATGCGCGGGGATGAACCGATCTGAAGAGGCGAACAGCTTGGACGCTCTCCGTGTTCCCCGCATGCGCGGGGATGAACCGAACCCATCCGAGTTGTCCAACATCTTCGGCAGGTGTTCCCCGCATGCGCGGGGATGAACCGACGCTGGGCTTACCACCGCCACGTCCATCGTTGTGTTCCCCGCATGCGCGGGGATGAACCGTTGAACGCACTATTTTGCGTTGACTACCGTAAGTGTTCCCCGCATGCGCGGGGATGAACCGCCCCGTTGGCTCGTTGGACAGGCCCCGAGTAGGTGTTCCCCGCATGCGCGGGGATGAACCATACCGGGCATCATCCTCGGATATCTCCTGCCCGTGTTCCCCGCATGCGCGGGGATGAACCGTGGGCATCAGACAAGTCATGCCGCCCACGCGGGTGTTCCCCGCATGCGCGGGGATGAACCGTTCCGCGGGGGAGGTGCGGGGAGCCAGGGGTAGTGTTCCCCGCATGCGCGGGGATGAACCGCCATCTAGCTGATTTAAATAGCAAATCGCACAGTGTTCCCCGCATGCGCGGGGATGAACCGTATTGCCCAGTTCCCCCACACAATGATGCTGTGTGTTCCCCGCATGCGCGGGGATGAACCGGTGGTTGCCGGCAATGCAGAGGCAGATGATGCGTGTTCCCCGCATGCGCGGGGATGAACCGCAAGCACGGCAGTGCCCGCGTCCTTGACATTCGTGTTCCCCGCATGCGCGGGGATGAACCGAAACCGACCATCATCGGCTTGCAGGGCGGCGGGTGTTCCCCGCATGCGCGGGGATGAACCGGCGACGTTCCCCCGGCTCTGGGGGAACAGAACGTGTTCCCCGCATGCGCGGGGATGAACCGGGCATTTTGCTGGTTTTGGCGGTCGAGAAAGAGTGTTCCCCGCATGCGCGGGGATGAACCGGTGATACGGAACGCGAGGATCTTCTGTTCGTCGTGTTCCCCGCATGCGCGGGGATGAACCGATGCTCTCATTCCCATTCCTGTGCACCTGGGGGTGTTCCCCGCATGCGCGGGGATGAACCGCACTGGCGGGGAGGGTGGGGCTCATCCCTGAGGTGTTCCCCGCATGCGCGGGGATGAACCGTGCGCCTCACCGATGGCACCCGCGTTGACTGCGTGTTCCCCGCATGCGCGGGGATGAACCGGACTCCGGACTCACCACCGCCACCTCCATCGTGTGTTCCCCGCATGCGCGGGGATGAACCGCCTCACCCAGGGCCTCACCGCCATCACCCTCTGTGTTCCCCGCATGCGCGGGGATGAACCGAGGTTTTCAAACATGGGTCGTTCCTCCTTTCGGTGTTCCCCGCATGCGCGGGGATGAACCGGTGGCCTGGCGCTCGCGGGCGTTCTTCTCGGCGTGTTCCCCGCATGCGCGGGGATGAACCGGTGGATGCTCTCCCTCTGCCTTGCCCGCGACCGTGTTCCCCGCATGCGCGGGGATGAACCGAGTATTTCAGCGATGCGTAGATTTCTCATCGGGTGTTCCCCGCATGCGCGGGGATGAACCGGGCGACACGCTGCCGGTTGGTGTTGGCAAAGGGTGTTCCCCGCATGCGCGGGGATGAACCGCTGCGAGTCGATCATCTCGATACTGTGAGCAAGTGTTCCCCGCATGCGCGGGGATGAACCGACCTTGATGGTTTTGCCCTTGGCGCCGGCAAAGTGTTCCCCGCATGCGCGGGGATGAACCCACGTCGTCATTGATGGGGATTTTCTCGTCATCGTGTTCCCCGCATGCGCGGGGATGAACCGGTGTGCAAGGTCTCCGCCAACGGCGAGATCGAGTGTTCCCCGCATGCGCGGGGATGAACCGCTCATCGTCCCCGTGGCTGCCCTGCACAACGTGTGTTCCCCGCATGCGCGGGGATGAACCGGCGCCAGTCTGCCGGTTTTTCGATGATGAGGGGTGTTCCCCGCATGCGCGGGGATGAACCGCAGAAACAGTCATGAGATACTGAATAGGAAAGGTGTTCCCCGCATGCGCGGGGATGAACCGACGAGGAAGATGTGCTCGGTGGAGAGGCCAGTGTGTTCCCCGCATGCGCGGGGATGAACCGAACAATTCAACAATCTGGTAGCACTCGCCACGGTGTTCCCCGCATGCGCGGGGATGAACCGCAATCCAGGTTTATCGTTGCGAACCGACAGAGGTGTTCCCCGCATGCGCGGGGATGAACCGTTAACGCACGGATCGCCGCAACCATTCGCCGGGTGTTCCCCGCATGCGCGGGGATGAACCGGATAGAGGGGGCCTAAGCCCCCTCATGGTGAAGTGTTCCCCGCATGCGCGGGGATGAACCGAGACGGTTATGAACGCTCGTAATCTGCTTCCCGTGTTCCCCGCATGCGCGGGGATGAACCGATGTTGACCGATGCCAGCGCATAGGCGAAACAGTGTTCCCCGCATGCGCGGGGATGAACCGATGTTGACCGATGCCAGCGCATAGGCGAAACAGTGTTCCCCGCATGCACGGGGATGAACCGGTCTATGGGAAGAGGGCAGCGAAGACAAGCAC
11068 NC_008786.1 Verminephrobacter-eiseniae-EF01-2 Bacteria 1612297-1626857 14561 242 60 TTTCTGAGCT TTTCTGAGCTGCCTATCCGGCAGTGAACGACTGAATGCCGCGCCCTGATCCGTCAGATATTTTCTGAGCTGCCTATCCGGCAGTGAACGTGAATGTGAAGGGGCGCCCAGTGCGCGGGCTTTTCTGAGCTGCCTATCCGGCAGTGAACGCAAAATCGCTGTTGGCGACCATCTTTCCGAATTTCTGAGCTGCCTATCCGGCAGTGAACTGTTGAGCGATAATCTATCGAAAGACGGGACATTTCTGAGCTGCCTATCCGGCAGTGAACACCGGATACAGTTCGACGCCGGTGATTTGCTCTTTCTGAGCTGCCTATCCGGCAGTGAACGCCGAGTGTATGGGTTGTTGGCGAACCAGCATTTTCTGAGCTGCCTATCCGGCAGTGAACAGATTCGACGAACAAGCGAAAGACAGTGCCGCTTTCTGAGCTGCCTATCCGGCAGTGAACACATGGCAGGATACAAAGTTTTACACTTTTGGTTTCTGAGCTGCCTATCCGGCAGTGAACACTGGCCGCTGGGCGAGCCGCAATCTTGGCTTTTTCTGAGCTGCCTATCCGGCAGTGAACTTCCTCGGTTGGGCTGATCAAGGGATTGGGGTTTTCTGAGCTGCCTATCCGGCAGTGAACGCAGTACGTGTCTCGCGCCTACCTGCCCTGCCTTTCTGAGCTGCCTATCCGGCAGTGAACGCGCACGTTCTTGCAGATAATCTGTGGGTTTTTTTCTGAGCTGCCTATCCGGCAGTGAACGATTCGTACTTGAATAACGTCCTTTTCGTCAATTTCTGAGCTGCCTATCCGGCAGTGAACAAATCACCGGCGTCGAACTGTATCCGGTGACGTTTCTGAGCTGCCTATCCGGCAGTGAACACCGATGCCGCACGTTGCGAAGCAGCGATGATTTTCTGAGCTGCCTATCCGGCAGTGAACTCATCAATATGCGCAGCGACAGCGGCCCTGCATTTCTGAGCTGCCTATCCGGCAGTGAACTTGATTGACGTGTTGATCAATCGACAAACAAATTTCTGAGCTGCCTATCCGGCAGTGAACGCATGGTCATGAATGAAGAACAGATCGCACGCTTTCTGAGCTGCCTATCCGGCAGTGAACCGCGCAAGATCGTCGCGCAGCGCCACCTGGTGTTTCTGAGCTGCCTATCCGGCAGTGAACGAGCCGGTCGAGTTTCCAGATTACGAGCGTGTTTTCTGAGCTGCCTATCCGGCAGTGAACGTAGATAACATTCATGTCAATCTCCCAAAAATTTTCTGAGCTGCCTATCCGGCAGTGAACAGGGTTGTTGCTGAACTGGGATGATCTTGCTCTTTCTGAGCTGCCTATCCGGCAGTGAACTAGAAGCGCTGCACGGCATCCACGGCCGCGATTTTCTGAGCTGCCTATCCGGCAGTGAACAACCAGGACACACCAAAGCCCATGACGAACCCTTTCTGAGCTGCCTATCCGGCAGTGAACACGCCAGCGGATGGGCGTGGATGCGTGCGCGTTTTCTGAGCTGCCTATCCGGCAGTGAACAATAAGCAACGCTGTCCACTCTTGCGGGAGGGTTTCTGAGCTGCCTATCCGGCAGTGAACCCAGAATGCGGGCCTCAACCCGCATTCGGTTCTTTCTGAGCTGCCTATCCGGCAGTGAACTTATTTCGCGAATTGTCGGAAGTTTCTTTTTCTTTCTGAGCTGCCTATCCGGCAGTGAACAGTAGAAACCCTATAGACATGACGTTTTTGGTTTTCTGAGCTGCCTATCCGGCAGTGAACGCACACGCACGTGCACGCACGTGAGCGCGCCGTTTCTGAGCTGCCTATCCGGCAGTGAACGCATGGTCATGAATGAAGAACAGATCGTACGCTTTCTGAGCTGCCTATCCGGCAGTGAACGGCACGAAGATGGACCGTCCTGGTCTGAATATTTTCTGAGCTGCCTATCCGGCAGTGAACCCAAAACCCGATCACTTTGCATTTCACCCAGTTTTCTGAGCTGCCTATCCGGCAGTGAACACGTGTTGATCAATCGAAACCAACTTTTTTTATTTCTGAGCTGCCTATCCGGCAGTGAACGATCTTTTTTTCTCTTTCCAGCGAATCCGCTATTTCTGAGCTGCCTATCCGGCAGTGAACACTTGGCATCACGGCCCTATCGCCGCCAGGAGTTTCTGAGCTGCCTATCCGGCAGTGAACTTGCCGAATCTAAGTAGAAACCCTGATGACATTTTCTGAGCTGCCTATCCGGCAGTGAACGTGCTGAGCAGCAGCGGTTCATCGTCCGCTTCTTTCTGAGCTGCCTATCCGGCAGTGAACTTGTTTCAGGAGAGCGTTTCGCGTCTGGTATTTTTCTGAGCTGCCTATCCGGCAGTGAACGCAACCAATTTTTGCCGCCAAAATGTCAATATTTTCTGAGCTGCCTATCCGGCAGTGAACCGAAATCCGAATTCGCGTGCAAGGCCCCGGACTTTCTGAGCTGCCTATCCGGCAGTGAACAATGATGCACTTTGGTGCCTTGATTCTTTCGATTTCTGAGCTGCCTATCCGGCAGTGAACCGCGCAAGATCGTCGCGCAGCGCCACCTGGTGTTTCTGAGCTGCCTATCCGGCAGTGAACAATCGACGGAGAAAAGATCAAGATTCCAGGATTTTCTGAGCTGCCTATCCGGCAGTGAACGCGGATATGCATTGATCAGCGGCGGAGACTATTTTCTGAGCTGCCTATCCGGCAGTGAACAGGAAGGCCGTAGCGCGGCTTTCGACCATTCATTTCTGAGCTGCCTATCCGGCAGTGAACTTCTGCATTCACGCGACTGACGAGACCGACCCTTTCTGAGCTGCCTATCCGGCAGTGAACGGCCCACGGTTTGACAGATCGACAGCGGCAGTTTTCTGAGCTGCCTATCCGGCAGTGAACGGCACGAAGCTGGACCGTCCTGGGCTGAATATTTTCTGAGCTGCCTATCCGGCAGTGAACCTGGACGATATTGTTCGAATAACCAAAGGATTTTTCTGAGCTGCCTATCCGGCAGTGAACACCTCAAATAAGCAACGCCGTCCACTCTTGCGTTTCTGAGCTGCCTATCCGGCAGTGAACTCACATACCTGCGCCGTGGATGTCTTCGATTCTTTCTGAGCTGCCTATCCGGCAGTGAACATCAATGACTTAGCAGACCCCGTCAGCTGGTCTTTCTGAGCTGCCTATCCGGCAGTGAACAATCGACGGAGAAAAGATCAAGATTCCCGGATTTTCTGAGCTGCCTATCCGGCAGTGAACCCAGAATGCGGGCCTCAACCCGCATTCGGTTCTTTCTGAGCTGCCTATCCGGCAGTGAACTGGGATGATCTTGCTCGACAAGAAATTCACTCTTTCTGAGCTGCCTATCCGGCAGTGAACTGCGGTACACCGGAGGCGGGGGCTTTCAAATTTTTCTGAGCTGCCTATCCGGCAGTGAACATTTTCTCCAAAAGTTTCATTATCAAGTAGCCTTTCTGAGCTGCCTATCCGGCAGTGAACAATGGTCGAAAGCCGCGCTACGGCCTTCCTACTTTCTGAGCTGCCTATCCGGCAGTGAACGCCGGAGGTAATAGTTTGCGGCGATTCGGAATTTTCTGAGCTGCCTATCCGGCAGTGAACTACGTCGACCCGAAGACCGGCGCCACCTGGACTTTCTGAGCTGCCTATCCGGCAGTGAACGCATGGTCATGAATGAAGAACAGATCGCACGCTTTCTGAGCTGCCTATCCGGCAGTGAACGGTAAACCCGTATAATCCGTCCCTCATATGATTTTCTGAGCTGCCTATCCGGCAGTGAACTGGATACTGGCGTGTACAAAACGTGACTGAGCTTTCTGAGCTGCCTATCCGGCAGTGAACCGCGCCGAGCGCGACGACGGCTACAAGCAGATTTTCTGAGCTGCCTATCCGGCAGTGAACAACAACGACCAGGGCTACGACCGGCTCGACCTTTTCTGAGCTGCCTATCCGGCAGTGAACCGGTGATGCAGGACGGGCTTGCGTTGATCGAGTTTCTGAGCTGCCTATCCGGCAGTGAACGGGCTGCGCGCAAGATCGTCGCGCAGCGGGCTTTTCTGAGCTGCCTATCCGGCAGTGAACGTATATCACTCATATATCAGCCGTATTCATTCTTTCTGAGCTGCCTATCCGGCAGTGAACTTCAGTGTCGCGCCGCTCGCCAGCATTTCCCTTTTCTGAGCTGCCTATCCGGCAGTGAACGCGTGGTGCCGGCGGCAATGGTGATGCACGCCTTTCTGAGCTGCCTATCCGGCAGTGAACTCAGATTCCCGCTCACGCAGCGCCTGCGCGCATTTCTGAGCTGCCTATCCGGCAGTGAACTTTGCGGTGACCGGCGAATCGTGCTGCATCTCTTTCTGAGCTGCCTATCCGGCAGTGAACACTTTCTGATGCAGTGAAACTGGGGCCGTCGGTTTCTGAGCTGCCTATCCGGCAGTGAACGATAGTAGTCTGATGGCCTTGCCTGGCTTTCTTTTCTGAGCTGCCTATCCGGCAGTGAACTCAAGCGCCAGCGCAGCGCTCTCGATGAGCGCTTTCTGAGCTGCCTATCCGGCAGTGAACCGCAGATTATCTGCAAGCACATGCGCGGCAGCTTTCTGAGCTGCCTATCCGGCAGTGAACATCAGGGCGAAGGTAGGGGATAGTAGTCTGATTTTCTGAGCTGCCTATCCGGCAGTGAACACGAAGCCGGAGATTGATTATGTTTCGGTTCTTTTCTGAGCTGCCTATCCGGCAGTGAACGCAGCGTCAGGGGCGTGATCGTGCCACGGCATTTTCTGAGCTGCCTATCCGGCAGTGAACGTCCGTTGATAAAAACGATGCTGATCAAGCGCTTTCTGAGCTGCCTATCCGGCAGTGAACGTCAATACCACACAATAGAATCTGCTGCCAACTTTCTGAGCTGCCTATCCGGCAGTGAACGGCCGTCGAAGGCGACATCCGGCCTACGGGCATTTCTGAGCTGCCTATCCGGCAGTGAACCCGCCACCAGGCGCTCGTAGGCGGCGGTTTCATTTCTGAGCTGCCTATCCGGCAGTGAACAGTTGCTTGGCCTTGCTCCAAGACTTCGGGACTTTCTGAGCTGCCTATCCGGCAGTGAACGGTAAACCCGTATAATCCGTCTCTCATATGATTTTCTGAGCTGCCTATCCGGCAGTGAACGTGTACGTGAAGGGGCGCCCAGTGCGCGGGCTTTTCTGAGCTGCCTATCCGGCAGTGAACCAGCATCATACCATCGTCGTCATGCGTGATCATTTCTGAGCTGCCTATCCGGCAGTGAACAGCTGATTATGTTGCGTGAAGATCACGATGACTTTCTGAGCTGCCTATCCGGCAGTGAACTCGATGGGCGTCTATCCCTTCGCGCTCATACTTTTCTGAGCTGCCTATCCGGCAGTGAACGGGTTTTCCCTGCACCGGGTTTTCCCCTAGTATTTCTGAGCTGCCTATCCGGCAGTGAACCTCGGGAAGCGGCAAGGCCGGCGCTCCAGGTATTTCTGAGCTGCCTATCCGGCAGTGAACTAATCGGTGGGCATATTCAAGCATTTTCGCTTTTTCTGAGCTGCCTATCCGGCAGTGAACAGAAGGCCCTAGAAGGCCAGGGAAGGCCATCATTTCTGAGCTGCCTATCCGGCAGTGAACAAATGCGCCTTGCGCCACCCCGTCCGCCGTAGTTTCTGAGCTGCCTATCCGGCAGTGAACAGTCCCGCCACCGGGCTACTCACAATCTCGTTTTTCTGAGCTGCCTATCCGGCAGTGAACGCAAGGGGCATGACATGCCACTAGTAACCATCTTTCTGAGCTGCCTATCCGGCAGTGAACCGCGCCCAGGGCCGCGTCGGCGGGCGGCGCATTTTCTGAGCTGCCTATCCGGCAGTGAACGGCAGGGTCAATCGCACCTACACCGACATCGCTTTCTGAGCTGCCTATCCGGCAGTGAACGGAATTGAAAGAAGGCGACACGCTCGTAATCTTTTCTGAGCTGCCTATCCGGCAGTGAACTTTGAATGTACGCCACGTTTCCACCTCCGCCATTTCTGAGCTGCCTATCCGGCAGTGAACCGATTGACGTGTTGATCAATCGAAAATTTAGGTTTCTGAGCTGCCTATCCGGCAGTGAACGCCTGGCCGCTGCGCGCGCCCAGGGCCGCGTCTTTCTGAGCTGCCTATCCGGCAGTGAACCCGGCGGCTCTTGACACTTCCCGCGCTCATCGTTTCTGAGCTGCCTATCCGGCAGTGAACTAGGAAGGCCGTAGCGCCGCTTTCGACCGTTCTTTCTGAGCTGCCTATCCGGCAGTGAACATTCTTTCGAAGGGGTCGGTGCGGTTCATGATTTTCTGAGCTGCCTATCCGGCAGTGAACTTGCAGATTATCAGCAATAACCGCCGCGCCGGTTTCTGAGCTGCCTATCCGGCAGTGAACGGCTATATTCGCTGCGGCAGAAAGCGGGGGCTTTTCTGAGCTGCCTATCCGGCAGTGAACCAGATAATCGTCCCACATTTTGTCGAGCGCCGTTTCTGAGCTGCCTATCCGGCAGTGAACTAATACGCCCGGCCTGTATGTATCTGCGTCGCTTTCTGAGCTGCCTATCCGGCAGTGAACATTGCGATGACGGTGCAGGTTTTTGCGCTTCTTTTCTGAGCTGCCTATCCGGCAGTGAACCGATTGTTCGCTTGTTTGTCGAAGCGAGTAGTTTTCTGAGCTGCCTATCCGGCAGTGAACGGCCTTCTAGGGCCTTCTGGCGCGGCAGGGCATTTCTGAGCTGCCTATCCGGCAGTGAACAATGTCTCCGCGCGCGGAAGGCGGTTGAAAGATTTCTGAGCTGCCTATCCGGCAGTGAACTGTTGGTGATCCCACCTGGTGCCTGCGGGTGCTTTCTGAGCTGCCTATCCGGCAGTGAACGCCGCCATTCCCCGGCATCGCCCGGGCCGTGTTTTCTGAGCTGCCTATCCGGCAGTGAACACAGCCAACTAACCAACCCGAGCCGGCCTCCGTTTCTGAGCTGCCTATCCGGCAGTGAACGTGCCGATGTTGATTCTTTTGAAGGGGTCGGTTTTCTGAGCTGCCTATCCGGCAGTGAACCGCATCGGCGGGCGGCGCATGGTCATGAATGATTTCTGAGCTGCCTATCCGGCAGTGAACACCAAGCCGGTTCGCCGAATACCCAAACGCTTTTTCTGAGCTGCCTATCCGGCAGTGAACTAACTGAGAATATCGACACCAGCACCTGCATCTTTCTGAGCTGCCTATCCGGCAGTGAACCTCTCGTTTATACTTTTCCGCCGCTCCGTTGTTTTCTGAGCTGCCTATCCGGCAGTGAACCATACACAGAAACTACAGAAATTGGCGCGTACTTTCTGAGCTGCCTATCCGGCAGTGAACACCAAGCCGGTTCGCCGAATACCCAAACGCTTTTTCTGAGCTGCCTATCCGGCAGTGAACATGTCATGTCATTATGAACTAGCAGCAATTTCTTTCTGAGCTGCCTATCCGGCAGTGAACGGGTCAGGGTCAGGGTCAGCGCAGCGCCGCCTTTTCTGAGCTGCCTATCCGGCAGTGAACAGCTGCCGCGCCTGGTCAGCGGTCTGGACACCTTTCTGAGCTGCCTATCCGGCAGTGAACATGTAGCACTCCCAAAAACGTCATGTCTATAGTTTCTGAGCTGCCTATCCGGCAGTGAACAGCTGCGCGATGAGCTGACCGACGTGCAAGCTTTTCTGAGCTGCCTATCCGGCAGTGAACTGACCGGCAAGCTGCCGCGCCGTGCTGCTGCTTTTCTGAGCTGCCTATCCGGCAGTGAACGGGATGTGTTAGAGCCAAGCGTTTGGGTATGTTTTCTGAGCTGCCTATCCGGCAGTGAACGGCACCTCCCCGTCGTTTGAAGACAGCACCCCTTTCTGAGCTGCCTATCCGGCAGTGAACGGAATTGAAAGAAGGCGACACGCTTGTAATCTTTTCTGAGCTGCCTATCCGGCAGTGAACTTCTACAGACTACTTTGTACGAATCGAAATCTTTTCTGAGCTGCCTATCCGGCAGTGAACTTTTACTAGGCTTTCCGAAGTGATCATCCTGTTTTCTGAGCTGCCTATCCGGCAGTGAACACGGCCCTATCGCCGCCAGGAGGCCGTAGGAATTTCTGAGCTGCCTATCCGGCAGTGAACGTATATCACTCATATATCAGCCGTATTCATTCTTTCTGAGCTGCCTATCCGGCAGTGAACGCCCGCGCCATCGGCATAATCTTCAGCGACGATTTCTGAGCTGCCTATCCGGCAGTGAACTACGCCATATTCCCCCATACACCGGGCGGATATTTCTGAGCTGCCTATCCGGCAGTGAACGCGGCGACGGCCTCGCGGCATGCGCGGTGCGCTTTCTGAGCTGCCTATCCGGCAGTGAACGCGCTGCTGGGCGCTGAATGGGCGCCGCTGGTTTTCTGAGCTGCCTATCCGGCAGTGAACGGTGCGCAATCGCTGACCAGGTCGCCATGAGCTTTCTGAGCTGCCTATCCGGCAGTGAACCTTTCTAGCGGCCCGTGGCAGGTAGAAGGGCCTTTCTGAGCTGCCTATCCGGCAGTGAACGTGCTACTCATAATCGCGTGGGCTTTGGATATTTTCTGAGCTGCCTATCCGGCAGTGAACCGCCGGTTCTTGCTGTTGCGCTCGTCTTGATCTTTCTGAGCTGCCTATCCGGCAGTGAACAAGTGTCAAAAGACGACGACAGTATGCGTCTTTTTCTGAGCTGCCTATCCGGCAGTGAACCGCTGCGACTCGTCGCTGAAGATTATGCCGCGTTTCTGAGCTGCCTATCCGGCAGTGAACGGCGGGTAAGCACGCAGAATCTGATTCGCGAATTTCTGAGCTGCCTATCCGGCAGTGAACTAGCCCGGGCGTATTCATTGTCCACGCCATAGTTTCTGAGCTGCCTATCCGGCAGTGAACCCCGGGGCTTGCAAGTCCACCGGGACATGTATTTTCTGAGCTGCCTATCCGGCAGTGAACGCCCGCGCCATCGGCATAATCTTCAGCGACAATTTCTGAGCTGCCTATCCGGCAGTGAACAGGTTGCGAAGTTTTACACTTTAGGGGCTTGCTTTCTGAGCTGCCTATCCGGCAGTGAACGAATGCTGGCACGCTTCGCATTTTGACGGGGCTTTCTGAGCTGCCTATCCGGCAGTGAACCGGGCTGCTGCAAAGGCGCTGGCGCGGCAACCTTTCTGAGCTGCCTATCCGGCAGTGAACCGCACGCACGTGCAGATGCAGGTCAAGGTCAATTTCTGAGCTGCCTATCCGGCAGTGAACAATGTGTTTCGCGACAGCGTCGCGATATGCGTTTTCTGAGCTGCCTATCCGGCAGTGAACATCGTCCAGAATGCGGGCCGCAACCCGCATTCTTTCTGAGCTGCCTATCCGGCAGTGAACAATGATGCCCGCGCGGCGCTTGCCGCCAAGGATTTCTGAGCTGCCTATCCGGCAGTGAACGCGGGCTGTGGAAACACATGGCCCGCATCATTTTTCTGAGCTGCCTATCCGGCAGTGAACACCAAGCCGATTCGCCGTATACCCAAACGCTTTTTCTGAGCTGCCTATCCGGCAGTGAACAAGCCGCAGCGACCCGCAGCGGGTCAGCATCGTTTCTGAGCTGCCTATCCGGCAGTGAACGAAGGAGTAAAATCATGAGCGAATATGTGAGCTTTCTGAGCTGCCTATCCGGCAGTGAACGGGGAAAATGCGGATTTCGATTCGTACAAAGTTTTCTGAGCTGCCTATCCGGCAGTGAACCGCCATTTGCTGCCCAGCAGCGCCAGGGCATCTTTCTGAGCTGCCTATCCGGCAGTGAACAATAAGCAACGCTGTTCGCTCTGTCGGGCGGTTTTCTGAGCTGCCTATCCGGCAGTGAACGCGCGCCCAGGGCCGCATCGGCGGGCGGCGCATTTCTGAGCTGCCTATCCGGCAGTGAACTGGAGGCATTCTTTCTGCCGACCTGCTCGGATTTTCTGAGCTGCCTATCCGGCAGTGAACAGTGACCTGCCGCTTCAATACCAGGTGCAGATTTTCTGAGCTGCCTATCCGGCAGTGAACAAATCAGGGCTTATCCCATAATCACCCGCGATTTTCTGAGCTGCCTATCCGGCAGTGAACCTGCTCGCCGCCCGCTAGCTGCGGCCCGACGTTTTCTGAGCTGCCTATCCGGCAGTGAACCGTGCAACCGGTCTTGCGTTTCCCCATCGTGATTTCTGAGCTGCCTATCCGGCAGTGAACTGCAGCAGATGCCACATCGCACATCATGAGAATTTCTGAGCTGCCTATCCGGCAGTGAACTTTTACGTTGAAATCGGCCAAACCGCCATGTTTTTCTGAGCTGCCTATCCGGCAGTGAACGCGCTGCGCGAAAGTCACAGAGATATGCAGCTTTTCTGAGCTGCCTATCCGGCAGTGAACGCCAGCAAGTACTACGGCGTGCCCCGCGTTGTTTTCTGAGCTGCCTATCCGGCAGTGAACAGGCCGGCAATTGTCCGATCACGCATCTGACCTTTCTGAGCTGCCTATCCGGCAGTGAACGATATATTGGTCAATTCTGTACCGCGCAGGCTTTTCTGAGCTGCCTATCCGGCAGTGAACTTCCGTCAAAAGTCCGCACGTCATCCCAAATTTTTCTGAGCTGCCTATCCGGCAGTGAACACGATCTGGATTGCCCAGTTCGTGGGCAAAGATTTCTGAGCTGCCTATCCGGCAGTGAACCACTGGCGCGCAGTCTGATGCATTCACGATCTTTTCTGAGCTGCCTATCCGGCAGTGAACCCAGAATGCGGGCCTCAACCCGCATTCGGTTCTTTCTGAGCTGCCTATCCGGCAGTGAACGCTGCACGCACCGAGGCCGCGCGCTGCGCCGATTTCTGAGCTGCCTATCCGGCAGTGAACAGTTTTCAAATGGAAATACGGAGACGACGAATTTTCTGAGCTGCCTATCCGGCAGTGAACAGACAGCCCCATTCCGCATCGAACCCGAGTTCTTTCTGAGCTGCCTATCCGGCAGTGAACAATATCAAAGTGATCTTTTCGGCCATGAAGATTTTCTGAGCTGCCTATCCGGCAGTGAACAGTTGGAACCCCCGGCGCGCCACCGACGCGGTTTTCTGAGCTGCCTATCCGGCAGTGAACCTTGATTGCAATATTCGACAAGCTGAATACTTTTTCTGAGCTGCCTATCCGGCAGTGAACGGCATCAGTCACGTACGTGCTGCACGCAACGATTTCTGAGCTGCCTATCCGGCAGTGAACGCAGTCTGTATCTTCTTTCTCGACGGGATTTTTTTCTGAGCTGCCTATCCGGCAGTGAACGCGCTAAGGGCCGCATCGGCGGGCGGCGCATGTTTCTGAGCTGCCTATCCGGCAGTGAACTAACTGATAATATCGACACAAGCACATGCATCTTTCTGAGCTGCCTATCCGGCAGTGAACGATGATTCGTGCTAGTCTGACAGCAGATCGTATTTCTGAGCTGCCTATCCGGCAGTGAACGATTAATGACAGCTTCGCTATCGAAAGCTATCTTTCTGAGCTGCCTATCCGGCAGTGAACTGGGATGATCTTGCGCTGCAAGAATTGCGATCTTTCTGAGCTGCCTATCCGGCAGTGAACATCTGGCATGACCGCCGGGGGCTAGCGATAGTTTTCTGAGCTGCCTATCCGGCAGTGAACGCAACGGCTCGATCAGAGGCGGCGGCGGATGGTTTCTGAGCTGCCTATCCGGCAGTGAACCGCACCGATGCCGCGCGCTGCACCGATGCCCTTTTCTGAGCTGCCTATCCGGCAGTGAACTGCCGGTCGACCTTGGTGCGCATGCTCAACGCTTTCTGAGCTGCCTATCCGGCAGTGAACAGTTGGAACCCCCGGCGCGCCACCGACGCGGTTTTCTGAGCTGCCTATCCGGCAGTGAACTATGAGATAATGCCGGGCTTCGGCCCGGCAATTTTCTGAGCTGCCTATCCGGCAGTGAACGCGGGGCAGTTCGGGCGGTGGGTGTACGTGAATTTCTGAGCTGCCTATCCGGCAGTGAACATGGCGATGGGCTTGGCCCTGGGGTTCGGCACTTTCTGAGCTGCCTATCCGGCAGTGAACGATTTCTTGATTAGTGAGCATGATTTTCCCCTTTTCTGAGCTGCCTATCCGGCAGTGAACGTTCCTTCGTTGAAAGGCGTAGATCGTATCAATTTCTGAGCTGCCTATCCGGCAGTGAACGAATGTACGCCACGTTTCCACCGCCGCCGGGTTTTCTGAGCTGCCTATCCGGCAGTGAACACTGTAGCACCCCAAAAACGTCACGTCTATAGTTTCTGAGCTGCCTATCCGGCAGTGAACAACCGTGGGCCGCATCCCCGGCCACGGCACCTTTTCTGAGCTGCCTATCCGGCAGTGAACGACATGACATGACATCCAGCCCGCCCTGCGCGTTTCTGAGCTGCCTATCCGGCAGTGAACCGATAAAATCACGCGCATTTTCTTCGCTGAGT
56682 NZ_CP011373.1 Nonlabens-sp Bacteria 2127342-2141682 14341 117 114 GATTGTGATG GATTGTGATGGAGATGGTGTTCTAAATAGTGCTGAGATAGCAGACGGAACTAATCCAAACGATGCGTGTAGTTATGACCCAGCAAGTGTAACAGTAGCAGTAACAAGTACCGTAGATTGTGATGGAGACGGAGTAACGGATGCTGATGAGATAGCAAACGGAACCGATCCAAACGATGCATGTAGTTATAATGTGGCAGATATTACGGTATCAGTAACCAGCACAGTAGATTGTGATGGAGATGGAGTAACGGATGCTGATGAGATAGCAGACGGAACCGATCCAAATGATGCGTGTAGTTATGATCCAGCAAGTGTAACAGTAGCAGTAACAAGCACAGTAGATTGTGATGGAGACGGAGTAACGGATGCTGATGAGATAGCAGACGGAACCGATCCGAACGATGCGTGTAGTTATGATCCAGCAAGTGTAACAGTAGCGGTAACAAGTACCGTAGATTGTGATGGAGACGGAGTAACGGATGCTGATGAGATAGCAAACGGAACCGATCCAAACGATGCATGTAGTTATAATGTTGCAGATATTACGGTATCAGTAACCAGTACTGTAGATTGTGATGGAGACGGAGTAACTGATGCTGATGAGATAGCAAACGGAACTGATCCAAACGATGCGTGTAGTTATAATGTTGCAGATGTAACAGTAGCAGTAACCAGTACTGTAGATTGTGATGGAGACGGAGTAATCGATGCTGATGAGATAGCAGACGGAACCGATCCAAACGATGCGTGTAGTTATGATCCAGCAAGTGTAACAGTAGCGGTAACAAGTACCGTAGATTGTGATGGAGACGGAGTAACGGATGCTGATGAGATAGCAAACGGAACCGATCCAAACGATGCATGTAGTTACAATGTTGCAGATATTACGGTATCAGTAACAAGCACAGTAGATTGTGATGAAGATGGAGTAACTGATGCTGATGAGATAGCAAACGGAACTGATCCAAATGATGCATGTAGTTACAATGTTGCAGATGTAACAGTAGCAGTAACAAGCACAGTAGATTGTGATGGAGATGGAGTGATAGATGCTGATGAGATAGCAGACGGAACCGATCCGAACGATGCGTGTAGTTATGATCCAGCAAGTGTAACAGTAGCAGTAACAAGTACCGTAGATTGTGATGGAGACGGAGTAACGGATGCTGATGAGATAGCAAACGGAACCGATCCAAACGATGCATGTAGTTATAATGTGGCAGATATTACGGTATCAGTAACCAGCACAGTAGATTGTGATGGAGATGGAGTAACTGATGCTGATGAGATAGCAAACGGAACCGATCCAAATGATGCATGTAGTTACAATGTTGCAGATGTAACAGTAGCAGTAACAAGCACAGTAGATTGTGATGGAGATGGAGTGATAGATGCTGATGAGATAGCAGACGGAACCGATCCGAACGATGCGTGTAGTTATGATCCAGCAAGTGTAACAGTAGCAGTAACAAGTACCGTAGATTGTGATGGAGACGGAGTAACGGATGCTGATGAGATAGCAAACGGAACCGATCCAAACGATGCATGTAGTTATAATGTTGCAGATATTACAGTATCAGTAACGAGCACAGTAGATTGTGATGGAGATGGAGTAACGGATGCTGATGAGATAGCAGACGGAACCGATCCAAATGATGCGTGTAGTTATGATCCAGCAAGTGTAACAGTAGCAGTAACAAGCACAGTAGATTGTGATGGAGACGGAGTAACGGATGCTGATGAGATAGCAGACGGAACCGATCCGAACGATGCGTGTAGTTATGATCCAGCAAGTGTAACAGTAGCGGTAACAAGTACCGTAGATTGTGATGGAGATGGAGTAACGGATGCTGATGAGATAGCAAACGGAACCGATCCAAACGATGCGTGTAGTTATGATCCAGCAAGTGTAACAGTAGCGGTAACCAGCACAGTAGATTGTGATGGAGATGGAGTAACGGATGCTGATGAGATAGCAAACGGAACCGATCCAAATGATGCGTGTAGTTATAATGTTGCAGATGTAACAGTAGCAGTAACAAGCACAGTAGATTGTGATGGAGATGGAGTGATAGATGCTTATGAGATAGCAGACGGAACCGATCCGAACGATGCGTGTAGTTATGATCCAGCAAGTGTAACAGTAGCAGTAACAAGTACCGTAGATTGTGATGGAGACGGAGTAACGGATGCTGATGAGATAGCAAACGGAACCGATCCAAACGATGCATGTAGTTATAATGTGGCAGATATTACGGTATCAGTAACCAGCACAGTAGATTGTGATGGAGACGGAGTAACGGATGCTGATGAGATAGCAGCCGGAACCGATCCAAACGATGCGTGTAGTTATAATGTTGCAGATGTAACAGTAGCAGTAACCAGTACTGTAGATTGTGATGGCGATGGAGTAACGGATGCTGATGAGATAGCAGACGGAACTGATCCAAACGATGCGTGTAGTTATGATCCAGCAAGTGTAACAGTAGCAGTAACAAGTACCGTAGATTGTGATGGAGACGGAGTAACGGATGCTGATGAGATAGCAAACGGAACCGATCCAAACGATGCATGTAGTTACAATGTTGCAGATATTACGGTATCAGTAACCAGCACAGTAGATTGTGATGGAGACGGAGTAACGGATGCTGATGAGATAGCGGAAGGAACCGATCCAAATGATGCGTGTAGTTACAATGTTGCAGATGTAACAGTAGCAGTAACCAGTACTGTAGATTGTGATGGAGACGGAGTAATCGATGCTGATGAGATAGCAGACGGAACCGATCCAAACGATGCGTGTAGTTATGATCCAGCAAGTGTAACAGTAGCAGTAACAAGTACCGTAGATTGTGATGGAGACGGAGTAACGGATGCTGATGAGATAGCAAACGGAACCGATCCAAACGATGCATGTAGTTATAATGTTGCAGATATTACGGTATCAGTAACGAGCACAGTAGATTGTGATGGAGATGGAGTAACGGATGCTGATGAGATAGCAAACGGAACTGATCCAAACGATGCATGTAGTTACAATGTTGCAGATGTAACAGTAGCAGTAACAAGCACAGTAGATTGTGATGGAGATGGAGTGATAGATGCTGATGAGATAGCAGACGGAACCGATCCGAACGATGCGTGTAGTTATGATCCAGCAAGTGTAACAGTAGCAGTAACAAGTACCGTAGATTGTGATGGAGACGGAGTAACGGATGCTGATGAGATAGCAAACGGAACCGATCCAAACGATGCATGTAGTTATAATGTTGCAGATGTAACAGTAGCAGTAACAAGCACAGTAGATTGTGATGGAGATGGAGTAATCGATGCTGATGAGATAGCAGCCGGAACCGATCCAAACGATCCATGTAGTTACAATCTTAGTAACGTTTCAGTTCCAGTGACCAGCACAGTAGATTGTGATGGCGATGGAGTAACGGATGCTGATGAGATAGCAGACGGAACTGATCCAAACGATGCGTGTAGTTATGATCCAGCAAGTGTAACAGTAGCAGTAACAAGTACCGTAGATTGTGATGGAGACGGAGTAACGGATGCTGATGAGATAGCAAACGGAACCGATCCAAACGATGCATGTAGTTATAATGTTGCAGATATTACGGTATCAGTAACCAGCACAGTAGATTGTGATGGAGACGGAGTAACTGATGCTGATGAGATAGCAAACGGAACTGATCCAAATGATGCATGTAGTTACAATGTTGCAGATGTAACAGTAGCAGTAACCAGTACTGTAGATTGTGATGGAGACGGAGTAATCGATGCTGATGAGATAGCAGACGGAACCGATCCAAACGATGCGTGTAGTTATGATCCAGCAAGTGTAACAGTAGCGGTAACAAGTACCGTAGATTGTGATGGAGACGGAGTAACGGATGCTGATGAGATAGCAAACGGAACCGATCCAAACGATGCATGTAGTTATAATGTTGCAGATATTACGGTATCAGTAACCAGCACAGTAGACTGTGATGGAGATGGAGTAATCGATGCTGATGAGATAGCAGCCGGAACCGATCCAAACGATCCATGTAGTTACAATCTTAGTAACGTTTCAGTTCCAGTGACGAGCACAGTAGATTGTGATGGCGATGGAGTAACCGATGCTGATGAGATAGCAGACGGAACTGATCCAAACGATGCGTGTAGTTATGATCCAGCAAGTGTAACAGTAGCAGTAACAAGTACCGTAGATTGTGATGGAGACGGAGTAACGGATGCTGATGAGATAGCAAACGGAACCGATCCAAACGATGCATGTAGTTACAATGTTGCAGATATTACGGTATCAGTAACCAGCACAGTAGATTGTGATGGAGACGGAGTAACGGATGCTGATGAGATAGCGGAAGGAACCGATCCAAATGATGCGTGTAGTTACAATGTTGCAGATGTAACAGTAGCAGTAACAAGCACAGTAGATTGTGATGGAGATGGAGTGATAGATGCTGATGAGATAGCAGACGGAACCGATCCGAACGATGCGTGTAGTTATGATCCAGCAAGTGTAACAGTAGCAGTAACAAGTACCGTAGATTGTGATGGAGACGGAGTAACGGATGCTGATGAGATAGCAAACGGAACCGATCCAAACGATGCATGTAGTTATAATGTTGCAGATATTACAGTATCAGTAACGAGCACAGTAGATTGTGATGGAGATGGAGTAACGGATGCTGATGAGATAGCAAACGGAACTGATCCAAACGATGCATGTAGTTACAATGTTGCAGATGTAACAGTAGCAGTAACAAGCACAGTAGATTGTGATGGAGATGGAGTGATAGATGCTGATGAGATAGCAGACGGAACCGATCCGAACGATGCGTGTAGTTATGATCCAGCAAGTGTAACAGTAGCAGTAACAAGTACCGTAGATTGTGATGGAGACGGAGTAACGGATGCTGATGAGATAGCAAACGGAACCGATCCAAACGATGCATGTAGTTATAATGTTGCAGATGTAACAGTAGCAGTAACAAGCACAGTAGATTGTGATGGAGATGGAGTAATCGATGCTGATGAGATAGCAGCCGGAACCGATCCAAACGATCCATGTAGTTACAATCTTAGTAACGTTTCAGTTCCAGTGACCAGCACAGTAGATTGTGATGGCGATGGAGTAACGGATGCTGATGAGATAGCAGACGGAACTGATCCAAACGATGCGTGTAGTTATGATCCAGCAAGTGTAACAGTAGCAGTAACAAGTACCGTAGATTGTGATGGAGACGGAGTAACGGATGCTGATGAGATAGCAAACGGAACCGATCCAAACGATGCATGTAGTTATAATGTTGCAGATATTACGGTATCAGTAACCAGCACAGTAGATTGTGATGGAGACGGAGTAACTGATGCTGATGAGATAGCAAACGGAACTGATCCAAATGATGCATGTAGTTACAATGTTGCAGATGTAACAGTAGCAGTAACCAGTACTGTAGATTGTGATGGAGACGGAGTAATCGATGCTGATGAGATAGCAGACGGAACCGATCCAAACGATGCGTGTAGTTATGATCCAGCAAGTGTAACAGTAGCGGTAACAAGTACCGTAGATTGTGATGGAGACGGAGTAACGGATGCTGATGAGATAGCAAACGGAACCGATCCAAACGATGCATGTAGTTACAATGTTGCAGATGTAACAGTAGCAGTAACAAGCACAGTAGATTGTGATGAAGATGGAGTAACTGATGCTGATGAGATAGCAAACGGAACTGATCCAAATGATGCATGTAGTTACAATGTTGCAGATGTAACAGTAGCAGTAACAAGCACAGTAGATTGTGATGGAGATGGAGTGATAGATGCTGATGAGATAGCAGACGGAACCGATCCGAACGATGCGTGTAGTTATGATCCAGCAAGTGTAACAGTAGCAGTAACAAGTACCGTAGATTGTGATGGAGACGGAGTAACGGATGCTGATGAGATAGCAAACGGAACCGATCCAAACGATGCATGTAGTTATAATGTTGCAGATATTACAGTATCAGTAACGAGCACAGTAGATTGTGATGGAGATGGAGTAACGGATGCTGATGAGATAGCAGACGGAACCGATCCAAATGATGCGTGTAGTTATGATCCAGCAAGTGTAACAGTAGCAGTAACAAGCACAGTAGATTGTGATGGAGACGGAGTAACGGATGCTGATGAGATAGCAGACGGAACCGATCCGAACGATGCGTGTAGTTATGATCCAGCAAGTGTAACAGTAGCGGTAACAAGTACCGTAGATTGTGATGGAGATGGAGTAACGGATGCTGATGAGATAGCAAACGGAACCGATCCAAACGATGCATGTAGTTACAATGTTGCAGATGTAACAGTAGCAGTAACAAGCACAGTAGATTGTGATGGAGATGGAGTAACTGATGCTGATGAGATAGCAAACGGAACTGATCCAAACGATGCATGTAGTTATGATCCAGCAAGTGTAACAGTAGCAGTAACAAGCACAGTAGATTGTGATGGCGATGGAGTAGTTGATGCTGATGAGATAGCAGACGGAACCGATCCGAACGATGCGTGTAGTTATGATCCAGCAAGTGTAACAGTAGCGGTAACAAGTACCGTAGATTGTGATGGAGACGGAGTAACGGATGCTGATGAGATAGCAAACGGAACCGATCCAAACGATGCATGTAGTTATAATGTTGCAGATGTAACAGTAGCAGTAACAAGCACAGTAGATTGTGATGGAGACGGAGTAACGGATGCTGATGAGATAGCGGAAGGAACCGATCCAAATGATGCGTGTAGTTACAATGTTGCAGATGTAACAGTAGCAGTAACAAGCACAGTAGATTGTGATGGAGATGGAGTGATAGATGCTGATGAGATAGCAGACGGAACCGATCCGAACGATGCGTGTAGTTATGATCCAGCAAGTGTAACAGTAGCAGTAACAAGTACCGTAGATTGTGATGGAGACGGAGTAACGGATGCTGATGAGATAGCAAACGGAACCGATCCAAACGATGCATGTAGTTATAATGTTGCAGATATTACAGTATCAGTAACGAGCACAGTAGATTGTGATGGAGATGGAGTAACGGATGCTGATGAGATAGCAAACGGAACTGATCCAAACGATGCATGTAGTTACAATGTTGCAGATGTAACAGTAGCAGTAACAAGCACAGTAGATTGTGATGGAGATGGAGTGATAGATGCTGATGAGATAGCAGACGGAACCGATCCGAACGATGCGTGTAGTTATGATCCAGCAAGTGTAACAGTAGCAGTAACAAGTACCGTAGATTGTGATGGAGACGGAGTAACGGATGCTGATGAGATAGCAAACGGAACCGATCCAAACGATGCATGTAGTTATAATGTGGCAGATATTACGGTATCAGTAACCAGTACTGTAGATTGCGATGGAGACGGAGTAACGGATGCTGATGAGATAGCAAACGGAACCGATCCAAACGATGCGTGTAGTTACAATGTTGCAGATGTAACCGTAGCAGTAACGAGCACAGTAGATTGTGATGGCGATGGAGTAACGGATGCTGATGAGATAGCAGACGGAACCGATCCAAACGATGCGTGTAGTTATGATCCAGCAAGTGTAACAGTAGCAGTAACAAGTACCGTAGATTGTGATGGAGACGGAGTAACGGATGCTGATGAGATAGCAAACGGAACCGATCCAAACGATGCATGTAGTTACAATGTTGCAGATATTACGGTATCAGTAACCAGCACAGTAGATTGTGATGGAGACGGAGTAACGGATGCTGATGAGATAGCGGCAGGAACCGATCCAAACGATGCATGTAGTTACAATGTTGCAGATGTAACAGTAGCAGTAACAAGTGGAGTAGATTGTGATGGAGATGGAGTGATAGATGCTGATGAGATAGCAGACGGAACTGATCCAAACGATGCGTGTAGTTATGATCCAGCAAGTGTAACAGTAGCGGTAACAAGTACCGTAGATTGTGATGGAGACGGAGTAACGGATGCTGATGAGATAGCAAACGGAACCGATCCAAACGATGCATGTAGTTACAATGTTGCAGATATTACGGTATCAGTAACCAGCACAGTAGACTGTGATGGAGATGGAGTGATAGATGCAGATGAGATTGCAGACGGAACCGATCCAACAGATGCTTGTGATTATGATCAAGGTAGTATTACAGTTCCGGTGACCAGCACAGTA
75667 NZ_CP015938.1 Legionella-pneumophila-strain-C7_O Bacteria 685896-699858 13963 26 537 GGATGGGGAT GGATGGGGATGGGGACACGGCGACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGTGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCGGAGACGATTGGTGTACTTTCCGACACCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGGCGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACAGCCACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGCGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGATGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACAGCCACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGCGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGATGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACAGCCACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGTGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCGGAGACGATTGGTGTACTTTCCGACACCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGATGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACGGCGACCGCCAGCGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGCGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGATGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACGGCGACCGCCAGCGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGCGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGGCGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACAGCCACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGCGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGATGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACGGCGACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGTGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCGGAGACGATTGGTGTACTTTCCGACACCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGGCGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACAGCCACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGCGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGATGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACGGCGACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGCGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCGGAGACGATTGGTGTACTTTCCGACACCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACAACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGGCGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACAGCCACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGCGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACAACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGATGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACGGCGACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGCGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGGCGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACAGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACAGCCACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGCGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGATGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACGGCGACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGCGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACAACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGGTGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGATCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACGGCGACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGCGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACAACGGTGACCACTTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAATATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGATGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACAGGCCTGGTCTTTTTAAACGCCACCGCAGTGACGACGGATGGGGATGGGGATACGGCGACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGTGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCTGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCAGGGATTACCACAGGCAACACCATCTTTTCATTGGATGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACGGCGACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGTGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCGGAGACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACAACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGAGCGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACGGCGACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGTGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCGGAGACGATTGGTGTACTTTCCGACACCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCAGGGATTACCACAGGCAACACCATCTTTTCATTGGGCGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACGGCGACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGCGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGGCGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACAGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACGGCGACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGTGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGATGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACAGGCCTGGTCTTTTTAAACGCCACCGCAGTGACGACGGATGGGGATGGGGATACGGCGACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGTGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGATGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACAGGCCTGGTCTTTTTGAACGCCACCGCAGTGACGACGGATGGGGATGGGGATACGGCGACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGTGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACAACGGTGACCACTTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGATGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTAAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACAGCCACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGTGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCGGAGACGATTGGTGTACTTTCCGACACCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGATGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTAAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACAGCCACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGTGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCAGGGATTACCACAGGCAACACCATCTTTTCATTGGGCGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTAAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACGGCGACTGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGTGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCGGAGACGATTGGTGTACTTTCCGACACCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCGGGTATTACCACAGGCAACACCATCTTTTCATTGGATGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTAAACGCCACCGCAGTGACGACGGATGGGGATGGGGACACAGCCACCGCCAGTGCGTCTTTGGATTTGGGCGGCAATGTGAAGTTTGATGACGACGGTCCGAGTGTGACGATGGCGGTGAGCGATAATAATGCGATCACCTTGAACACCCAGGATGCCGATACGATTGGGGCAGCCAGTGACAGCGACAGCGCAAGCTTTGCGGCCGCCTTTGCGGTGACTCCTAATTACGGGGCCGATGGTGCGGGCACGACGGTGACCACCTACGCCTTGAGTGTGTCCGCCCAAGGGGTGGATTCCGGCCTTGATAACAACGGCAACAACATCTACCTGTACAACATCGCAGGTTCTGTGGTGGGTTCAACATCAGCCACGCAGGCAGGGATTACCACAGGCAACACCATCTTTTCATTGGGCGTGAACAGCAGCAGTGGGGTGGTGACTTTAACGCAACACCAGGAAGTGGACCACGGTTTGCCGGGAGCCAGTTCCAATTACGCGGCTCAGGAAGCGATATTGAATACGGGCCTGGTCTTTTTAAACGCCACCGCAGTGACGAC
125326 NZ_CP029049.1 Miniimonas-sp Bacteria 2395649-2409263 13615 228 61 CCCGCGCGAG CCCGCGCGAGCGGGGATGGCCCCTCGCGGACCCCGTAGTCGACGTTGCCCCAGATGTGCTCCCCGCGCGAGCGGGGATGGCCCATCACATCCGCGCCAGCATCACCGCCGCACGCGGTGCTCCCCGCGCGAGCGGGGATGGCCCCCGATACGCGCCCAGCGTCGGCATCGGAGACCCGTGCTCCCCGCGCGAGCGGGGATGGCCCCATCTGAGCGGCCCGGATTGCGACCTTCGTCGCGTGCTCCCCGCGCGAGCGGGGATGGCCCGGTCGACGCGCTGGCGGCCCTGCGGAAGATGCGGTGCTCCCCGCGCGAGCGGGGATGGCCCCCAGGGCCGGTTCGACCACCCGCTCGACCCAGGGTGCTCCCCGCGCGAGCGGGGATGGCCCCCCTTCCGCGAAGGGTGAGGCAACTCCCCTTCCGTGCTCCCCGCGCGAGCGGGGATGGCCCCAGGTCCAGGAGTGCGTCGACGACGTCCGCGATGTGCTCCCCGCGCGAGCGGGGATGGCCCCTGCTGGTCGATCCGGGCGTACTCCTCGATCTCGTGCTCCCCGCGCGAGCGGGGATGGCCCTCAACCTCCCCTCAAGTACCCTCGGTCGTACGCGTGCTCCCCGCGCGAGCGGGGATGGCCCCGCGACCGGCAGGATCGTCCCGATGCACTCCCGGTGCTCCCCGCGCGAGCGGGGATGGCCCGTTCGCGAACGGCGCGACGATGCAGTTCAAGGCGTGCTCCCCGCGCGAGCGGGGATGGCCCCCGACCGGGGTCCACCCGTCCGCAGGGAAGGGCGTGCTCCCCGCGCGAGCGGGGATGGCCCCCTGCACCAGCCAGCGAGAACTCAGCAGGCTGAGTGCTCCCCGCGCGAGCGGGGATGGCCCCACCCTCTCGGTCAAGCACCGCGACGGGCAGTAGTGCTCCCCGCGCGAGCGGGGATGGCCCCTTCTCCGTCCCCGGGCCGGGCCTGGGAAAAGGGTGCTCCCCGCGCGAGCGGGGATGGCCCGGCCGCCGGCGTGAGCCAGCGCGACCTCTCCGAGTGCTCCCCGCGCGAGCGGGGATGGCCCCCCACATTGCCTCCACGCCGGCGTGCCTTGCTGGTGCTCCCCGCGCGAGCGGGGATGGCCCCCAGTACAGGCAACCGGCCATGACGACCGTGAAGTGCTCCCCGCGCGAGCGGGGATGGCCCCGTAGCGGCCCGGCCGCTCGGTGTCTCCCGAACGTGCTCCCCGCGCGAGCGGGGATGGCCCTGTGGAGCGGGTGGAGGCGTCGGGGCAGGGGTGGTGCTCCCCGCGCGAGCGGGGATGGCCCCTCGAGTCGGGGATCGGCCGGGTGAACCCGCGGGTGCTCCCCGCGCGAGCGGGGATGGCCCGCCGCCGATGATCGCGGAGGTCGTCTCCGACGCGTGCTCCCCGCGCGAGCGGGGATGGCCCGTGGCGGGGTCCTCGACCGGCTCCACCCACCACGTGCTCCCCGCGCGAGCGGGGATGGCCCCATCCGCCTCATCGACGCCTGGTGGGCCGCGCGGTGCTCCCCGCGCGAGCGGGGATGGCCCGGCGTTCGCTGTAGTGCCAGCCGGGGGCACGATGTGCTCCCCGCGCGAGCGGGGATGGCCCCTCCTCGAGGTACCGGGGGCGGCCCATGCCCTGGTGCTCCCCGCGCGAGCGGGGATGGCCCCCACCGAGGGGTCGACAGCGGTCAGCAAGGGGCGTGCTCCCCGCGCGAGCGGGGATGGCCCCTGCAACGGACAGACGTGCATCTGCACGTTCCGGTGCTCCCCGCGCGAGCGGGGATGGCCCCGACTCCGTCGAGCTCGACAAGTCCTTCACCGAGTGCTCCCCGCGCGAGCGGGGATGGCCCCAGGTAGATGTCGGTGAGGTCGGTGAGCGTGGTGTGCTCCCCGCGCGAGCGGGGATGGCCCCAACGAGTACGCGATGACCGTCACCGACGTGTGGTGCTCCCCGCGCGAGCGGGGATGGCCCCCGCCGCCGACCAGGGACGTCTTGAACTCGTCGGTGCTCCCCGCGCGAGCGGGGATGGCCCCCAGCCGGCCACGACGGAGATGCCGTCGAAGGCGTGCTCCCCGCGCGAGCGGGGATGGCCCCCGTATGCCTACACAGGTGGTTGTTTGGCCATTGTGCTCCCCGCGCGAGCGGGGATGGCCCCGGGCTGCCTGTCCGCTCAGGGAAGCCGGAGGAGTGCTCCCCGCGCGAGCGGGGATGGCCCCGCCGTGAGCACGAGGCGATGAACCGCGACCCAGTGCTCCCCGCGCGAGCGGGGATGGCCCGGCGTGCGCGGCAACGAAGTCGGAGGTCACGAAGTGCTCCCCGCGCGAGCGGGGATGGCCCCCGACTCCCAGAAGGATACGAATAGCAGAGGGGGTGCTCCCCGCGCGAGCGGGGATGGCCCCCGGTGCGCGAGACCCTGCACCCACGCCCAGCCGTGCTCCCCGCGCGAGCGGGGATGGCCCGTACGTCCGCTCGCGCGCCTTCCGCGCCTCCGAGTGCTCCCCGCGCGAGCGGGGATGGCCCCGGCCCAGCTCTGCCACCGTCGGGTCATCCCTGGTGCTCCCCGCGCGAGCGGGGATGGCCCGCGGGGTCATGAGACGAGGCCTTCGAGGTCGAGGTGCTCCCCGCGCGAGCGGGGATGGCCCCGGCTTCGGCAGGTACAGGAGCGCCGTCAGCACGTGCTCCCCGCGCGAGCGGGGATGGCCCGGCCGTGACCGCCGCCTCTAGGTACGGGTGCCAGTGCTCCCCGCGCGAGCGGGGATGGCCCCTCACCGAGCAGCTCGGGCTGCCCGTCGACCTGGTGCTCCCCGCGCGAGCGGGGATGGCCCTCGTCTCCGACGTGAACCTGTCGGGCGCCGTACGTGCTCCCCGCGCGAGCGGGGATGGCCCCCATGTGGCTACGGATGAGAGTCCGTATCGTCAGTGCTCCCCGCGCGAGCGGGGATGGCCCCCGTCCCAGTAGTCGAGAATGTCAGACGTGTAGGTGCTCCCCGCGCGAGCGGGGATGGCCCCCGTCGCCAGGGACTGATTCCGTGACGCGCCGTGTGCTCCCCGCGCGAGCGGGGATGGCCCCCCTCGAAAGCTCGACCCATGAAAGGAGACACCGTGCTCCCCGCGCGAGCGGGGATGGCCCTCCAACCCAACCAGCACAATCCCTACCCCCGGAGTGCTCCCCGCGCGAGCGGGGATGGCCCGCCGCCCGCGGACCTGTCGTACGGCAACAAGCGGTGCTCCCCGCGCGAGCGGGGATGGCCCCCAGCCGCGCTCTCGGCGCAACGTGGATCTGCGGTGCTCCCCGCGCGAGCGGGGATGGCCCGCGGGCCCTGGACGTCCTCGACAGCCAGGACGCGTGCTCCCCGCGCGAGCGGGGATGGCCCCTCGCTCACCCATGCGGTGCGGGCGCCGGGCCAGTGCTCCCCGCGCGAGCGGGGATGGCCCCGGCCGCGCCCCCTTCACCCTCGCCGACATCCGGTGCTCCCCGCGCGAGCGGGGATGGCCCCGAGGCGGTAGGTGCCGCGCTCTCCGGTGGGGGGTGCTCCCCGCGCGAGCGGGGATGGCCCGGAGGACCCCATGGCCACCACCTCCCAGCGAGCGTGCTCCCCGCGCGAGCGGGGATGGCCCCATCCGCCTCATCGACGCCTGGTGGGCCGCGCGGTGCTCCCCGCGCGAGCGGGGATGGCCCGGCGTTCGCTGTAGTGCCAGCCGGGGGCACGATGTGCTCCCCGCGCGAGCGGGGATGGCCCCTCCTCGAGGTACCGGGGGCGGCCCATGCCCTGGTGCTCCCCGCGCGAGCGGGGATGGCCCCCACCGAGGGGTCGACAGCGGTCAGCAAGGGGCGTGCTCCCCGCGCGAGCGGGGATGGCCCCTGCAACGGACAGACGTGCATCTGCACGTTCCGGTGCTCCCCGCGCGAGCGGGGATGGCCCCGACTCCGTCGAGCTCGACAAGTCCTTCACCGAGTGCTCCCCGCGCGAGCGGGGATGGCCCCAGGTAGATGTCGGTGAGGTCGGTGAGCGTGGTGTGCTCCCCGCGCGAGCGGGGATGGCCCCAACGAGTACGCGATGACCGTCACCGACGTGTGGTGCTCCCCGCGCGAGCGGGGATGGCCCCCGCCGCCGACCAGGGACGTCTTGAACTCGTCGGTGCTCCCCGCGCGAGCGGGGATGGCCCCCAGCCGGCCACGACGGAGATGCCGTCGAAGGCGTGCTCCCCGCGCGAGCGGGGATGGCCCCCGTATGCCTACACAGGTGGTTGTTTGGCCATTGTGCTCCCCGCGCGAGCGGGGATGGCCCCGGGCTGCCTGTCCGCTCAGGGAAGCCGGAGGAGTGCTCCCCGCGCGAGCGGGGATGGCCCCGCCGTGAGCACGAGGCGATGAACCGCGACCCAGTGCTCCCCGCGCGAGCGGGGATGGCCCGGCGTGCGCGGCAACGAAGTCGGAGGTCACGAAGTGCTCCCCGCGCGAGCGGGGATGGCCCCCGACTCCCAGAAGGATACGAATAGCAGAGGGGGTGCTCCCCGCGCGAGCGGGGATGGCCCCCGGTGCGCGAGACCCTGCACCCACGCCCAGCCGTGCTCCCCGCGCGAGCGGGGATGGCCCGTACGTCCGCTCGCGCGCCTTCCGCGCCTCCGAGTGCTCCCCGCGCGAGCGGGGATGGCCCCGGCCCAGCTCTGCCACCGTCGGGTCATCCCTGGTGCTCCCCGCGCGAGCGGGGATGGCCCGCGGGGTCATGAGACGAGGCCTTCGAGGTCGAGGTGCTCCCCGCGCGAGCGGGGATGGCCCCGGCTTCGGCAGGTACAGGAGCGCCGTCAGCACGTGCTCCCCGCGCGAGCGGGGATGGCCCGGCCGTGACCGCCGCCTCTAGGTACGGGTGCCAGTGCTCCCCGCGCGAGCGGGGATGGCCCCTCACCGAGCAGCTCGGGCTGCCCGTCGACCTGGTGCTCCCCGCGCGAGCGGGGATGGCCCTCGTCTCCGACGTGAACCTGTCGGGCGCCGTACGTGCTCCCCGCGCGAGCGGGGATGGCCCCCATGTGGCTACGGATGAGAGTCCGTATCGTCAGTGCTCCCCGCGCGAGCGGGGATGGCCCCCGTCCCAGTAGTCGAGAATGTCAGACGTGTAGGTGCTCCCCGCGCGAGCGGGGATGGCCCCCGTCGCCAGGGACTGATTCCGTGACGCGCCGTGTGCTCCCCGCGCGAGCGGGGATGGCCCCCCTCGAAAGCTCGACCCATGAAAGGAGACACCGTGCTCCCCGCGCGAGCGGGGATGGCCCTCCAACCCAACCAGCACAATCCCTACCCCCGGAGTGCTCCCCGCGCGAGCGGGGATGGCCCGCCGCCCGCGGACCTGTCGTACGGCAACAAGCGGTGCTCCCCGCGCGAGCGGGGATGGCCCCCAGCCGCGCTCTCGGCGCAACGTGGATCTGCGGTGCTCCCCGCGCGAGCGGGGATGGCCCGCGGGCCCTGGACGTCCTCGACAGCCAGGACGCGTGCTCCCCGCGCGAGCGGGGATGGCCCCTCGCTCACCCATGCGGTGCGGGCGCCGGGCCAGTGCTCCCCGCGCGAGCGGGGATGGCCCCGGCCGCGCCCCCTTCACCCTCGCCGACATCCGGTGCTCCCCGCGCGAGCGGGGATGGCCCCGAGGCGGTAGGTGCCGCGCTCTCCGGTGGGGGGTGCTCCCCGCGCGAGCGGGGATGGCCCGGAGGACCCCATGGCCACCACCTCCCAGCGAGCGTGCTCCCCGCGCGAGCGGGGATGGCCCTCAATCCCTCGCTCGGACTTCTGGGCATCGTGCGTGCTCCCCGCGCGAGCGGGGATGGCCCCGCGTCGGATGCGGCGCTGCGGGCGCGTGGCACGTGCTCCCCGCGCGAGCGGGGATGGCCCCGCGTCGGATGCGGCGCTACGGGCGCGGGGTACGTGCTCCCCGCGCGAGCGGGGATGGCCCCGAAGCCGACCCACAGGCAGGCGGCGCCCCATCGTGCTCCCCGCGCGAGCGGGGATGGCCCCCACGGCTCGCCGTGCTCGTCGGTCTCGACGCGGTGCTCCCCGCGCGAGCGGGGATGGCCCGCCCAAGGCCCGCCGTGGCCGTGTAGGCATCGCGTGCTCCCCGCGCGAGCGGGGATGGCCCCCGCTCGGGCCGCTCCCCGGGAACCGTGGATGCGTGCTCCCCGCGCGAGCGGGGATGGCCCCGGGCCAGCCGTCTGCGACACCTGGCTACTGGCGTGCTCCCCGCGCGAGCGGGGATGGCCCGGCGTGGGCGCAGATCGCGACCCTCGGGGGGACGTGCTCCCCGCGCGAGCGGGGATGGCCCCTCCTTCAGGGCGTCCGCCGCGAGGTCCGTGTTGTGCTCCCCGCGCGAGCGGGGATGCCCCCCCGGGCACGCTCGCTTCTCCGAAGGCGTCGATGTGCTCCCCGCGCGAGCGGGGATGGCCCGGCGACGGGCATCGGTCCGGCCGATCCCCACACGTGCTCCCCGCGCGAGCGGGGATGGCCCCCGCCGACACCGACTGCTGTGCGCTCGCCGTGTGTGCTCCCCGCGCGAGCGGGGATGGCCCGCAGATCGCGAACGCGGCGCTCGCCCTCGAGGAGTGCTCCCCGCGCGAGCGGGGATGGCCCCGCGCCCACGATCACTGGCCCGACCGGTGCTCAGTGCTCCCCGCGCGAGCGGGGATGGCCCGACTCCGGAGCGTCGCGCGTCGTCGTTAATCTTGTGCTCCCCGCGCGAGCGGGGATGGCCCGTCGCCTCGTCGGATGCGCTGGGCGAGCGCCTCGTGCTCCCCGCGCGAGCGGGGATGGCCCGCCTCGCTCATCAGCCTGGCCAAGGGCGGTCGGGTGCTCCCCGCGCGAGCGGGGATGGCCCCCAGTTCGTTGACGACGCGCTGATCTACACGTCGTGCTCCCCGCGCGAGCGGGGATGGCCCCGCCCACCCCGCCATCCCCGAGCGGCGACGACCGTGCTCCCCGCGCGAGCGGGGATGGCCCGATCGGCCACACCGCGAAGGCACCCCCACGACGGTGCTCCCCGCGCGAGCGGGGATGGCCCTCGCGTGGGGGTCTCCCGGGTGTGCCTCCTCGAGTGCTCCCCGCGCGAGCGGGGATGGCCCGTTCGCGCCGAGCGCCCGGTTCGCGTCCGCCGTGTGCTCCCCGCGCGAGCGGGGATGGCCCGATCGACGCCTCCACAGCCGGGGCAGGAGCGGGGTGCTCCCCGCGCGAGCGGGGATGGCCCCCAGCTCGTCGCGCGCCGATGGCGACCCCACCGGTGCTCCCCGCGCGAGCGGGGATGGCCCGCCGACTCGACGTACCTCCAGCAGAAGGTGACGGTGCTCCCCGCGCGAGCGGGGATGGCCCCGTTTCCTCGGGGGGCGCGGGTCCCGCGCTGGCGTGCTCCCCGCGCGAGCGGGGATGGCCCCCCTTCCTAGAACCCTTCCCGGAACCCTTCCGCGTGCTCCCCGCGCGAGCGGGGATGGCCCTGGTGGACGCGGCCGCCACGTCACAGAGTGGCGGTGCTCCCCGCGCGAGCGGGGATGGCCCTGGTGGACGCGGCCGCCACGTCACAGAGTGGCGGTGCTCCCCGCGCGAGCGGGGATGGCCCGTCGTCGTCGGCCGCGAGCTCGGGGATCGTCGCGTGCTCCCCGCGCGAGCGGGGATGGCCCCGGGACCATCGGCATGTGCCCGTCGCGCACAGCGTGCTCCCCGCGCGAGCGGGGATGGCCCGCGTCGCGGCCGTCAGCCGCTCCGAAGGGTGCTGTGCTCCCCGCGCGAGCGGGGATGGCCCGGGTGAGGCAACTCCCCTTCCCCCTTCCCCTTAGTGCTCCCCGCGCGAGCGGGGATGGCCCGCCGTGTGCGTCGTGCGGGCACGGGAAGTCGATGTGCTCCCCGCGCGAGCGGGGATGGCCCGCCTGCATCGGCCATCGACCCCGCGCCCTACCTGTGCTCCCCGCGCGAGCGGGGATGGCCCTCGGCCGATGTCGGGTCAGGATGCGTGGATCGCGTGCTCCCCGCGCGAGCGGGGATGGCCCCCGCCACGGGGAGCCCGCTTACGGCACAGGCTCGTGCTCCCCGCGCGAGCGGGGATGGCCCCAGCAGCGCACCAGCGAGAGCGCGCGCCACCAGGTGCTCCCCGCGCGAGTGGGGATGGCCCTTGGATCGCCCGCCACATGTTCACGAGCCACCCGTGCTCCCCGCGCGAGCGGGGATGGCCCGGCTGTGACGGCGCTGTCGGCGCGTTGCACGTTGTGCTCCCCGCGCGAGCGGGGATGGCCCCAGGTCTGTCGGTCCGTCCGACCCGCCCCACCGGTGCTCCCCGCGCGAGCGGGGATGGCCCGACCTCACGCAGGTCATCGACGACGACCTCGCCGTGCTCCCCGCGCGAGCGGGGATGGCCCGACCTCGACCGGAGTGCATCGCGAGTGCCGCACGTGCTCCCCGCGCGAGCGGGGATGGCCCGTACGTGAGTTGCTGCACGGAAGTGAGCGAGAGGTGCTCCCCGCGCGAGCGGGGATGGCCCCCTCGACCCCTCCATCGTCTCCACCACCGTCAGGTGCTCCCCGCGCGAGCGGGGATGGCCCCCAGCCATGAGTGTCCTCCTCAGGACGAGAGTGGTGCTCCCCGCGCGAGCGGGGATGGCCCGACCTGCGCAGTCCGCACCGCGCCCTTCTTGCGGTGCTCCCCGCGCGAGCGGGGATGGCCCGGTCACCAACGGCGATGTGACCGTGTGGCTGCCGTGCTCCCCGCGCGAGCGGGGATGGCCCTGCCCCCTCAGGCGCCTTCGGGCGTCGAGGAGGGTGCTCCCCGCGCGAGCGGGGATGGCCCCCCGAGGCCTCCCCCAGCCCCCTGGACCTGGCGGTGCTCCCCGCGCGAGCGGGGATGGCCCGGGCGCGCCGGCTCGCGGGCCGGAGGAGATGGCGTGCTCCCCGCGCGAGCGGGGATGGCCCCCCGGCCGCGCTCGTCTCGCTCGCGTCGGTCGCGTGCTCCCCGCGCGAGCGGGGATGGCCCCTCGGCAAGTTGACCGTGAACTGGACGAAGCCGGTGCTCCCCGCGCGAGCGGGGATGGCCCGCCCGGTGACCCGGTTGATGAACTCGCAGCCCGGTGCTCCCCGCGCGAGCGGGGATGGCCCCTCGGTGCGGCACGGACTGCGGGACGCCCTCGCGTGCTCCCCGCGCGAGCGGGGATGGCCCCGGCTCGAGCTCGCGTGCCAACGCCAACGACAGGTGCTCCCCGCGCGAGCGGGGATGGCCCGCAGATCGCGAACGCGGCGCTCGCCCTCGAGGAGTGCTCCCCGCGCGAGCGGGGATGGCCCGCCGCAGCGCGTGCCGCTGCTCGTCACGCGAGGGTGCTCCCCGCGCGAGCGGGGATGGCCCTGAGCGCGCGGGCGCTCGTGGTCGAGCTCGGCGGTGCTCCCCGCGCGAGCGGGGATGGCCCCGAAGGGACCAGCCATGCACCTCACCGCCCGCGGTGCTCCCCGCGCGAGCGGGGATGGCCCGCGCGTCACCCTCTACTGCGACCCCGCCGTGAAGTGCTCCCCGCGCGAGCGGGGATGGCCCCGCCTGGCACAGCGGCATCGCACCCGCGGCACCGTGCTCCCCGCGCGAGCGGGGATGGCCCGAAGAAGTCCGACGCGGCGGCTTGGGTGGCCTGGTGCTCCCCGCGCGAGCGGGGATGGCCCCGCGCGCATCGCACGCGACCTCGACCTCGACCCGTGCTCCCCGCGCGAGCGGGGATGGCCCGGCGACCCGCGAGGCGCCGACGTGATGGCCGCGGTGCTCCCCGCGCGAGCGGGGATGGCCCCGCGGCCTGCCGCTCGTCGGCGTCGTCGGGGTCGTGCTCCCCGCGCGAGCGGGGATGGCCCCCGCCCGACGGGGCCGCCGGGCGAGCCCATGCCGTGCTCCCCGCGCGAGCGGGGATGGCCCCAGCGCTGCCGCGATCCGCGGCACTGTGACCGCGTGCTCCCCGCGCGAGCGGGGATGGCCCCCTCGGCCTGTACGTGTGGTGGAAGCAGTCGACGTGCTCCCCGCGCGAGCGGGGATGGCCCCGGCGCGGACCCGCATTTCGACGGCATCCAGACGTGCTCCCCGCGCGAGCGGGGATGGCCCCATCGTGAGGTCCTTCGCGCACACCACGAGCAGGTGCTCCCCGCGCGAGCGGGGATGGCCCGAGCGCCGGGTACTCGGTGGACGTGTCGAGCAGGTGCTCCCCGCGCGAGCGGGGATGGCCCCGACGCGTCCAAGATGGAGACGGCCCAGCGGAAGTGCTCCCCGCGCGAGCGGGGATGGCCCCCGCTCGCGCCCACCTGCCCCCGCGCCGCCTGGGTGCTCCCCGCGCGAGCGGGGATGGCCCGCCCACTGCCTGGCTGCCGTCTGCGCGGCCAGCGTGCTCCCCGCGCGAGCGGGGATGGCCCCGACCTCGCGGTGGAGTACGTGCCGCAGGCGGAGTGCTCCCCGCGCGAGCGGGGATGACCCCTGGTCGCCGACGGCGGTGATCAAGTTGTGCGTGTGCTCCCCGCGCGAGCGGGGATGGCCCCGAGACGGCAACGGGCGCGGCGGACACGATGCGGTGCTCCCCGCGCGAGCGGGGATGGCCCCAGCGACCGCCCGAGGGATGGGTGGTCGGACGCGTGCTCCCCGCGCGAGCGGGGATGGCCCCACCCCGGTCGTCTACTCGGTGACGACCGGTGGGTGCTCCCCGCGCGAGCGGGGATGGCCCCTCTTTGAGCGCGTCCGCTACCAGGTCCGTGTTGTGCTCCCCGCGCGAGCGGGGATGGCCCCCACACCACCGACGCATCCACGCTGGAGGTGACGTGCTCCCCGCGCGAGCGGGGATGGCCCCGCCTCATCGGCCGACTTCGCCACCCCCGAGCGGTGCTCCCCGCGCGAGCGGGGATGGCCCCTCATTCAGCCGGGCTCGCGCGTCCTCGATGCCGTGCTCCCCGCGCGAGCGGGGATGGCCCGCCCTGTACTCGGCCGACGTGGCCGAGCTGGACGTGCTCCCCGCGCGAGCGGGGATGGCCCCGCGGACGTCACGTAGCCGCCAGCGAGCGGGTAGTGCTCCCCGCGCGAGCGGGGATGGCCCGTACCAGATCACGTCTTATCGTCCTCCTCACCCGTGCTCCCCGCGCGAGCGGGGATGGCCCCTGGGCGCCGACGGCGGTGATCAGGTTGTGCGTGTGCTCCCCGCGCGAGCGGGGATGGCCCTCGTGTCCGCCGCCGGCGACGTCGCGTCCGTCGGTGCTCCCCGCGCGAGCGGGGATGGCCCCTTCTCGAACTCCGTGTCGTTCTGGTCCAGATCGTGCTCCCCGCGCGAGCGGGGATGGCCCTCCGCAGAGCCGATCGACGTGAGCACGGACGCGGTGCTCCCCGCGCGAGCGGGGATGGCCCTCCGCAGAGCCGATCGACGTGAGCACGGACGCGGTGCTCCCCGCGCGAGCGGGGATGGCCCGAAGGCCCCGTGGCAGCGACTCGCGGCCAGGGCGTGCTCCCCGCGCGAGCGGGGATGGCCCCACGGTCTTGAGGCTGGCGTTCAGGCTGCGCCGGTGCTCCCCGCGCGAGCGGGGATGGCCCCACCACCGGCCCCTACGCCTGGTCAGGGTCCTAGTGCTCCCCGCGCGAGCGGGGATGGCCCCGGCTTCGGTGACGCGGGGATCACCCATCCGACGTGCTCCCCGCGCGAGCGGGGATGGCCCCCTCGGCCTGTACGCGTGGTGGAAGCAGTCGACGTGCTCCCCGCGCGAGCGGGGATGGCCCCTGGTCGCCGACGGCGGTGATCAGGTTGTGCGTGTGCTCCCCGCGCGAGCGGGGATGGCCCCTTCTTCCACGGCCCGTACATCAACGGCGCGGAGTGCTCCCCGCGCGAGCGGGGATGGCCCCCGGCGGGGAGCGCACCGTGGCCGTCCTCGGAGGTGCTCCCCGCGCGAGCGGGGATGGCCCGTCGACGCGGGCGTGCACCGGCAGTGGGATCGGGTGCTCCCCGCGCGAGCGGGGATGGCCCGCTCCCGACGGCGGTCGCGACGGTCGTGCCGACGTGCTCCCCGCGCGAGCGGGGATGGCCCGCTCCCGACGGCGGTCGCGACGGTCGTGCCGACGTGCTCCCCGCGCGAGCGGGGATGGCCCCGGTGAGTGCCCGAACGGAAGCATCAGCAGCGCGTGCTCCCCGCGCGAGCGGGGATGGCCCCGGTGAGTGCCCGAACGGAAGCATCAGCAGCGCGTGCTC
124541 NZ_CP028800.2 Acinetobacter-junii-strain-WCHAJ59-chromosome Bacteria 920937-934236 13300 31 429 CACCGGCACC CACCGGCACCGGCACCATTGTTGACGATGGTAGCGACCCTGCGAACCCAGGCCAACCTGGCAATCCAGCGACACCTGGCTACGACAACGACTTACGTGCAAGCGTGAACGATGCAGCAGTCTACGAAGGCCAAAGCTTAACCCACGACGTGACCCTGACTGGCAGCTCAAGTGCGGCCACCCCAGTGACCGTGACCCTAAGCAATGGCAGCGCGACCTTGGGTACCGACACCGCGACCGTGGTGACGGTTGAATATGCAAATGGCAGCACTGCAAGCTTCACCCCAGACGTGAATGGCCAATTCACCGTGACCGTCCCGGCAGGCGATACTGGCTTTAAAGTCATCGTCAGCAGCACAGACGACACGGTACTTGAAGGACTAGAAAGCTACACCATCAGCGTTGCGACGCCAGAACAAAGCACAGCAGACACCGGCACCGGCACCATTGTTGACGATGGTAGCGACCCTGCGAACCCAGGCCAACCTGGCAATCCAGCGACACCTGGCTACGACAACGACTTACGTGCAAGCGTGAACGATGCAGCAGTCTACGAAGGCCAAAGCTTAACCCACGACGTGACCCTGACTGGCAGCTCAAGTGCGGCCACCCCAGTGACCGTGACCCTAAGCAATGGCAGCGCGACCTTGGGTACCGACACCGCGACCGTGGTGACGGTTGAATATGCAAATGGCAGCACTGCAAGCTTCACCCCAGACGTGAATGGCCAATTCACCGTGACCGTCCCTGCAGGCGATACTGGCTTTAAAGTCATCGTCAGCAGCACAGACGACACGGTACTTGAAGGACTAGAAAGCTACACCATCAGCGTTGCGACGCCAGAACAAAGCACAGCAGACACCGGCACCGGCACCATTGTTGACGATGGTAGCGACCCTGCGAACCCAGGCCAACCTGGCAATCCAGCGACACCTGGCTACGACAACGACTTACGTGCAAGCGTGAACGATGCAGCAGTCTACGAAGGCCAAAGCTTAACCCACGACGTGACCCTGACTGGCAGCTCAAGTGCGGCCACCCCAGTGACCGTGACCCTAAGCAATGGCAGCGCGACCTTGGGTACCGACACCGCGACCGTGGTGACGGTTGAATATGCAAATGGCAGCACTGCAAGCTTCACCCCAGACGTGAATGGCCAATTCACCGTGACCGTCCCGGCAGGCGATACTGGCTTTAAAGTCATCGTCAGCAGCACAGACGACACGGTACTTGAAGGACTAGAAAGCTACACCATCAGCGTTGCGACGCCAGAACAAAGCACAGCAGACACCGGCACCGGCACCATTGTTGACGATGGTAGCGACCCTGCGAACCCAGGCCAACCTGGCAATCCAGCGACACCTGGCTACGACAACGACTTACGTGCAAGCGTGAACGATGCAGCAGTCTACGAAGGCCAAAGCTTAACCCACGACGTGACCCTGACTGGCAGCTCAAGTGCGGCCACCCCAGTGACCGTGACCCTAAGCAATGGCAGCGCGACCTTGGGTACCGACACCGCGACCGTGGTGACGGTTGAATATGCAAATGGCAGCACTGCAAGCTTCACCCCAGACGTGAATGGCCAATTCACCGTGACCGTCCCGGCAGGCGATACTGGCTTTAAAGTCATCGTCAGCAGCACAGACGACACGGTACTTGAAGGACTAGAAAGCTACACCATCAGCGTTGCGACGCCAGAACAAAGCACAGCAGACACCGGCACCGGCACCATTGTTGACGATGGTAGCGACCCTGCGAACCCAGGCCAACCTGGCAATCCAGCGACACCTGGCTACGACAACGACTTACGTGCAAGCGTGAACGATGCAGCAGTCTACGAAGGCCAAAGCTTAACCCACGACGTGACCCTGACTGGCAGCTCAAGTGCGGCCACCCCAGTGACCGTGACCCTAAGCAATGGCAGCGCGACCTTGGGTACCGACACCGCGACCGTGGTGACGGTTGAATATGCAAATGGCAGCACTGCAAGCTTCACCCCAGACGTGAATGGCCAATTCACCGTGACCGTCCCGGCAGGCGATACTGGCTTTAAAGTCATCGTCAGCAGCACAGACGACACGGTACTTGAAGGACTAGAAAGCTACACCATCAGCGTTGCGACGCCAGAACAAAGCACAGCAGACACCGGCACCGGCACCATTGTTGACGATGGTAGCGACCCTGCGAACCCAGGCCAACCTGGCAATCCAGCGACACCTGGCTACGACAACGACTTACGTGCAAGCGTGAACGATGCAGCAGTCTACGAAGGCCAAAGCTTAACCCACGACGTGACCCTGACTGGCAGCTCAAGTGCGGCCACCCCAGTGACCGTGACCCTAAGCAATGGCAGCGCGACCTTGGGTACCGACACCGCGACCGTGGTGACGGTTGAATATGCAAATGGCAGCACTGCAAGCTTCACCCCAGACGTGAATGGCCAATTCACCGTGACCGTCCCGGCAGGCGATACTGGCTTTAAAGTCATCGTCAGCAGCACAGACGACACGGTACTTGAAGGGCTAGAAAGCTACACCATCAGCGTTGCGACGCCAGAACAAAGCACAGCAGACACCGGCACCGGCACCATTGTTGACGATGGTAGCGACCCTGCGAACCCAGGCCAACCTGGCAATCCAGCGACACCTGGCTACGACAACGACTTACGTGCAAGCGTGAACGATGCAGCAGTCTACGAAGGCCAAAGCTTAACCCACGACGTGACCCTGACTGGCAGCTCAAGTGCGGCCACCCCAGTGACCGTGACCCTAAGCAATGGCAGCGCGACCTTGGGTACCGACACCGCGACCGTGGTGACGGTTGAATATGCAAATGGCAGCACTGCAAGCTTCACCCCAGACGTGAATGGCCAATTCACCGTGACCGTCCCGGCAGGCGATACTGGCTTTAAAGTCATCGTCAGCAGCACAGACGACACGGTACTTGAAGGACTAGAAAGCTACACCATCAGCGTTGCGACGCCAGAACAAAGCACAGCAGACACCGGCACCGGCACCATTGTTGACGATGGTAGCGACCCTGCGAACCCAGGCCAACCTGGCAATCCAGCGACACCTGGCTACGACAACGACTTACGTGCAAGCGTGAACGATGCAGCAGTCTACGAAGGCCAAAGCTTAACCCACGACGTGACCCTGACTGGCAGCTCAAGTGCGGCCACCCCAGTGACCGTGACCCTAAGCAATGGCAGCGCGACCTTGGGTACCGACACCGCGACCGTGGTGACGGTTGAATATGCAAATGGCAGCACTGCAAGCTTCACCCCAGACGTGAATGGCCAATTCACCGTGACCGTCCCGGCAGGCGATACTGGCTTTAAAGTCATCGTCAGCAGCACAGACGACACGGTACTTGAAGGACTAGAAAGCTACACCATCAGCGTTGCGACGCCAGAACAAAGCACAGCAGACACCGGCACCGGCACCATTGTTGACGATGGTAGCGACCCTGCGAACCCAGGCCAACCTGGCAATCCAACGACACCTGGCTACGACAACGACTTACGTGCAAGCGTGAACGATGCAGCAGTCTACGAAGGCCAAAGCTTAACCCACGACGTGACCCTGACTGGCAGCTCAAGTGCGGCCACCCCAGTGACCGTGACCCTAAGCAATGGCAGCGCGACCTTGGGTACCGACACCGCGACCGTGGTGACGGTTGAATATGCAAATGGCAGCACTGCAAGCTTCACCCCAGACGTGAATGGCCAATTCACCGTGACCGTCCCGGCAGGCGATACTGGCTTTAAAGTCATCGTCAGCAGCACAGACGACACGGTATTTGAAGGGCTAGAAAGCTACACCATCAGCGTTGCGACGCCAGAACAAAGCACAGCAGACACCGGCACCGGCACCATTGTTGACGATGGTAGCGACCCTGCGAACCCAGGCCAACCTGGCAATCCAGCGACACCTGGCTACGACAACGACTTACGTGCAAGCGTGAACGATGCAGCAGTCTACGAAGGCCAAAGCTTAACCCACGACGTGACCCTGACTGGCAGCTCAAGTGCGGCCACCCCAGTGACCGTGACCCTAAGCAATGGCAGCGCGACCTTGGGTACCGACACCGCGACCGTGGTGACGGTTGAATATGCAAATGGCAGCACTGCAAGCTTCACCCCAGACGTGAATGGCCAATTCACCGTGACCGTCCCTGCAGGCGATACTGGCTTTAAAGTCATCGTCAGCAGCACAGACGACACGGTACTTGAAGGACTAGAAAGATACACCATCAGCGTTGCGACGCCAGAACAAAGCACAGCAGACACCGGCACCGGCACCATTGTTGACGATGGTAGCGACCCTGCGAACCCAGGCCAACCTGGCAATCCAGCGACACCTGGCTACGACAACGACTTACGTGCAAGCGTGAACGATGCAGCAGTCTACGAAGGCCAAAGCTTAACCCACGACGTGACCCTGACTGGCAGCTCAAGTGCGGCCACCCCAGTGACCGTGACCCTAAGCAATGGCAGCGCGACCTTGGGTACCGACACCGCGACCGTGGTGACGGTTGAATATGCAAATGGCAGCACTGCAAGCTTCACCCCAGACGTGAATGGCCAATTCACCGTGACCGTCCCTGCAGGCGATACTGGCTTTAAAGTCATCGTCAGCAGCACAGACGACACGGTACTTGAAGGACTAGAAAGCTACACCATCAGCGTTGCGACGCCAGAACAAAGCACAGCAGACACTGGCACCGGCACCATTGTTGACGATGGTAGCGACCCTGCGAACCCAGGCCAACCTGGCAATCCAACGACACCTGGCTACGACAACGACTTACGTGCAAGCGTGAACGATGCAGCAGTCTACGAAGGCCAAAGCTTAACCCACGACGTGACCCTGACTGGCAGCTCAAGTGCGGCCACCCCAGTGACCGTGACCCTAAGCAATGGCAGCGCGACCTTGGGTACCGACACCGCGACCGTGGTGACGGTTGAATATGCAAATGGCAGCACTGCAAGCTTCACCCCAGACGTGAATGGCCAATTCACCGTGACCGTCCCGGCAGGCGATACTGGCTTTAAAGTCATCGTCAGCAGCACAGACGACACGGTACTTGAAGGACTAGAAAGCTACACCATCAGCGTTGCGACGCCAGAACAAAGCACAGCAGACACCGGCACCGGCACCATTGTTGACGATGGTAGCGACCCTGCGAACCCAGGCCAACCTGGCAATCCAGCGACACCTGGCTACGACAACGACTTACGTGCAAGCGTGAACGATGCAGCAGTCTACGAAGGCCAAAGCTTAACCCACGACGTGACCCTGACTGGCAGCTCAAGTGCGGCCACCCCAGTGACCGTGACCCTAAGCAATGGCAGCGCGACCTTGGGTACCGACACCGCGACCGTGGTGACGGTTGAATATGCAAATGGCAGCACTGCAAGCTTCACCCCAGACGTGAATGGCCAATTCACCGTGACCGTCCCGGCAGGCGATACTGGCTTTAAAGTCATCGTCAGCAGCACAGACGACACGGTACTTGAAGGACTAGAAAGCTACACCATCAGCGTTGCGACGCCAGAACAAAGCACAGCAGACACCGGCACCGGCACCATTGTTGACGATGGTAGCGACCCTGCGAACCCAGGCCAACCTGGCAATCCAGCGACACCTGGCTACGACAACGACTTACGTGCAAGCGTGAACGATGCAGCAGTCTACGAAGGCCAAAGCTTAACCCACGACGTGACCCTGACTGGCAGCTCAAGTGCGGCCACCCCAGTGACCGTGACCCTAAGCAATGGCAGCGCGACCTTGGGTACCGACACCGCGACCGTGGTGACGGTTGAATATGCAAATGGCAGCACTGCAAGCTTCACCCCAGACGTGAATGGCCAATTCACCGTGACCGTCCCGGCAGGCGATACTGGCTTTAAAGTCATCGTCAGCAGCACAGACGACACGGTACTTGAAGGGCTAGAAAGCTACACCATCAGCGTTGCGACGCCAGAACAAAGCACAGCAGACACCGGCACCGGCACCATTGTTGACGATGGTAGCGACCCTGCGAACCCAGGCCAACCTGGCAATCCAGCGACACCTGGCTACGACAACGACTTACGTGCAAGCGTGAACGATGCAGCAGTCTACGAAGGCCAAAGCTTAACCCACGACGTGACCCTGACTGGCAGCTCAAGTGCGGCCACCCCAGTGACCGTGACCCTAAGCAATGGCAGCGCGACCTTGGGTACCGACACCGCGACCGTGGTGACGGTTGAATATGCAAATGGCAGCACTGCAAGCTTCACCCCAGACGTGAATGGCCAATTCACCGTGACCGTCCCGGCAGGCGATACTGGCTTTAAAGTCATCGTCAGCAGCACAGACGACACGGTACTTGAAGGACTAGAAAGCTACACCATCAGCGTTGCGACGCCAGAACAAAGCACAGCAGACACCGGCACCGGCACCATTGTTGACGATGGTAGCGACCCTGCGAACCCAGGCCAACCTGGCAATCCAGCGACACCTGGCTACGACAACGACTTACGTGCAAGCGTGAACGATGCAGCAGTCTACGAAGGCCAAAGCTTAACCCACGACGTGACCCTGACTGGCAGCTCAAGTGCGGCCACCCCAGTGACCGTGACCCTAAGCAATGGCAGCGCGACCTTGGGTACCGACACCGCGACCGTGGTGACGGTTGAATATGCAAATGGCAGCACTGCAAGCTTCACCCCAGACGTGAATGGCCAATTCACCGTGACCGTCCCGGCAGGCGATACTGGCTTTAAAGTCATCGTCAGCAGCACAGACGACACGGTACTTGAAGGACTAGAAAGCTACACCATCAGCGTTGCGACGCCAGAACAAAGCACAGCAGACACCGGCACCGGCACCATTGTTGACGATGGTAGCGACCCTGCGAACCCAGGCCAACCTGGCAATCCAGCGACACCTGGCTACGACAACGACTTACGTGCAAGCGTGAACGATGCAGCAGTCTACGAAGGCCAAAGCTTAACCCACGACGTGACCCTGACTGGCAGCTCAAGTGCGGCCACCCCAGTGACCGTGACCCTAAGCAATGGCAGCGCGACCTTGGGTACCGACACCGCGACCGTGGTGACGGTTGAATATGCAAATGGCAGCACTGCAAGCTTCACCCCAGACGTGAATGGCCAATTCACCGTGACCGTCCCGGCAGGCGATACTGGCTTTAAAGTCATCGTCAGCAGCACAGACGACACGGTATTTGAAGGGCTAGAAAGCTACACCATCAGCGTTGCGACGCCAGAACAAAGCACAGCAGACACCGGCACCGGCACCATTGTTGACGATGGTAGCGACCCTGCGAACCCAGGCCAACCTGGCAATCCAGCGACACCTGGCTACGACAACGACTTACGTGCAAGCGTGAACGATGCAGCAGTCTACGAAGGCCAAAGCTTAACCCACGACGTGACCCTGACTGGCAGCTCAAGTGCGGCCACCCCAGTGACCGTGACCCTAAGCAATGGCAGCGCGACCTTGGGTACCGACACCGCGACCGTGGTGACGGTTGAATATGCAAATGGCAGCACTGCAAGCTTCACCCCAGACGTGAATGGCCAATTCACCGTGACCGTCCCTGCAGGCGATACTGGCTTTAAAGTCATCGTCAGCAGCACAGACGACACGGTACTTGAAGGACTAGAAAGCTACACCATCAGCGTTGCGACGCCAGAACAAAGCACAGCAGACACCGGCACCGGCACCATTGTTGACGATGGTAGCGACCCTGCGAACCCAGGCCAACCTGGCAATCCAGCGACACCTGGCTACGACAACGACTTACGTGCAAGCGTGAACGATGCAGCAGTCTACGAAGGCCAAAGCTTAACCCACGACGTGACCCTGACTGGCAGCTCAAGTGCGGCCACCCCAGTGACCGTGACCCTAAGCAATGGCAGCGCGACCTTGGGTACCGACACCGCGACCGTGGTGACGGTTGAATATGCAAATGGCAGCACTGCAAGCTTCACCCCAGACGTGAATGGCCAATTCACCGTGACCGTCCCTGCAGGCGATACTGGCTTTAAAGTCATCGTCAGCAGCACAGACGACACGGTACTTGAAGGACTAGAAAGCTACACCATCAGCGTTGCGACGCCAGAACAAAGCACAGCAGACACTGGCACCGGCACCATTGTTGACGATGGTAGCGACCCTGCGAACCCAGGCCAACCTGGCAATCCAACGACACCTGGCTACGACAACGACTTACGTGCAAGCGTGAACGATGCAGCAGTCTACGAAGGCCAAAGCTTAACCCACGACGTGACCCTGACTGGCAGCTCAAGTGCGGCCACCCCAGTGACCGTGACCCTAAGCAATGGCAGCGCGACCTTGGGTACCGACACCGCGACCGTGGTGACGGTTGAATATGCAAATGGCAGCACTGCAAGCTTCACCCCAGACGTGAATGGCCAATTCACCGTGACCGTCCCGGCAGGCGATACTGGCTTTAAAGTCATCGTCAGCAGCACAGACGACACGGTACTTGAAGGGCTAGAAAGCTACACCATCAGCGTTGCGACGCCAGAACAAAGCACAGCAGACACCGGCACCGGCACCATTGTTGACGATGGTAGCGACCCTGCGAACCCAGGCCAACCTGGCAATCCAGCGACACCTGGCTACGACAACGACTTACGTGCAAGCGTGAACGATGCAGCAGTCTACGAAGGCCAAAGCTTAACCCACGACGTGACCCTGACTGGCAGCTCAAGTGCGGCCACCCCAGTGACCGTGACCCTAAGCAATGGCAGCGCGACCTTGGGTACCGACACCGCGACCGTGGTGACGGTTGAATATGCAAATGGCAGCACTGCAAGCTTCACCCCAGACGTGAATGGCCAATTCACCGTGACCGTCCCGGCAGGCGATACTGGCTTTAAAGTCATCGTCAGCAGCACAGACGACACGGTACTTGAAGGACTAGAAAGCTACACCATCAGCGTTGCGACGCCAGAACAAAGCACAGCAGACACCGGCACCGGCACCATTGTTGACGATGGTAGCGACCCTGCGAACCCAGGCCAACCTGGCAATCCAGCGACACCTGGCTACGACAACGACTTACGTGCAAGCGTGAACGATGCAGCAGTCTACGAAGGCCAAAGCTTAACCCACGACGTGACCCTGACTGGCAGCTCAAGTGCGGCCACCCCAGTGACCGTGACCCTAAGCAATGGCAGCGCGACCTTGGGTACCGACACCGCGACCGTGGTGACGGTTGAATATGCAAATGGCAGCACTGCAAGCTTCACCCCAGACGTGAATGGCCAATTCACCGTGACCGTCCCGGCAGGCGATACTGGCTTTAAAGTCATCGTCAGCAGCACAGACGACACGGTACTTGAAGGACTAGAAAGCTACACCATCAGCGTTGCGACGCCAGAACAAAGCACAGCAGACACCGGCACCGGCACCATTGTTGACGATGGTAGCGACCCTGCGAACCCAGGCCAACCTGGCAATCCAGCGACACCTGGCTACGACAACGACTTACGTGCAAGCGTGAACGATGCAGCAGTCTACGAAGGCCAAAGCTTAACCCACGACGTGACCCTGACTGGCAGCTCAAGTGCGGCCACCCCAGTGACCGTGACCCTAAGCAATGGCAGCGCGACCTTGGGTACCGACACCGCGACCGTGGTGACGGTTGAATATGCAAATGGCAGCACTGCAAGCTTCACCCCAGACGTGAATGGCCAATTCACCGTGACCGTCCCGGCAGGCGATACTGGCTTTAAAGTCATCGTCAGCAGCACAGACGACACGGTACTTGAAGGACTAGAAAGCTACACCATCAGCGTTGCGACGCCAGAACAAAGCACAGCAGACACCGGCACCGGCACCATTGTTGACGATGGTAGCGACCCTGCGAACCCAGGCCAACCTGGCAATCCAGCGACACCTGGCTACGACAACGACTTACGTGCAAGCGTGAACGATGCAGCAGTCTACGAAGGCCAAAGCTTAACCCACGACGTGACCCTGACTGGCAGCTCAAGTGCGGCCACCCCAGTGACCGTGACCCTAAGCAATGGCAGCGCGACCTTGGGTACCGACACCGCGACCGTGGTGACGGTTGAATATGCAAATGGCAGCACTGCAAGCTTCACCCCAGACGTGAATGGCCAATTCACCGTGACCGTCCCGGCAGGCGATACTGGCTTTAAAGTCATCGTCAGCAGCACAGACGACACGGTACTTGAAGGGCTAGAAAGCTACACCATCAGCGTTGCGACGCCAGAACAAAGCACAGCAGACACCGGCACCGGCACCATTGTTGACGATGGTAGCGACCCTGCGAACCCAGGCCAACCTGGCAATCCAGCGACACCTGGCTACGACAACGACTTACGTGCAAGCGTGAACGATGCAGCAGTCTACGAAGGCCAAAGCTTAACCCACGACGTGACCCTGACTGGCAGCTCAAGTGCGGCCACCCCAGTGACCGTGACCCTAAGCAATGGCAGCGCGACCTTGGGTACCGACACCGCGACCGTGGTGACGGTTGAATATGCAAATGGCAGCACTGCAAGCTTCACCCCAGACGTGAATGGCCAATTCACCGTGACCGTCCCGGCAGGCGATACTGGCTTTAAAGTCATCGTCAGCAGCACAGACGACACGGTACTTGAAGGACTAGAAAGCTACACCATCAGCGTTGCGACGCCAGAACAAAGCACAGCAGACACCGGCACCGGCACCATTGTTGACGATGGTAGCGACCCTGCGAACCCAGGCCAACCTGGCAATCCAGCGACACCTGGCTACGACAACGACTTACGTGCAAGCGTGAACGATGCAGCAGTCTACGAAGGCCAAAGCTTAACCCACGACGTGACCCTGACTGGCAGCTCAAGTGCGGCCACCCCAGTGACCGTGACCCTAAGCAATGGCAGCGCGACCTTGGGTACCGACACCGCGACCGTGGTGACGGTTGAATATGCAAATGGCAGCACTGCAAGCTTCACCCCAGACGTGAATGGCCAATTCACCGTGACCGTCCCGGCAGGCGATACTGGCTTTAAAGTCATCGTCAGCAGCACAGACGACACGGTACTTGAAGGACTAGAAAGCTACACCATCAGCGTTGCGACGCCAGAACAAAGCACAGCAGACACCGGCACCGGCACCATTGTTGACGATGGTAGCGACCCTGCGAACCCAGGCCAACCTGGCAATCCAGCGACACCTGGCTACGACAACGACTTACGTGCAAGCGTGAACGATGCAGCAGTCTACGAAGGCCAAAGCTTAACCCACGACGTGACCCTGACTGGCAGCTCAAGTGCGGCCACCCCAGTGACCGTGACCCTAAGCAATGGCAGCGCGACCTTGGGTACCGACACCGCGACCGTGGTGACGGTTGAATATGCAAATGGCAGCACTGCAAGCTTCACCCCAGACGTGAATGGCCAATTCACCGTGACCGTCCCGGCAGGCGATACTGGCTTTAAAGTCATCGTCAGCAGCACAGACGACACGGTACTTGAAGGACTAGAAAGCTACACCATCAGCGTTGCGACGCCAGAACAAAGCACAGCAGACACCGGCACCGGCACCATTGTTGACGATGGTAGCGACCCTGCGAACCCAGGCCAACCTGGCAATCCAGCGACACCTGGCTACGACAACGACTTACGTGCAAGCGTGAACGATGCAGCAGTCTACGAAGGCCAAAGCTTAACCCACGACGTGACCCTGACTGGCAGCTCAAGTGCGGCCACCCCAGTGACCGTGACCCTAAGCAATGGCAGCGCGACCTTGGGTACCGACACCGCGACCGTGGTGACGGTTGAATATGCAAATGGCAGCACTGCAAGCTTCACCCCAGACGTGAATGGCCAATTCACCGTGACCGTCCCGGCAGGCGATACTGGCTTTAAAGTCATCGTCAGCAGCACAGACGACACGGTACTTGAAGGACTAGAAAGCTACACCATCAGCGTTGCGACGCCAGAACAAAGCACAGCAGACACCGGCACCGGCACCATTGTTGACGATGGTAGCGACCCTGCGAACCCAGGCCAACCTGGCAATCCAGCGACACCTGGCTACGACAACGACTTACGTGCAAGCGTGAACGATGCAGCAGTCTACGAAGGCCAAAGCTTAACCCACGACGTGACCCTGACTGGCAGCTCAAGTGCGGCCACCCCAGTGACCGTGACCCTAAGCAATGGCAGCGCGACCTTGGGTACCGACACCGCGACCGTGGTGACGGTTGAATATGCAAATGGCAGCACTGCAAGCTTCACCCCAGACGTGAATGGCCAATTCACCGTGACCGTCCCGGCAGGCGATACTGGCTTTAAAGTCATCGTCAGCAGCACAGACGACACGGTACTTGAAGGGCTAGAAAGCTACACCATCAGCGTTGCGACGCCAGAACAAAGCACAGCAGA
