Satellite database app by ALGGEN

Id Genbank id Name Type Indice Satlength Numrep Replength Seed Seq
142885 NZ_CP035443.1 Streptococcus-pyogenes-strain-emm58-chromosome Bacteria 999999-1000368 370 5 99 TGTGGACCTG TGTGGACCTGCAGGGCCTTGAGCTCCAGCTTCGCCATCTTTACCAGCAGGACCTTGCGGGCCGGCTTCGCCACGTTCACCTTTGGCACCTTGAAGGCCTTGTGGACCTGCAGGGCCTTGAGCTCCAGCTTCGCCATCTTTACCAGCAGGACCTTGCGGGCCGGCTTCGCCACGTTCACCTTTGGCACCTTGAAGGCCTTGTGGACCTGCAGGGCCTTGAGCTCCAGCTTCGCCATCTTTACCAGCAGGACCTTGCGGGCCGGCTTCGCCACGTTCACCTTTGGCACCTTGAAGGCCT
20665 NC_015846.1 Capnocytophaga-canimorsus-Cc5 Bacteria 999987-1000239 253 6 42 TATAATTTTC TATAATTTTCCGAGAAATGGATTTTTTACTTCTGAAAACGACTATAATTTTCGGATATGTCGTTTTTCACTTGTAAAAAACTGCTATAATTTTCCGAGAAATGACTTTTTCACTTTTGAAAACGACTATATTTTTCAGATATGTTGTTTTTCACTTGTAAAAAACTGCTATAATTTTCGAAGAAATGGCTTTTTCACTTCTGAAAATGATTATATTTTTCGGATATGACGTTTCTCACTTGTAAAAAAACCA
70154 NZ_CP014046.2 Vibrio-parahaemolyticus-strain-ATCC-17802-chromosome-1 Bacteria 999986-1000178 193 16 12 TCTCTATCTC TCTCTATCTCTATCTCTATCTCTATCTCTATCTCTATCTCTATCTCTATCTCTATCTCTATCTCTATCTCTATCTCTATCTCTATCTCTATCTCTATCTCTATCTCTATCTCTATCTCTATCTCTATCTCTATCTCTATCTCTATCTCTATCTCTATCTCTATCTCTATCTCTATCTCTATCTCTATCTCTA
87712 NZ_CP018382.1 Burkholderia-pseudomallei-strain-2008724758-chromosome-1 Bacteria 999974-1000044 71 5 14 CGGCAAGCGG CGGCAAGCGGCAAGCGGCAAGCGGCAAGCGGCAAGCGGCAAGCGGCAAGCGGCAAGCGGCAAGCGGCAAG
158695 NZ_CP043307.1 Acinetobacter-johnsonii-strain-Acsw19-chromosome Bacteria 99996-100744 749 8 84 TTTTTTATAA TTTTTTATAAATGGTTTGTAAACTTTCTTCCGTCCTAATGACGTAAGTTATTGTTTTATAGTGGTGCCAAAATACGAGCGAAACTTTTTTATAAATGGGTTGTAAACTTTCTTCCGTCCTAATGATGTAAGTTGTTGATTTATAGTGCTGGCAAATTTCGAGCGAAACTTTTTTATAAATGGGTTGTAAACTTTCTTCCGTCCTAATGATGTAAGTTGTTGATTTATAGTGCTGGCAAATTTCGAGCGAAAGTTTTTTATAAATGGGTTGTAAACTTTCTTCCGTCCTAATGATGTAAGTTGTTGATTTATATTGCTGGCAAATTTCGAGCGAAAGTTTTTTATAAATGGGTTGTAAACTTTCTTCCGTCCTAATGACGTAAGTTATTGATTTATAGTTGTGTCAAAATACGAGCGAAAG
