Satellite database app by ALGGEN

Id Genbank id Name Type Indice Satlength Numrep Replength Seed Seq
171295 NZ_LT999999.1 Chlamydia-suis-isolate-4-29b-genome-assembly Bacteria 397354-401173 3820 19 201 CCATACAAAA CCATACAAAACCTAGCTCCTCCAGCCTCGCTATCCTATCTTCCGATAGATCTCCTTTCTTAAAATCTTTTCTCTGGTTGCTTACCCATACTGACAACTGAGGACTTTTAGGATACTTATGAGGAACTTTACAGTGACCATGCTCTTCTCGGAAGCGTTGCAATTCCAGAAAATTCTCCTCCCACGCTTCTTTAAGAACATTCCATACAAAACCTAGCTCCTCCAGTCTCGCCACCCTATCTTCCGCTAGCTTACCTTCCTTAAAACGTATTCTTTGCACACATACCCAAACACCTAAGGATGGATTTTGAGGATACCTCGCAGGAACTTTACAGTGACCATACTCTTCTCGGAAGCGTTTCAATTCCAGAAAATTCTTCTCCCATTCTTCTTCAAGAACATCCCATACAAAACCTAGCTCCTCCAGCCTTGCTATCCTATCTTCTGATAGCTCGCTAGATTTAAAAGTTTTTCTTTGTACGCTTACCCAAGACCCAAGATCAGGATTTTGAGGATACCTCTGGGGAACTTTACAGTGACCATGCTCTTCTTGGAAGCGTTTCAACTCCAGAAAGTTCTTTTCCCACGATTCTTCAAGAACATCCCATACAAAACCTAGCTCATTCATCCTCTTTATCCCATCTTCCGATAGATCTCCTTTCTTAAAATTTTCTCTCTGGTGTCTTACCCATACTGACAACTGAGGACTTTTAGGATACTTATAAGGAACTTTACAGTGACCATGCTCTTCTCGGAAGCGTTTCAACTCCAGAAAGTTCTTTTCCCACGATTCTTCAAGAACATCCCATACAAAACCTAGCTCCTCCAGCCTCGCTATCCTATCTTCGGAAAGCTTATCTTCCTTAAAATCTTGTCTCTGGTGGCTTACCCAAGTCCCTAGGAAAGGATTTTGAGGATACCTTTGAGGAACTTTACAGTGACCATGCTCTTCTAGGAAGCGTTGCAATTCCAAAAAATTCTCCTCCCACACTTCTTTAAGAACATCCCATACAAAACCCAGCTCTTCCAACCTTACTATCTTATCTTCTGATAGCTCGCCTTTCTTAAAGGCATATCTTTGATTACTTACCCACGACGCAAGCTGAGGATTTTGAGGATAGTCCCCAGGAACTTTACAATGACCGTGTTCCTCTCGGAAGCGTTGCAATTCCAGAAAATTCTTCTCCCACACTTCTTTAAGAACATCCCATACAAAACCTAGCTCCTCCAGCCTTGCTATCTTATCTTCCGCTAGCTTACCTTCCTTAAAATCCGCTCTTTGATGCCTTACCCAAACTGCTAACTGAGGATTTTGAGGATAGCCCCCAGGAACTTTACAGTGACCATGCTCTTCTCGGAAGCGTTTCAACTCCAGAAAATTCTTCTCCCATGCTTCTTCAAGAACTCTCCATACAAAACCTAGCTCCTCCAGTCTCGCTATCTTATCTTCCGCTAGCTTACCTTCCTTAAAATCCGCTCTTTGATGACTTACCCAAACTGCTAACTGAGGATTTTGAGGATACTTATGAGGAACATTACAATGACCATGCTCTTCTTGGAAGCGTTTCAACTCCAGAAAATTCTCCTCCCATTCTTCTTCAAGAACTCTCCATACAAAACCTAGCTCTTCCAACCTTACTATCCTGTCTTCGGAAAGCTTACCTTTCTTAAAATCTTTTCTCTGGTGGCTTACCCATACTGACAACTGAGGACTTTTAGGATACTTATAAGGAACTTTACAGTGACCATGCTCTTCTCGGAAGCATTTCAACTCCAGAAAATTCTCCTCCCATTCTTCTTCAAGAACTCTCCATACAAAACCTATCTCCTCCAGCCTCGCTATCCTATCTTTTGCTAACTTACCTTTCCTAAAATATTGTCTCTGGTTGCTTACCCACGACGCAAGCTGAGGATTTTGAGGATATCCCTCAGGAACTTTACAATGCCTATGCTCTTCTTGGAAGCGTTTCAACTCCAGAAAATTCTCCTCCCATTCTTCTTCAAGAACATCCCATACAAAACCTATCTCCTCCAGCCTCGCTATCCTATCTTCCGCTAGCTTACCTTTCTTAAATCTTTCTCTTTGATCACCTACCCAAACACCTAAGGAAGGATTTTGAGGATACCTCTGGGGAACTTTACAGTGACCATGCTCTTCTCGGAAGCGTTTCAGCTCCAGAAAATTCTTCTTCCATTCTTCTTCAAGAACATCCCATACAAAACCTATCTCCTCCAGTCTCGCCACCCTATCTTCCGCTAGCTTACCTTTCTTAAATCTTTTTCTTTGCACACATACCCAAACACCTAAGAAAGGATTTTGAGGATAGACACTAGGAACATTACAATGACCGTGTTCCTCTCGGAAGCGTTGCAATTCCAGAAAATTCTCCTCCCACGCTTCTTCAAAAACTCTCCATACAAAACCTAGCTCCGCCAGCCTTGCTATCTTATCTTCCGCTAGCTTACCTTCCTTAAAATCCGCTCTTTGAGTACTTACCCACGACGCAAGCTGAGGATTTTGAGGATAGCTCGCAGGAACTTTACAGTGACCATGCTCTTCTCGGAAGCGTTGCAATTCCAGAAAATTCTTCTCCCATTCTTCTTCAAGAACATACCATACAAAACCTAGCTCCTCCAGCCTCACTATCCTATCTTCCGATAGATCTCCTTTCTTAAAATCCACTCTTTGATTACTTACCCAAGACCCAAGATCAGGATTTTGAGGATACCTCTCAGGCACTTTACAGTGACCATGCTCTTCTTGGAAGCGTTTCAACTCCAGAAAATTCTTCTCCCACACTTCTTCAAAAACATCCCATACAAAACCTAGCTCCTTCAGCCTCGCTATCTTATCTTCTGATAGCTTGCCTTTCTTAAAAACCACTCTTTGATTACTTACCCAAACACCTAAGGAAAGATTTTGAGGATAGCCCACAGGAACTTTACAGTGACCATGCTCTTCTCGGAAGCGTTTCAACTCCAGAAAATTCTTCTCCCACGCTTCTTCAGTAACATACCATACAAAACCTAGCTCCTCCAGCCTTGCTATCCTATCTTCCGCTAGCTTACCTTTCTTAAATCTTTCTCTTTGATCACATACCCAAACACCCAAGAAAGGATTTTGAGGATACCTATTCGGAACTTTACAATGACCATGCCCTTCTTGGAAGCGTTTCAACTCCAGAAAATTCTTCTCCCACGCTTCTTCAGTAACATCCCATACAAAACCTAGCTCCTCCAGCCTCGCTATCCTATCTTCTGATAGCTCGCCAGATTTAAAAGTTTTTCTTTGTACTTTTACCCAAACACCTAAGGAAGGATTTTGAGGATACCCCCAAGGAACTTTACAATGACCATGCTCTTCTCGGAAGCGTTTCAACTCCAGAAAATTCTTCTCCCACACTTCTTCAAAAACATCCCATACAAAACCTAGCTCCTCCAGCCTCGCTATCCTATCTTCTGATAGCTCGCCAGATTTAAAAGTTTTTCTTTGTGCTTTTACCCAAGACCCAAGATCAGGATTTTCAGGATACCACCTAGGAACATTACAATGACCATGCTCTTCTTGGAAGCGTTTCAACTCCAGAAAATTCTCCTCCCACGCTTCTTCAGTAACATCCCATACAAAACCTATCTCCTCCAGCCTCGCTATCCTATCTTCTGATAGCTTACATTTTTTAAAATGGCTTCTTTGATTACTTACCCAAACACCTAAGGAAGGATTTTGAGGATAGACACTAGGAACATTACAATGACCATGTTCTTCTCGAAAGCGTTGCAATTCCAGAAAATTCTCCTCCCACGCTTCTTCAAGAATATC