168390 NZ_LS483523.1 Streptococcus-pneumoniae-strain-4041STDY6836169-genome-assembly Bacteria 972788-986042 13255 334 36 TCAACAAGCG TCAACAAGCGCGTCGACCTCAGCAAGCACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCAAGCACGTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGCACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACGTCCGCATCAACAAGCGCAAGTACGTCAGCAAGCACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCTTCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCAAGCACGTCAGCAAGCACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCGTCGACCTCAGCAAGCATGTCGGCATCAACAAGCGCGTCGACCTCAGCAAGCACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGCACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACGTCCGCATCAACAAGCGCAAGTACGTCAGCAAGCACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCGTCGACCTCAGCAAGCACGTCAGCTTCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCTTCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCAAGCACGTCAGCAAGTACATCGGCATCAACAAGTGCCAGCACGTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGCACGTCCGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCGTCGACCTCAGCAAGCACGTCAGCTTCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGCACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACGTCCGCATCAACAAGCGCAAGTACGTCAGCAAGCACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCGTCGACCTCAGCAAGCACGTCAGCTTCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCTTCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCAAGCACGTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGCACGTCCGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCGTCGACCTCAGCAAGCACGTCAGCTTCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCTTCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCAAGCACGTCAGCAAGTACATCGGCATCAACAAGTGCCAGCACGTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGCACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACGTCCGCATCAACAAGCGCAAGTACGTCAGCAAGCACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCGTCGACCTCAGCAAGCACGTCAGCTTCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCAAGCACGTCAGCAAGTACATCGGCATCAACAAGTGCCAGCACGTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGCACGTCCGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGCACGTCAGCATCAACAAGCGCAAGCACGTCAGCAAGTACATCGGCGTCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGTGCAAGTACGTCAGCAAGTACATCAGCATCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCTTCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCAAGCACGTCAGCAAGTACATCGGCATCAACAAGTGCCAGCACGTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGCACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACGTCCGCATCAACAAGCGCAAGTACGTCAGCAAGCACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCGTCGACCTCAGCAAGCACGTCAGCTTCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGCACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACGTCCGCATCAACAAGCGCAAGTACGTCAGCAAGCACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCGTCGACCTCAGCAAGCACGTCAGCTTCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCGTCGACCTCAGCAAGCACGTCAGCTTCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGTGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCGTCGACCTCAGCAAGCACGTCAGCTTCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGCACGTCAGCAAGCACGTCAGCTTCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGCACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACGTCCGCATCAACAAGCGCAAGTACGTCAGCAAGGACATCGGCGTCAACAAGTGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGCACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACGTCCGCATCAACAAGCGCAAGTACGTCAGCAAGCACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCGTCGACCTCAGCAAGCACGTCAGCTTCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCGTCGACCTCAGCAAGCACGTCAGCTTCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCTTCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCAAGCACGTCAGCAAGTACATCGGCATCAACAAGTGCCAGCACGTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGCACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCGTCGACCTCAGCAAGCACGTCAGCTTCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCGTCGACCTCAGCAAGCACGTCAGCTTCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGTGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCGTCGACCTCAGCAAGCACGTCAGCTTCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGTGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGCACGTCCGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGCACGTCAGCATCAACAAGCGCAAGCACGTCAGCAAGTACATCGGCGTCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGTGCAAGTACGTCAGCAAGTACATCAGCATCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCTTCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCAAGCACGTCAGCAAGTACATCGGCATCAACAAGTGCCAGCACGTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACGTCCGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCAGCATCAACAAGCGCGTCGACCTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGCACGTCCGCATCAACAAGCGCAAGTACGTCAGCAAGTACATCGGCATCAACAAGCGCGTCGACCTCAGCAAGCACGTCAGCTTCAACAAGCGCAAGTACATCGGCAAGTACGTCCGCATCAACAAGCGCAAGCACGTCAGCAAGTACATCGGCATCAACAAGCGCAAGTACGTCAGCAAGTACGTCGGCATCAACAAGCGCAAGTACATCGGCAAGCACGTCAGCATCAACAAGTGCAAGTACGTCAGCAAGTACATCAGCATCAACAAGTGCAAGTACATCAGCAAGTACGTCAGCA
121316 NZ_CP027236.1 Actinomyces-sp Bacteria 3068750-3081811 13062 216 61 GGATCATCCC GGATCATCCCCGCGCGTGCGGGGTTTACACCGCCGGTCAGGGTAAGCTCACGACCGAGAACGGATCATCCCCGCACACGCAGGGTTTACCCTGCTCAAGGGTGACGAGCATGGCGTTTTTCCGGATCATCCCCGCACACGCGGGGTTTACATCCGTGGCCTGCTCGACGGCATCAAGTCCATGGGATCATCCCCGCACACGCGGGGTTTACGCCGTCCACGACGGGCGCGGCCACTGGCTGGTCGGATCATCCCCGCATGCGCGGGGTTTACGGTGACGCTCTTGGCCATCAGCCCCGCACCTCCGGATCATCCCCGCGTGCGCGGGGTTTACGCCTCCCGCTACGACTCCGACGGGAAGCGGAGGGGATCATCCCCGCACGCGCGGGGTTTACGCGGCGGCCACGGCGGCCTCGGCCGCCACCACCGGATCATCCCCGCATGCGCGGGGTTTACCCCCTGCCAGCCCCCGTCCATGTCGCGCCACCCGGATCATCCCCGCACACGCGGGGTTTACCTGACTACGGCAGTCAGCAGATCCAGCACCTTGGGATCATCCCCGCACACGCGGGGTTTACGTGACCGCGTGACTGGCGTCACGTGGCCACTGGGGATCATCCCCGCACACGCGGGGTTTACCTCGCCCCGGCCGGGCTGGCGTCGGGCGACCAGGGATCATCCCCGCACACGCGGGGTTTACGGTGGTTGAGGGAGGTGGGGGGTGGCCCCACGGGGATCATCCCCGCACACGCGGGGTTTACTTGTGACGACGGGATTCCGGGGTTTGTCGCCTGGGATCATCCCCGCACACGCGGGGTTTACTTGTGACGACGGGATTCCGGGGTTTGTCGCCTGGGATCATCCCCGCACACGCGGGGTTTACCTGTAGGCCCACGAGTCGTCCGTTGACCCCGCGGGATCATCCCCGCACACGCGGGGTTTACCGGTTGGTGGTCGAGGGAGGGGTGGCCCCACGGGGATCATCCCCGCACACGCGGGGTTTACGATCAAGAGCGCAGCCTCAGTCGTCGGCCGAACGGATCATCCCCGCACACGCGGGGTTTACGACCGCTTGCCCTTGGCCAGTTCCTGCCGGATCGGATCATCCCCGCACACGCGGGGTTTACAATTTCAACGTTTTATGGTCGGGGTGGCGGGATGGATCATCCCCGCACACGCGGGGTTTACCCCCAACCCAAGCGGTACCTGGGAGTGGCCGCCGGATCATCCCCGCACACGCGGGGTTTACAGGGGGATTTCGATTGTTGATGCGAGTAATCCAGGATCATCCCCGCACACGCGGGGTTTACTATGCGGGGGTGTCTTAGTGGCGGGAAGCCCTCGGATCATCCCCGCACACGCGGGGTTTACCACTCTAACATGTTGCCCTGGGGCATGTAGGACGGATCATCCCCGCACACGCGGGGTTTACAGCCATGCGGCCTCCCATGAGGCGGCACGGGGGGGATCATCCCCGCACACGCGGGGTTTACTTCGAGGGCGTGGTTGAGCATGGTGGCTCTGGCGGATCATCCCCGCACACGCGGGGTTTACCCATACTCACTAGAGTGTGTATAGTTATGGGTGGGATCATCCCCGCACACGCGGGGTTTACGCCGTCGGTGGCGTTTCCGACGGCCTTGGGCTGGGATCATCCCCGCACACGCGGGGTTTACGCGGCCCGGGCGACCCCGACCCGACGATCACCGGGATCATCCCCGCACACGCGGGGTTTACCGGTCGGTGGGCTCGTACATGTGGGAGACCCTGGGATCATCCCCGCACACGCGGGGTTTACGCCTCCAGCTCCCCCAGGGCCGCCCGCACGGCCGGATCATCCCCGCACACGCGGGGTTTACGACACCAGGTAGTCTGTCGCGTACCGCACCAGCGGATCATCCCCGCACACGCGGGGTTTACCGGCCACCGTGACCAGCGTCACGGCGACCTGACGGATCATCCCCGCACACGCGGGGTTTACCGGCCACCGTGACCAGCGTCACGGCGACCTGACGGATCATCCCCGCACACGCGGGGTTTACCTGAGCGAGCACTGTGACGCGTGGGGCCGCCGGGGATCATCCCCGCACACGCGGGGTTTACAAGCCCCCCCGGGAATACTTAAGTTTGGCTGGCGGATCATCCCCGCACACGCGGGGTTTACTGGGCGACGCCTGGTGCTGGGGCGTGATGTAAAGGATCATCCCCGCACACGCGGGGTTTACAGGCCACTGTGCCACTGCACGTGGGCCAGCTGAGGATCATCCCCGCACACGCGGGGTTTACGTGACCGCGTGACTGGCGTCACGTGGCCACTGAGGATCATCCCCGCACACGCGGGGTTTACACGCGCACGGACTCAGCCCGCATGCGCCGCATGGGATCATCCCCGCACACGCGGGGTTTACGGTTTACCTAAGTTTGGTGGGGGTGTGTTGGGGGGATCATCCCCGCACACGCGGGGTTTACGCCGTCGTGTGTGGCCCTGTGGGGGTTAGGTGGGGATCATCCCCGCACACGCGGGGTTTACCGCGAGGCCTCATCAGAGGTCATAAAAAACGGGGGATCATCCCCGCACACGCGGGGTTTACTCGTCGCCGGTCTCCCGGACGATCTTGAGGACGGGATCATCCCCGCACACGCGGGGTTTACAGGAGGTGGTCCAGGCGGAGGCGCTCGGTCGCCGGATCATCCCCGCACACGCGGGGTTTACCGCTCAGGGGCGCTGTGAGCGTCTCTGAGCGGCGGATCATCCCCGCACACGCGGGGTTTACTTGCCCGCAGCGTTCACCCCAGTTGACAGGGTAGGATCATCCCCGCACACGCGGGGTTTACCCACCGACGGACCTCAGGATTTCCGATCATACAGGATCATCCCCGCACACGCGGGGTTTACTCACTACTAGACGCCTCACTGCTACCGCCCACAGGATCATCCCCGCACACGCGGGGTTTACACTCGCACGCTCGGTAATGGGCACTTTCGCTTAGGATCATCCCCGCACACGCGGGGTTTACCACGAATCTTAAGGTTGTCGAATTGTGCTACCCGGATCATCCCCGCACACGCGGGGTTTACGTTAACAGCCAAAACTACTCCTTGTCGGGCACGGGATCATCCCCGCGCGTGCGGGGTTTACGGCGTCATCACCGACGCCGACGGCAAGGTTGTCGGATCATCCCCGCGCGTGCGGGGTTTACGTGAGCGGGGATGCCCTTTCGGGCTGGGGGCCGGGATCATCCCCGCGCGTGCGGGGTTTACGTCCGTCCATCCGTAGAAGCGCGTGGTTATCCAGGATCATCCCCGCGCGTGCGGGGTTTACGGTGATGATGACGTCCGGCGGCGGGAGAAGTCCGGATCATCCCCGCGCGTGCGGGGTTTACAAGGGTTATGGGTGGGTTAGGTTTACCTAAGTTGGATCATCCCCGCGCGTGCGGGGTTTACGCCATAGCGGTCTTCGTGACCGCGCCCCACGCGGGATCATCCCCGCGCGTGCGGGGTTTACGTTCATGAGTGCTTTGGCATCCGCTCGGCCGACGGATCATCCCCGCGCGTGCGGGGTTTACTCTGAGCGGCTTTCCGTCGTCATGTGTCCCCCTGGATCATCCCCGCGCGTGCGGGGTTTACAAGGGCTGGCGTTTCTCGCTTTCTAGGGCGTAGGGATCATCCCCGCGCGTGCGGGGTTTACGCCAGGGTCGCGGCCTGCTGGGCCTGGGCGTCCGGATCATCCCCGCGCGTGCGGGGTTTACGACAGAAGCCCTCTTCCAGAAGCGCCTACAGCGGGATCATCCCCGCGCGTGCGGGGTTTACCCGATACCGATTCTCTGGAGCCTCACAGCTGCCGGATCATCCCCGCGCGTGCGGGGTTTACCCGATACCGATTCTCTGGAGCCTCACAGCTGCCGGATCATCCCCGCGCGTGCGGGGTTTACGACTACGGTCAGCCCGCGCTCAGCGACGACGCCGGATCATCCCCGCGCGTGCGGGGTTTACCCGATACCGATTCTCTGGAGCCTCACAGCTGCCGGATCATCCCCGCGCGTGCGGGGTTTACGACTACGGTCAGCCCGCGCTCAGCGACGACGCCGGATCATCCCCGCGCGTGCGGGGTTTACGGCGACGCCCCCCAGGACCCGACGGTGGAGGCGGGATCATCCCCGCGCGTGCGGGGTTTACTAGGAGAATCCCGAAAAATCAACCTAAAACCGCGGATCATCCCCGCGCGTGCGGGGTTTACCGGTGCCCGCGCAAGCGCCGGTGGTGACGGCCCGGATCATCCCCGCGCGTGCGGGGTTTACTCCACGATCACCAGGGAGCGCTTGACGAGGGGGGGATCATCCCCGCGCGTGCGGGGTTTACTCGGTCCGCTTATTTTTGCTCGTGTGGATTGGAGGATCATCCCCGCGCGTGCGGGGTTTACGACGATGTGCTGCGGGCCACAGTGGTCAACAACGGATCATCCCCGCGCGTGCGGGGTTTACTGGGTGGATACGGGGCGTGGTAGGGAGGACCGGGGATCATCCCCGCGCGTGCGGGGTTTACCCTGTCATCTTGGTGATCTCGGGGATCATACGGGGATCATCCCCGCGCGTGCGGGGTTTACCGGGCACCGTGACCAGCGTCACGGCGACCCGACGGATCATCCCCGCGCGTGCGGGGTTTACCTGCGTGCGTGATCGGCGTCACACGTCCACAACGGATCATCCCCGCGCGTGCGGGGTTTACCGCTGGCGGGGCCGCTGGTGGCCTTTCCCGGGCGGATCATCCCCGCGCGTGCGGGGTTTACTTGCTACGATCATGTCCGGGAGGCTCGTCAGCGGGATCATCCCCGCGCGTGCGGGGTTTACGGAAATCGATCCGCGAGGTCGCCGAGGGAACAGGGATCATCCCCGCGCGTGCGGGGTTTACGCCTGGGCCTGAGGGTCCGGTAGAGGGTGATCGGGATCATCCCCGCGCGTGCGGGGTTTACCCCGGTCGAAGGGGAAGGCGCTGAGCGGCCCCCGGATCATCCCCGCGCGTGCGGGGTTTACTTCCTGCCGGATCTTGATGATGGTTAGAATGGCGGATCATCCCCGCGCGTGCGGGGTTTACACTGAGACCGAGATCACTGAGGCCAGCGAGGCGGGATCATCCCCGCGCGTGCGGGGTTTACACTGAGACCGAGATCACTGAGGCCAGCGAGGCGGGATCATCCCCGCGCGTGCGGGGTTTACCTGCGTGCGTGATCGGCGTCACGGCGACCCGACGGATCATCCCCGCGCGTGCGGGGTTTACCTCGCGGCCGGGAAGTGCTTGGGTTTGTACCACGGATCATCCCCGCGCGTGCGGGGTTTACCTGCTGGACCACGAGGGCCTGTCCGTCACCGCGGGATCATCCCCGCGCGTGCGGGGTTTACAAGACCGCCGTCCACGCCAGCACCACATTCACAGGATCATCCCCGCGCGTGCGGGGTTTACGGGATCCGGTGCCCGGCCGGGACCCCGGAGTAGGGATCATCCCCGCGCGTGCGGGGTTTACATCAAGTCCTCCACGAAGGACGCGGGGGGCAAGGGATCATCCCCGCGCGTGCGGGGTTTACCCGCCCACCTCCGAGCCGTCTGACGGCGGGGAAGGATCATCCCCGCGCGTGCGGGGTTTACGAGGCCGTTGCGAGGATGTTAGCCGCGGATGCCGGATCATCCCCGCGCGTGCGGGGTTTACAGTCGCCGTCGCTCATCTCCGGTCGGCATTCAAGGATCATCCCCGCGCGTGCGGGGTTTACCCGTTACCGACGCCACGAAGTCGGAAAACGCAGGGATCATCCCCGCGCGTGCGGGGTTTACCGCTACGTCGGATGTGGAAATGCCGTGGAATGGGGATCATCCCCGCGCGTGCGGGGTTTACCTCACAGGGATACGGGCGGCTTGACCCTGAGAAGGATCATCCCCGCGCGTGCGGGGTTTACCTTCTTAATATAGATATGATGGTGGTGGGCGAAGGATCATCCCCGCGCGTGCGGGGTTTACTAACCGTGACCTTAAGAGTGATAATGTAGACTAGGATCATCCCCGCGCGTGCGGGGTTTACGCCAGCTTCTCATGTCCTACCGGCAGACACTTCGGATCATCCCCGCGCGTGCGGGGTTTACCCCGTAGGAGTGCAATGATTCCTTTTTGGGGCGGGATCATCCCCGCGCGTGCGGGGTTTACGCCATGTCAGCGCCGTCAAGGCCCGGGATTCCCGGATCATCCCCGCGCGTGCGGGGTTTACTCTACGGCGGCGAGTGTAGCGATAATGCATGCCGGATCATCCCCGCGCGTGCGGGGTTTACCTGAGTATGAGAAGAATGATGGTTTCTGGCATGGGATCATCCCCGCGCGTGCGGGGTTTACGCGCGTTTTTCGGGGTGTGCTGTGGTGGGGGTGGGATCATCCCCGCGCGTGCGGGGTTTACCAGTCAGACACCTCCGACTACCTGTCAGCCCCAGGATCATCCCCGCGCGTGCGGGGTTTACCCAAAAGCATCCATCAACACGCCGGGCACGGACGGATCATCCCCGCGCGTGCGGGGTTTACAAGTTCGGTGGATTTCTAAGAGTGCTGACGGGAGGATCATCCCCGCGCGTGCGGGGTTTACGTCCCAGGAGGCGTCATCCTCACTGAGACAGTTGGATCATCCCCGCGCGTGCGGGGTTTACATAAAGCCGTCGGCGCGTGTCACGTACCCCGTCGGATCATCCCCGCGCGTGCGGGGTTTACTTTCGGGACTCATGATGTTGACGTGAGGTCTAGGGATCATCCCCGCGCGTGCGGGGTTTACCTCGGCGCGGGCTTTCATTGCGTGGATGAGGGCGGATCATCCCCGCGCGTGCGGGGTTTACTTGGCCTCGGCATCGGTCGTGGTGGTGTCGACGGGATCATCCCCGCGCGTGCGGGGTTTACGCGATGGCGTCGTCGAGGACCTCGTTAAAGAGGGGATCATCCCCGCGCGTGCGGGGTTTACTTCTCCCCCGCATCCCACCAGAAGCGGTCCCCGGGATCATCCCCGCGCGTGCGGGGTTTACGCTCGGGGGATTGGGACACTGTCGCCGGCCTCAGGATCATCCCCGCGCGTGCGGGGTTTACACGCCACGCACGCGAAACGCATTCGCACAGATAGGATCATCCCCGCGCGTGCGGGGTTTACTGAGGTGTGATGCCGGGCACTTCGGTGCCCGGCGGATCATCCCCGCGCGTGCGGGGTTTACAATCGTGGCGTTGAAGCCCATTCTTGGACTTTTGGATCATCCCCGCGCGTGCGGGGTTTACCTACCTGAACAACGAATGCTCGGTTTTCAACGAGGATCATCCCCGCGCGTGCGGGGTTTACGATATGGGACCAACCGAAAACACCACGGGCTGGGGATCATCCCCGCGCGTGCGGGGTTTACATTAATTCCGGCGCACGCAAGAGAATTGGTGAGGGATCATCCCCGCGCGTGCGGGGTTTACTGTAGTTACGGAGAAGCGCATCGAAGAGAATCGGGATCATCCCCGCGCGTGCGGGGTTTACGCCACGCGGCGGGGCATGACCCCCACCGGCGTGGGATCATCCCCGCGCGTGCGGGGTTTACTGTCGGCGGCTTTCGGTGGCGTCATGAGCGGTAGGATCATCCCCGCGCGTGCGGGGTTTACGGGGGTCACATCTTCGTGCCCACCATCACATCAGGATCATCCCCGCGCGTGCGGGGTTTACATCGAATCGGTATTCGATTTGTTGCTGCCGGTGGGATCATCCCCGCGCGTGCGGGGTTTACCGCTACAAAACAGAACTGAAACAGCGCACCACCGGATCATCCCCGCGCGTGCGGGGTTTACGTGGGGGTGAATGGAGTTGGCCGCCAGAAACGCGGATCATCCCCGCGCGTGCGGGGTTTACTCGGTGACGGTGACTGCTCCCATATAGGCGTCCGGATCATCCCCGCGCGTGCGGGGTTTACGGCGGATTTTGAGACGACGCCTAACCGGGATGAGGATCATCCCCGCGCGTGCGGGGTTTACCCGGCCCAGGAGGCAATCCGGCCGGCATCGGGAGGATCATCCCCGCGCGTGCGGGGTTTACGTGGCGCGGTCGCTGGCGTCCTCGGCAAGTGTCGGATCATCCCCGCGCGTGCGGGGTTTACCATGTGGTGCCCGCCACTCGGAGGAAGCTATGGGGATCATCCCCGCGCGTGCGGGGTTTACCGAAGCGTCTTCGGGACATGGTCTCCAAGCCTGGGATCATCCCCGCGCGTGCGGGGTTTACAAAATGGGCACGGGCAGGACGTTCCCCGAACGTGGATCATCCCCGCGCGTGCGGGGTTTACATCTCCGGGGGCATCCCGTCCCACGCGAAACGAGGATCATCCCCGCGCGTGCGGGGTTTACGTGTCACGGATTGCTCGGGTTTTGTGTGGTGGCGGATCATCCCCGCGCGTGCGGGGTTTACTCGGTGAGGGAGGAATTAGAGTTCTCGTTCAGGGGATCATCCCCGCGCGTGCGGGGTTTACCAGGTCCTGGCGGACGCCGACGGGGCCGCGCGGGGATCATCCCCGCGCGTGCGGGGTTTACCCGGGTGGTGGGGTCGGTGTCCATGGTGGTGTCGGATCATCCCCGCGCGTGCGGGGTTTACGTCGGGTCGGGGTGACGTGGGCCGTGGGTACGCGGATCATCCCCGCGCGTGCGGGGTTTACGACCACGGCTACTGCACCGTGGCCGAGGAGGAGGGATCATCCCCGCGCGTGCGGGGTTTACTCTGAAGAGCTTTTTTGCGTCTTGTGGATTGGAGGATCATCCCCGCGCGTGCGGGGTTTACCTAAGGAAGGCAATCACATTGATTGCCAGGTGAGGATCATCCCCGCGCGTGCGGGGTTTACACGCTCTTGCTGTCGGCGGCGCTTGTCGCGTAGGGATCATCCCCGCGCGTGCGGGGTTTACTTATGAGTGAGCCCATTACCGCCGTGGCGTCGCGGATCATCCCCGCGCGTGCGGGGTTTACGGGGTAGGCCGTCTGACCCCCAGTTCATTATTGGGATCATCCCCGCGCGTGCGGGGTTTACTTATGAGTGAGCCCATTACCGCCGTGGCGTCGCGGATCATCCCCGCGCGTGCGGGGTTTACTATTTTGGCTTACAGCGGTTCTTTGTAGCACGGGGATCATCCCCGCGCGTGCGGGGTTTACTTCGAAGCCTGGAATTCCTTCGCACTTCCACTCGGATCATCCCCGCGCGTGCGGGGTTTACAACCACCTGAGCCGGGAAAACCTGACACGGGGCGGATCATCCCCGCGCGTGCGGGGTTTACGCGGCCGACATTCCCGGCGCCAGTAGTGAGAATGGATCATCCCCGCGCGTGCGGGGTTTACGATGACCCCTCCTGGGACTCTCTCGGGCACCAGGGATCATCCCCGCGCGTGCGGGGTTTACAGAATCCTCTGGCCGAGTTTAAGCGCGGCCTCCGGATCATCCCCGCGCGTGCGGGGTTTACACCCAATCGATTTTGACCAGATGAAACACGCCAGGATCATCCCCGCGCGTGCGGGGTTTACGAGAACCTTTTCCGATGATAAATTCGTCAAACAGGATCATCCCCGCGCGTGCGGGGTTTACCGCTTTCTCTCGCCTATGAGAGTAGTAAGCGTCGGATCATCCCCGCGCGTGCGGGGTTTACGTGGCGAGACCTGTGAGAATATTGCCGGCTGCGGGATCATCCCCGCGCGTGCGGGGTTTACATTACGTAGACGTAGCCGGCCCGGATATTGGCGGGATCATCCCCGCGCGTGCGGGGTTTACTCCAGGTCGTCCCTCAGGTGGGTGCCGTGGGCGGGATCATCCCCGCGCGTGCGGGGTTTACTGGATAGACGCCGCCCCGACCCCGATCGGGAGCGGATCATCCCCGCGCGTGCGGGGTTTACCACGCCTCCCGCCGGGGCCATGGCGTGCAGGGCGGATCATCCCCGCGCGTGCGGGGTTTACCTGATGCCGCCGACGGTGGCCTGGTCGAGGAACGGATCATCCCCGCGCGTGCGGGGTTTACGCTATGGTCCACCCTCGGGCCGTGAGGGCGCCCGGATCATCCCCGCGCGTGCGGGGTTTACTCCAGCCCGGCGGTGGTGGTGCCGAAGAAGTCGGGATCATCCCCGCGCGTGCGGGGTTTACGACTGTACCCTGGGGGAAGCGACTTCTGCCTTGGGATCATCCCCGCGCGTGCGGGGTTTACGGCTTCTAGGCTTGGCATTGTGGGTGGCCCGTAGGATCATCCCCGCGCGTGCGGGGTTTACTTCTCATGTCCTACCGGCAGACACTGCTTAATAGGATCATCCCCGCGCGTGCGGGGTTTACCGTCCAAGGCTATTGCCGAAGTTTATGGCAGGGGGATCATCCCCGCGCGTGCGGGGTTTACACACCGCTATGTGCACCATCACACGCCCGTGGGGGATCATCCCCGCGCGTGCGGGGTTTACTCAGAATACCTCACCAGAATCCTCCCAATAAAGGGATCATCCCCGCGCGTGCGGGGTTTACACGGGCCTGTACGACGCGGAGGTCATGGCTCACGGATCATCCCCGCGCGTGCGGGGTTTACGGGGGCGTGGTCCCGGTGATGGACGTGCTTCAGGGATCATCCCCGCGCGTGCGGGGTTTACTTGGTCGCCAAACTGCACGTGCTGCCGGGGTTCGGATCATCCCCGCGCGTGCGGGGTTTACTCCTTGTGGTAGGTCGGTCGGGCTCTGGTGCCCGGATCATCCCCGCGCGTGCGGGGTTTACCGGGCGACGGTGCGGCCCATGAGCCGCACCTCCGGATCATCCCCGCGCGTGCGGGGTTTACGCGGCGATGGACGTTGACGCTCTTGCCGCGGCAGGATCATCCCCGCGCGTGCGGGGTTTACAGATCCGGAATATTAACATGCCAGAACCCGTCAGGATCATCCCCGCGCGTGCGGGGTTTACTGGCGTTTGACGGTAGTTTTATTGTCGACTATCGGATCATCCCCGCGCGTGCGGGGTTTACGGTGTAGATGACTCTCAATTTCTCATGCGGTAGGGATCATCCCCGCGCGTGCGGGGTTTACCAAGTCAGATAGTTCACCTTGGTGGCTTCCGCGGGATCATCCCCGCGCGTGCGGGGTTTACGCCCGGGCCTGAGGGTCCGGTAGAGGGTGATCGGGATCATCCCCGCGCGTGCGGGGTTTACCTCAGGGCGAAGCCGGCCATGCTCAAGTACTGCGGATCATCCCCGCGCGTGCGGGGTTTACTCCACGATCACCAGGGAGCGCTTGACGAGGGGGGGATCATCCCCGCGCGTGCGGGGTTTACCCACGGTTTCCCGTGGGGCCGCCTTGGCCTCACGGATCATCCCCGCGCGTGCGGGGTTTACGCGATGTCAGTGGCAGTTGTTAGGGTGGCTACGGGATCATCCCCGCGCGTGCGGGGTTTACTTTCCGACGGCCTTGGGCTGTTCATGATTGACGGGATCATCCCCGCGCGTGCGGGGTTTACGTGGCCGTTGCTAGGGTGCCTGTGACGACGGGAGGATCATCCCCGCGCGTGCGGGGTTTACGACAGAAATCTTGGAAAATCAACCCAAAACCACGGATCATCCCCGCGCGTGCGGGGTTTACTCGATGGTGGCGGGTGTCCAGCCGCGTGTCTGGGGATCATCCCCGCGCGTGCGGGGTTTACATAATCTCCTTCTCCATGTGGATAAGAATCATAGGATCATCCCCGCGCGTGCGGGGTTTACGAATCTGGGTTGGTGAGCCAGGACACTACTCCGGGATCATCCCCGCGCGTGCGGGGTTTACTCCCATGTAGGCGTCCTTGGTGACCCTGAGCCAGGATCATCCCCGCGCGTGCGGGGTTTACTTCGATAAGCGAATTAGCGGCCGCATTCAGGAG