16112 NC_012759.1 Escherichia-coli-BW2952 Bacteria 999926-1000650 725 4 181 CCCGGTGTGT CCCGGTGTGTGCAATATACGAAAAAAAAGCCCGTACTTTCGTACGAGCTCTTCTTTAAATATGGCGGTGAGGGGGGGATTGACTCGCTTCGCTCGCCCTGCGGGCAGCCCGCTCACTGCGTTCACGGTCTGTCCAACTGGCTGTCGCCAGTTGTCGACCCCCGGTCGGGGCTTCTCATCCCCCCGGTGTGTGCAATACACGAAAAAAAAGCCCGTACTTTCGTACGAGCTCTTCTTTAAATATGGCGGTGAGGGGGGGATTGACTCGCTTCGCTCGCCCTGCGGGCAGCCCGCTCACTGCGTTCACGGTCTGTCCAACTGGCTGTCGCCAGTTGTCGAACCCCGGTCGGGGCTTCTCATCCCCCCGGTGTGTGCAATATACGAAAAAAAAGCCCGTACTTTCGTACGAGCTCTTCTTTAAATATGGCGGTGAGGGGGGGATTGACTCGCTTCGCTCGCCCTGCGGGCAGCCCGCTCACTGCGTTCACGGTCTGTCCAACTGGCTGTCGCCAGTTGTCGAACCCCGGTCGGGGCTTCTCATCCCCCCGGTGTGTGCAATATACGAAAAAAAAGCCCGTACTTTCGTACGAGCTCTTCTTTAAATATGGCGGTGAGGGGGGGATTGACTCGCTTCGCTCGCCCTGCGGGCAGCCCGCTCACTGCGTTCACGGTCTGTCCAACTGGCTGTCGCCAGTTGTCGAACCCCGGTCGGGGCTTCTCATCCC
14648 NC_011047.1 Candidatus-Phytoplasma-mali-strain-AT Bacteria 99991-100087 97 4 21 TAAATTATTT TAAATTATTTATTTGAATTTGTAAATTATTTTTATTTTTTTCTAAATTATTTATTTGAATTTG
91970 NZ_CP019121.1 Vibrio-vulnificus-strain-FORC_054-chromosome-1 Bacteria 999907-1000606 700 4 175 ATGGTGGAGG ATGGTGGAGGGGGACGGATTCGAACCATCGAAGGCGGAGCCGGCAGATTTACAGTCTGCTCCCTTTGGCCACTCGGGAACCCCTCCAGGGTGTTTTTATACTTAGAACGTGTTTTCCCAACACACTATCCAAGTGTTTCTCACAATCAATCCAAAGGATAATCGCAAGAATAAATATGGTGGAGGGGGACGGATTCGAACCATCGAAGGCGGAGCCGGCAGATTTACAGTCTGCTCCCTTTGGCCACTCGGGAACCCCTCCAGGGTGTTTTTATACTTAGAACGTGTTTTCCCAACACACTATCCAAGTGTTTCTCACAATTAATCCAGAGGATAATCACAAGAAGAAATATGGTGGAGGGGGACGGATTCGAACCATCGAAGGCGGAGCCGGCAGATTTACAGTCTGCTCCCTTTGGCCACTCGGGAACCCCTCCAGGGTGTTTTTATACTTAGAACGTGTTTTCCCAACACACTATCCAAGTGTTTCTCACAATCAATCCAGAGGATAATCACAAGAAAAAAT
52555 NZ_CP010327.1 Myroides-sp Bacteria 999895-1000231 337 4 77 GTTTACAGTT GTTTACAGTTTACAGTTGCTCTCGACATCTATAAACAGAACGTTGACCTGTGTTCTTATTTTAGTTTACGGTGAACGGTTTACAGTTTACAGTTGCTTTCTACATCTATAAACAGACCGTTGACCTATGTTCTTATTTTGGTTTACGGTGAACGGTATACAGTTTACAGTTGCTCTCGACACCTATAAACAGACCGTTGACCTATGTTCTTATTTTGGTTTATGGTGAACT