171294 NZ_LT999998.1 Chlamydia-suis-isolate-3-25b-genome-assembly Bacteria 772345-772510 166 5 33 AAGCAAAAAC AAGCAAAAACTAAAAAAGCGGTTTCTTCTAAGGAAGCAAAAACTAAAAAAGCGGTTTCTTCTAAGGAAGCAAAAACTAAAAAAGCGGTTTCTTCTAAGGAAGCAAAAACTAAAAAAGCGGTTTCTTCTAAGGAAGCAAAAACTAAAAAAGCGGTTTCTTCTAAGG
171293 NZ_LT999998.1 Chlamydia-suis-isolate-3-25b-genome-assembly Bacteria 396409-397414 1006 5 201 TCCAGAAAAT TCCAGAAAATTCTTCTCCCACGCTTCTTCAGTAACATCCCATACAAAACCCATCTCCTCCAGCCTCGCTATCTTATCTTCTGAAAGCTTACCTTTCTTAAAATCTTTTCTCTGGGAGCTTACCCAAGTCGCAAGCTGAGGATTTTGAGGATACCTAGTCGGAACTTTACAGTGACCATGCTCTTTTCGGAAGCGTTGCAATTCCAGAAAATTCTTTTCCCACGCTTCTTCAAAAACATCCCATACAAAACCTAGCTCCTCCAGCCTTGCTATCTTATCTTCTGAAAGCTTGCCTTTCTTAAAATCTTTTCTCTGGGTTTTCACCCAACCTGCTAACTGAGGATTTTGAGGATAGCCCTCAGGAACTTTACAGTGACCATGTTCTTCTTGGAAACGTTGCAATTCCAGAAAATTCTCCTCCCATCCTTCTTCAAAAATATCCCATACAAAACCTAGCTCCTCCAGCCTCGCTATCTTATCTTCTGAAAGCTTGCCTTTCTTAAAGGCACATCTTTGGGTACTTACCCACGACGCAAGCTGAGGACTTTTAGGATACCTTTGAGGAACTTTACAGTGACCATGCTCTTCTTGGAAACGTTTCAGCTCCAGAAAATTCTCTTCCCATTCTTCTTCAAAAACATTCCATACAAAACCTATCTCCTCCAACCTCTCTATCTTATCTTCTGAAAGCTTGCCTTTCTTAAAGGCATATCTTTGGGTACTTACCCATACTGCTAACTGAGGATTTTGAGGATACCTTTGAGGAACTCTACAATGCCCGTGTTCTTCTCGAAAGCGTTGCAATTCCAGAAAATTCTCCTCCCATTCTTCTTCAAAAACATTCCATACAAAACCTATCCCTTCCAGCCTCGCTATCCTATCTTCCGCTAGCTTACCGTCCTTAAAATCTGTTCTCTGCTTGCGTACCCAAGACCCAAGCTCAGGATTTTCAGGATGCCCCCTAGGAACATTACAGTGCCCGTGCTCTTCTTGGAAGCGTTGCAAT
171281 NZ_LT996891.1 Staphylococcus-aureus-isolate-24117-WT-genome-assembly Bacteria 233889-234308 420 5 64 TTATCAATTT TTATCAATTTATTGATTAGTGTTTCTTATGCATGAGCTTTAGCTCAGGCGTTCCTCTAATCTTCTTATCAATTTATTGATTAGTGTTTCTTATGCATGAGCTTTAGCTCAGGCGTTCCTCTAATCTTCTTATCAATTTATTGATTAGTGTTTCTTATACATGAGCTTTAGCTCAAGCGTTCCTCTAATCTTCTTATCAATTTATTGATTTCTGCGTCTTTATCTTGAGCTTTAGCTCAAGCGTTCCTCTAATCTTC