98426 NZ_CP021120.1 Wolbachia-endosymbiont-of-Chrysomya-megacephala-isolate-wMeg-chromosome Bacteria 99988-100795 808 7 102 TAATAGAGCT TAATAGAGCTTTTACTATTTTTTCGTCACCTTTTTCAATAGCCAAATGTAAAGGAGTTTTTTCATAGTTATCTTGCAAATTAACCTTTATACCTTTTACTGCTAATAGAGCTTTTACTATTTTTTCGTCACCTTTTTCAATAGCCAAATGTAAAGGAGTTTTTTCATCGTTATCTTGCAAATTAACCTTTATACCTTTTACTGCTAATAGAGCTTTTACTATATTTTCGTTACCTTTTTCAATAGCCAAATGTAAAGAAGTTTCTTGAGATTGATTTTGCAAATTAACATCTATACCTTGTGCTGCTAATAGAGCTTTTACTATATTTTCGTTACCTTCTTTAATAGCCAAATGTAAAGGAGTTGCTTGAGATCGATTTTTCAAATTAACATCTATACCTTGTGCTGCTAATAGAGCGTTTACTATATTTTCGTTACCTTTTTCAATAGCCAAATGTAAAGGAGTTTCTTGAGATTGATTTTGCAAATTAACACCTATATCCTGTGCTTC
67888 NZ_CP013459.1 Burkholderia-stagnalis-strain-MSMB735WGS-chromosome-1 Bacteria 999834-999984 151 9 15 CGGCGGGCGA CGGCGGGCGATCCTGCGGTGGGCGATCCTTCGGCGGGCGATCCTGCGGCAGGCGATCCCGCGGCGGGCGATCCTGCGGTGGGCGATCCTGCGGCGGGCGATCCCGCGGCAGGCGATCCCG
151183 NZ_CP040244.1 Streptomyces-exfoliatus-strain-A1013Y-chromosome Bacteria 999834-999882 49 4 12 CCCCAGCCCC CCCCAGCCCCAGCCCCAGCCTCACCCCCAGCCCCAGCCCCAGCCTCAA
143763 NZ_CP036168.1 Salmonella-enterica-subsp Bacteria 999802-1000351 550 9 61 CCCGCGCCAG CCCGCGCCAGCGGGGATAAACCGGAACGAGTAATCTTTGTTTTCCCCGTACCTTCGTGTTCCCCGCGCCAGCGGGGATAAACCGTTCTTGAATATGATTGCGGGTATATGTGGATAGTGTTCCCCGCGCCAGCGGGGATAAACCGTCTGGTTATAACATCGCAGCAAAATCAAAAGAGTGTTCCCCGCGCCAGCGGGGATAAACCGGCACTATTTCGAATGTCTCGACGCCAGATTTAGTGTTCCCCGCGCCAGCGGGGATAAACCGAACGAATTGAGACTATTAGAGATTATTCGCCTGTGTTCCCCGCGCCAGCGGGGATAAACCGGCAACCCATTAATTAACTAAGCAGTAATAAACGTGTTCCCCGCGCCAGCGGGGATAAACCGTGACGAGGTGCGAGCGATGGTATCAAGGCCTAGTGTTTCCCGCGCCAGCGGGGATAAACCGGGTTAACCAGGGGTTTTTCCCCACTATTTCGCGTGTTCCCCGCGCCAGCGGGGATAAACCGAGGGGCGTTCCGCAGTCGACAAGGGCTGAAAAATGTTC
99599 NZ_CP021644.1 Glaesserella-parasuis-29755-chromosome Bacteria 999773-1000133 361 17 18 ACACCCGAGC ACACCCGAGCGATATCGTACACCCGAGCATCACCGCACACCCGAGCATCACCGAACACCCGAGCGATATCGTACACCCGAGCATCACCGCACACCCGAGCATCACCGAACACCCGAGCGTTACCGAACACCCAAGCCTTACCGTACACCCGAGCATTACCGTACACCCGAGCATTACCGAACACCCGAGCGTTACCGAACACCCGAGCATTACCGTACACCCCAGCGTTACCGTACACCCAAGCATTATCGT
92722 NZ_CP019413.1 Salmonella-enterica-subsp Bacteria 999761-999995 235 6 39 CCGCAGTATC CCGCAGTATCAGCAGCCGCAGCAGCCGGTAGCGCCGCAGCCGCAGTATCAGCAGCCGCAACAGCCGGTAGCGCCTCAGCCGCAGTATCAGCAGCCGCAACAGCCGGTAGCGCCGCAGCCGCAGTATCAGCAGCCGCAACAGCCGGTAGCGCCGCAGCCGCAGTATCAGCAGCCGCAACAGCCGGTAGCGCCGCAACCGCAGTATCAGCAGCCGCAGCAGCCGGTAGCGCCGCAA
77017 NZ_CP016321.1 Vibrio-vulnificus-strain-FORC_037-chromosome-I Bacteria 999754-999866 113 8 14 CTAGTCCCTA CTAGTCCCTAGTCCCTAGTCCCTAGTCCCTAGTCCCTAGTCCCTAGTCCCTAGTCCCTAGTCCCTAGTCCCTAGTCCCTAGTCCCTAGTCCCTAGTCCCTAGTCCCTAGTCC
168285 NZ_LS483492.1 Serratia-rubidaea-strain-NCTC10848-genome-assembly Bacteria 999752-1000382 631 6 105 AAGACGAAAG AAGACGAAAGAAAAAGATACCGCCGCGTTGCAGAGCGCGCTGGAGGAAAGCAAGAAAAACGGCGCAGAGCTGCAAAAGCAGCTGACGGCGCTGGCTGCTCAAGGCAAGACGAAAGAAAAAGATGCCGCCGCGTTGCAGAGCGCGCTGGAGGAAAGCAAGAAAAACGGCGCAGAGCTGCAGAAGCAGCTGACGGCGCTGGCCGCCCAGGGTAAGACGAAAGAGAAAGATGCCGCCGCCTTGCAGAAGGCGTTGGATGAAAGCAACAAGGGGCGGGGCGAGCTGCAAAAACAGCTGATGGCGTTGGCCGCTCAAGGCAAGACGAAAGAAAAAGATGCCGCCGCGTTGCAGAGCGCGCTGGAAGAAAGTAAGAAAAACGGCGTGGAGCTGCAGAAGCAACTGACGGCGCTGGCCGCCCAGGGCAAGACGAAAGAGAAAGATACCGCCGCGTTGCAGAGCGCGCTGGAAGAAAGTAAGAAAAACGGCGTGGAGCTGCAGAAACAGCTGACGGCGCTGGCTGCCCAGGGCAAGACGAAAGAGAAGGATGCCGCCGCGTTGCAGAGCGCGCTGGAGGAAAGCAAGAAAAACGGCGTGGAGCTGCAGAAACAGCTGACGGCGCTGGCTGCCCAGGGC
63049 NZ_CP012670.1 Sorangium-cellulosum-strain-So-ceGT47-chromosome Bacteria 9997491-9997596 106 5 21 GCCGCTCGCG GCCGCTCGCGGCGCCCCTGCAGCCGCTCGCGGCGCCCCCGCAGCCGCTCGCGGCGCCCCCGCAGCCGCTCGCGGCGCCCCCGCAGCCGCTCGCGGCGCCCCCGCA
15640 NC_012032.1 Chloroflexus-sp Bacteria 999708-999768 61 4 15 AAAGTAGGAG AAAGTAGGAGATAGGAAAGTAGGAGATAGGAAAGTAGGAGATAGGAAAGTAGGAGATAGG
129404 NZ_CP030097.1 Bacillus-amyloliquefaciens-strain-SH-B74-chromosome Bacteria 999708-1000842 1135 13 81 GCAAATTCAG GCAAATTCAGCCCGGAGACGATTTTGGCAGAACTCGATAAGTTCACAACGTCATTCATGGGAAAAGTGGACGAAATCGCGAGCAAATTCAGCCCGGAGACGATTTTAGCAGAGCTGGACAAATTCACGACCTCATTCATGGGAAAAGTAGACGAAATCGCGAGCAAATTCAGCCCGGAGACGATTTTAGCAGAGCTGGACAAGTTCACGAGCTCATTCACGGGAAAAGTAGACGAAATCGCAAGCAAATTCAGCCCGGCAACGATTTTAGCCGAACTGGACAAGTTCACGAGCTCATTCATGGGAAAAGTAGACGAAATCGCAAGCAAATTCAGCCCGGCAACGATTTTAGCAGAGTTGGATAAGTTCACAACGTCATTCATGGGAAAAGTGGACGAGATCGCAAGCAAATTCAGCCCGGCAACGATATTAGCCGAACTGGACAAGTTCACGAGCTCATTCATGGGAAAAGTAGACGAAATCGCGAGCAAATTCAGCCCGGCAACGATTTTAACCGAACTGGATAAGTTCACAACGTCATTCATGGGAAAAGTGGACGAGATCGCAAGCAAATTCAGCCCGGAGACGATTTTGGCAGAGCTGGATAAGTTCACAACGTCATTCATGGGAAAAGTGGACGAGATCGCAAGCAAATTCAGCCCGGCAACGATTTTGGCAGAGCTGGATAAGTTCACAACGTCATTCATGGGAAAAGTGGACGAGATCGCAAGCAAATTCAGCCCGGAGACGATTTTAGCAGAGCTGGACAAATTCGCTGATTCGTTTATGAAAAAAGTAGACGGGGTCGTGAGTAAATTCAGTCCGGAAGCCATATTGAAAGAACTGGATAAATTCACTGATTCATTTATGAAAAAGATAGATGACGTTGTCAGCAAATTCAGCCCGGAGACCATATTGAAAGAGCTGGATCATTTTACTGATTCGTTTATGAAGAAAGTCGACGACGTTGTCG
137315 NZ_CP033255.2 Salmonella-enterica-subsp Bacteria 999647-1001094 1448 24 61 TGTTCCCCGC TGTTCCCCGCGCCAGCGGGGATAAACCTCCCACCGCGCTGATTAACGACGGACTGTTACAGTGTTCCCCGCGCCAGCGGGGATAAACCGTGAGCAACGACAGTAAATAATTTTTCGTGCTGGTGTTCCCCGCGCCAGCGGGGATAAACCGAACCGCTGGCGGGCTGATTGGTCTGCAACCACGTGTTCCCCGCGCCAGCGGGGATAAACCGCAACCAGGCTGGATCGTAACTCCTATCCCCTCGTGTTCCCCGCGCCAGCGGGGATAAACCGAAAATGCAGGTGGGGTAACGAATGCGAGATTGGTGTTCCCCGCGCCAGCGGGGATAAACCGCCATTATTCAACCCTCCAGGCTCGCGCCGGCTGTGTTCCCCGCGCCAGCGGGGATAAACCGACGCCCCGAATGTGTTTGCCTCGCCCGCTGCCGTGTTCCCCGCGCCAGCGGGGATAAACCGTGGATTATCTGTATTTTACGGAAGTGGGCGCGGTGTTCCCCGCGCCAGCGGGGATAAACCGGTCGTTCATCAGGCACTACCGGCACTTTCTGGGTGTTCCCCGCGCCAGCGGGGATAAACCGATATTCGCCGCTTTCCATTTACCGAACGTAACGTGTTCCCCGCGCCAGCGGGGATAAACCGCCACGTTCGGCGATGTTGGCCCCATCGGTCCAGTGTTCCCCGCGCCAGCGGGGATAAACCGAATAAGGCGCGGTGCCACCCTCGGCTTTAATTGTGTTCCCCGCGCCAGCGGGGATAAACCGAGCCGTTTCCGCTAAATACCCCCGCAGTGATTGTGTTCCCCGCGCCAGCGGGGATAAACCGTTCTTGAATATGATTGCGGGTATATGTGGATAGTGTTCCCCGCGCCAGCGGGGATAAACCGTCTGGTTATAACATCGCAGCAAAATCAAAAGAGTGTTCCCCGCGCCAGCGGGGATAAACCGGCACTATTTCGAATGTCTCGACGCCAGATTTAGTGTTCCCCGCGCCAGCGGGGATAAACCGAACGAATTGAGACTATTAGAGATTATTCGCCTGTGTTCCCCGCGCCAGCGGGGATAAACCGGCAACCCATTAATTAACTAAGCAGTAATAAACGTGTTCCCCGCGCCAGCGGGGATAAACCGTGACGAGGTGCGAGCGATGGTATCAAGGCCTAGTGTTTCCCGCGCCAGCGGGGATAAACCGGGTTAACCAGGGGTTTTTCCCCACTATTTCGCGTGTTCCCCGCGCCAGCGGGGATAAACCGAGGGGCGTTCCGCAGTCGACAAGGGCTGAAAAA