171288 NZ_LT996891.1 Staphylococcus-aureus-isolate-24117-WT-genome-assembly Bacteria 1496533-1497235 703 35 18 TCAGACAGCG TCAGACAGCGACTCAGGTTCAGATAGCGATTCGGATTCAGACAGCGATTCAGACTCAGACAGCGACTCAGGTTCAGATAGCGATTCGGATTCAGACAGCGACTCAGAATCAGACAGTGAGTCAGATTCAGATAGCGATTCAGAATCAGACAGTGACTCGGACTCAGATAGCGATTCAGACTCAGACAGCGATTCAGACTCAGACAGCGACTCAGATTCAGATAGCGACTCAGACTCAGACAGCGATTCAGAATCAGATAGCGATTCAGACTCAGACAGCGATTCAGACTCAGACAGCGACTCAGACTCAGACAGTGACTCAGACTCAGATAGCGACTCAGATTCAGATAGCGATTCAGACTCAGACAGCGATTCAGATTCAGACAGCGATTCAGACTCAGACAGCGACTCAGACTCAGACAGCGACTCAGAATCAGATAGCGATTCAGACTCAGACAGCGATTCAGATTCAGATAGCGACTCAGACTCAGACAGCGATTCAGATTCAGATAGCGACTCAGACTCAGACAGCGACTCAGAATCAGATAGCGATTCAGACTCAGACAGCGATTCAGAT
171292 NZ_LT996891.1 Staphylococcus-aureus-isolate-24117-WT-genome-assembly Bacteria 2353557-2353905 349 5 30 GAAGCACAAG GAAGCACAAGAGATTCAAGAAGCTAAAAGTGAGGCACAAGAGATTCAAGAAGCTAAAAAAGAGGCACAAGAGGTTCAAGAAGCTAAAAAA
171282 NZ_LT996891.1 Staphylococcus-aureus-isolate-24117-WT-genome-assembly Bacteria 391799-392240 442 7 63 CCTTACAACT CCTTACAACTTTTAGTTGTTAGGGGATTTTATGCATGTGCTCGGCACATGTATCCCTCTCCTTCCTTACAACTTTTAGTTGTTAGGGGATTTTATGCATGTGCTCGGTGCATGTATCCCTCTTTTACCTTACAACTTTTAGTTGTTAGGGGATTTTATGCATGTGCTCGGTGCATGTATCCCTCTTTTACCTTACAACTTTTAGTTGTTAGGGGATTTTATGCATGTGCTCGGCGCATGTATCCCTCTCCTTCCTTACAACTTTTAGTTGTTAGGGGATTTTATGCATGTGCTCGGCGCATGTATCCCTCTCCTTCCTTACAACTTTTAGTTGTTAGGGGATTTTATGCATGTGCTCGGTGCATGTATCCCTCTTTTACCTTACAACTTTTAGTTGTTAGGGGCTTTTTTGCTTGCGCTCGGCGCATGTATCCCTCTTCTT
171287 NZ_LT996891.1 Staphylococcus-aureus-isolate-24117-WT-genome-assembly Bacteria 1337545-1337761 217 7 24 GAAGACAACA GAAGACAACAACAAGCCTGGTAAAGAAGACAACAAAAAACCTGGTAAAGAAGACAACAAAAAACCTGGTAAAGAAGACAACAACAAGCCTGGTAAAGAAGACAACAAAAAACCTGGCAAA
171284 NZ_LT996891.1 Staphylococcus-aureus-isolate-24117-WT-genome-assembly Bacteria 598411-599203 793 37 18 CTGAATCTGA