160835 NZ_CP045096.1 Streptomyces-sp Bacteria 9996408-9996476 69 4 17 CGCCACCGAC CGCCACCGACCTCAGACCGCCACCGACCTCAGACCGCCACCGACCTCAGACCGCCACCGACCTCAGAC
94922 NZ_CP020055.1 Escherichia-coli-strain-AR_0069 Bacteria 999627-999932 306 5 61 CGGTTTATCC CGGTTTATCCCCGCTGGCGCGGGGAACACTGTACGCGGCGAGTTTTAGCGACAGGTCATCCCGGTTTATCCCCGCTGGCGCGGGGAACACTCACGGTAGCGCCACTGCGCGTCGGTGACGGGCGGTTTATCCCCGCTGGCGCGGGGAACACAACGAACAGGGATTTGTCGGCAGTTTCTTTACCGGTTTATCCCCGCTGGCGCGGGGAACACATAATTCGCAAATCAATATATATTTTGTCCGTCGGTTTATCCCCGCTGGCGCGGGGAACACAATTGCGGATGCTCCCGGAATTGCGCGGGCAA
108750 NZ_CP023704.1 Bacillus-thermoamylovorans-strain-SSBM-chromosome Bacteria 999621-1000918 1298 24 52 TTTCTCGTCG TTTCTCGTCGTCGTTTTTGGGCAGGAAACTCCTTTTTTTAGCGACGAGCCTCTTTCTCGTCGTCGTTTTTGGGCAGGAAACTCCTTTTTTTAGCGACGAGCCTCTTTCTCGTCGTCGTTTTTGCGCGGGAAACTCCTTTTTTTAGCGACGAGCCTCTTTCTCGTCGTCGTTTTTGCGCGGGAAACTCCTTTTTTTGGCGACGAGACCTTTTCTCGTCGTCATTTTGAGCCGAGAAACCCCTTTTTTTGGCGACGAGACCTTTTCTCGTCGTCATTTTGAGCCGAGAAACCCCTTTTTTTGGCGACGAGACCTTTTCTCGTCGTCATTTTTGACCGGAAAACTCCCTTTTTTGGCGACGAGACTCTTTCTCGTCGTCGTTTTGAGGCGGGAAACTCCTTTTTTTGGCGACGAGACCTTTTCTCGTCGTCATTTTTGACCGGAAAACTCCCTTTTTTGGCGACGAGACTCTTTCTCGTCGTCGTTTTGAGGCGGGAAACTCCTTTTTTTGGCGACGAGACCTTTTCTCGTCGTCGTTTTTGGGCAGGAAACTCCTTTTTTTAGCGACGAGACTCTTTCTCGTCGTCATTTTGAGCCGAGAAACTCCTTTTTTTGGCGACGAGACCATTTCTCGTCGTCGTTTTTGGGCCGGAAACTCCTTTTTTTAGCGACGAGACTCTTTCTCGTCGTCGTTTTTGGGCCGGAAACTCCTTTTTTTAGCGACGAGACCATTTCTCGTCGTCGTTTTTGGGCCGGAAACTCCTTTTTTTAGCGACGAGACCATTTCTCGTCGTCGTTTTTGGGCCAGAAACTCCTTTTTTTGGCGACGAGACCCTTTCTCGTCGTCGTTTTTGGGCCGGAAACTTCATTTTTTGGCGACGAAACCCTTTCTCGTCGTCGTTTTGAGGCGCGAAACTCCCTTTTTTGGCGACGAGACCATTTCTCGTCGTCGTTTTTGGGTAGGAAACTCCTATTTTTAGCGACGAGACTCTTTCTCGTCACCATTTTGAGGCGAAAATTGCTCGTTTTTAGCGACGAGACTC
75172 NZ_CP015817.1 Staphylococcus-aureus-strain-FORC_039 Bacteria 99962-100082 121 5 24 TCTTCTTTAC TCTTCTTTACCAGGTTTTTTGTTGTCTTCTTTACCAGGCTTGTTGCCGTCTTCTTTGCCAGGCTTGTTGTTGTCTTCTTTACCAGGCTTGTTGTTGTCTTCTTTGCCAGGTTTGTTGCCG