CTGAATCTGAGTCGCTGTCTGAATCTAAGTCACTGTCTGAATCTGAGTCACTGTCTGAATCTGATTCGCTATCTGAATCTGAATCGCTGTCTGAGTCTGAGTCACTATCTGATTCTGAATCGCTGTCTGAGTCTGAGTCATTATCGGAATCTGAATCGCTATCGGAATCTGAATCGCTATCGGAATCTGAGTCACTGTCTGAGTCTGAGTCGCTATCTGAATCTGAGTCACTGTCTGAGTCTGAGTCACTGTCGGAATCTGAATCGCTGTCTGAGTCTGAGTCACTGTCTGAGTCTGAATCGCTGTCTGAGTCTGAATCGCTGTCGGAATCTGAGTCACTATCTGAGTCTGAATCGCTCGCTGAGTCTGAATCACTCGCTGAATCTGAATCGCTCGCTGAATCTGAATCGCTCGCTGAATCTGAATCGCTTGCTGAATCTGAATCACTTGCTGAATCTGAATCACTTGCTGAGTCTGAATCACTTGCTGAGTCTGAATCACTTGCTGAATCTGAATCACTTGCTGAATCTGAATCACTCG
171285 NZ_LT996891.1 Staphylococcus-aureus-isolate-24117-WT-genome-assembly Bacteria 841845-842043 199 11 18 TCTGAGTCTG TCTGAGTCTGAGTCGCTATCTGAGTCTGAGTCGCTATCTGAATCTGAGTCGCTGTCTGAGTCTGAGTCACTATCTGAGTCTGAATCACTGTCTGAATCTGAATCGCTATCTGAGTCTGAATCACTATCTGAGTCTGAATCACTGTCTGAATCTGAGTCGCTATCTGAGTCTGAGTCACTATCTGAATCTGAATCGCTA
171286 NZ_LT996891.1 Staphylococcus-aureus-isolate-24117-WT-genome-assembly Bacteria 845466-846114 649 34 18 TCTGAATCTG TCTGAATCTGAGTCGCTATCTGAGTCTGAATCGCTGTCCGAATCTGAGTCACTATCTGAGTCTGAATCGCTGTCTGAATCTGAGTCGCTATCTGAGTCTGAGTCGCTATCTGAATCTGAATCACTGTCTGAGTCTGAGTCGCTGTCTGAATCTGAGTCACTATCTGAGTCTGAGTCGCTGTCTGAATCTGAATCACTGTCTGAGTCTGAGTCGCTGTCTGAATCTGAATCGCTATCTGAGTCTGAGTCACTATCTGAATCTGAGTCGCTGTCTGAATCTGAATCGCTATCTGAGTCTGAGTCACTATCTGAATCTGAATCGCTGTCTGAATCTGAGTCGCTATCTGAGTCTGAGTCACTATCTGAATCTGAGTCGCTGTCTGAGTCTGAGTCGCTATCTGAATCTGAGTCGCTGTCTGAGTCTGAGTCACTATCTGAGTCTGAATCACTGTCTGAATCTGAGTCGCTATCTGAGTCTGAGTCACTATCTGAATCTGAATCGCTATCTGAATCTGAATCGCTGTCTGAGTCTGAGTCGCTGTCTGAATCTGAATCGCTGTCTGAATCTGAATCGCTG
171283 NZ_LT996891.1 Staphylococcus-aureus-isolate-24117-WT-genome-assembly Bacteria 408505-408793 289 5 58 GGCCCCAACA GGCCCCAACAAAGAAGCTGACGAAAAGTCAGCTTACAATAATGTGCAAGTTGGGGAGGGGCCCCAACACAGAGAATTTCGAAAAGAAATTCTACAGGCAATGTGAGTTGGGGTGTGGGCCCCAACAAAGAAGCTGACGAAAAGTCAGCTTACAATAATGTGCAAGTTGGGGATGGGCCCCAACACAGAGAATTTCGAAAAGAAATTCTACAGGCAATGCAAGTTGGGGGATG
171290 NZ_LT996891.1 Staphylococcus-aureus-isolate-24117-WT-genome-assembly Bacteria 1817689-1818049 361 6 60 GCAACTGCAT GCAACTGCATAAGAGGCTCTAATAACTTAAGTTAAAGGCAAAAGGTATACAGTTGACTGCGCAACTGCATAAGAGGCTCTAATTACTTAAGTTAAAGGCAAAAGGTATACAGTTGACTGAGCAACTGCATAAGAGGCTCTAATTACTTAAGTTAAAGGCAAAAGGTATACAGTTGACTACGCAACTGCATAAGGGGCTCTAATAACTTAAGTTAAAGGCGAAAGGTATACAGTTGACTACGCAACTGCATAAGAGGCTCTAATTACTTAAGTTAAAGGCAAAAGGTATACAGTTGACTGAGCAACTGCATAAGAGTCTCTAATAACTTAAGTTAAAGGCGAAAGGTATACAGTTGACTAC
171291 NZ_LT996891.1 Staphylococcus-aureus-isolate-24117-WT-genome-assembly Bacteria 2231872-2232454 583 5 117 GCTGACTTTC GCTGACTTTCCGCCAGCTTTTGTGTTTGTGGCCCGTTTCCCCAACTTGCATCGTCTGTAGAAATTGAGGATCCAATTTTTCTATGTTGTGGCCCCGCCAACTTGCATGTTATTTTAAGCTGACTTTCCGCCAGCTTCTGAGTTTGTGGCCCGTTTCCCCAAATTGCACTGTTTGTAGAAATTAGAAATCCGATTTCACTATTTTGGGGCCTCGCCAACTTACATGTTATTTTAAGCTGACTTTCCGCCAGCTTCTGAGTTTGTGGCCCGTTTCCCCAAATTGCACTGTTTGTAGAAATTAGAAATCCGATTTCACTATTTTGGGGCCTCGCCAACTTACATGTTATTTTAA
171289 NZ_LT996891.1 Staphylococcus-aureus-isolate-24117-WT-genome-assembly Bacteria 1765910-1766151 242 4 60 GGTTGTTAGG GGTTGTTAGGGGCTTTTATGCATGCGCAAAGCGCAGGCGAACCGGAGCGCAGTGACCTCAGGTTGTTAGGGGCTTTTATGCATGCGCAAAGCGCAGGCGAACCGAAGCGCAGTGACCTCAGGTTGTTAGGGGCTTTTATGCATGCGCAAAGCGCAGGCGAACCGGAGCGCAGTGACCTCA
171280 NZ_LT996890.1 Staphylococcus-aureus-isolate-24117-SCV-genome-assembly Bacteria 2353555-2353903 349 5 30 GAAGCACAAG GAAGCACAAGAGATTCAAGAAGCTAAAAGTGAGGCACAAGAGATTCAAGAAGCTAAAAAAGAGGCACAAGAGGTTCAAGAAGCTAAAAAA
171272 NZ_LT996890.1 Staphylococcus-aureus-isolate-24117-SCV-genome-assembly Bacteria 598411-599203 793 37 18 CTGAATCTGA CTGAATCTGAGTCGCTGTCTGAATCTAAGTCACTGTCTGAATCTGAGTCACTGTCTGAATCTGATTCGCTATCTGAATCTGAATCGCTGTCTGAGTCTGAGTCACTATCTGATTCTGAATCGCTGTCTGAGTCTGAGTCATTATCGGAATCTGAATCGCTATCGGAATCTGAATCGCTATCGGAATCTGAGTCACTGTCTGAGTCTGAGTCGCTATCTGAATCTGAGTCACTGTCTGAGTCTGAGTCACTGTCGGAATCTGAATCGCTGTCTGAGTCTGAGTCACTGTCTGAGTCTGAATCGCTGTCTGAGTCTGAATCGCTGTCGGAATCTGAGTCACTATCTGAGTCTGAATCGCTCGCTGAGTCTGAATCACTCGCTGAATCTGAATCGCTCGCTGAATCTGAATCGCTCGCTGAATCTGAATCGCTTGCTGAATCTGAATCACTTGCTGAATCTGAATCACTTGCTGAGTCTGAATCACTTGCTGAGTCTGAATCACTTGCTGAATCTGAATCACTTGCTGAATCTGAATCACTCG
171273 NZ_LT996890.1 Staphylococcus-aureus-isolate-24117-SCV-genome-assembly Bacteria 841845-842043 199 11 18 TCTGAGTCTG TCTGAGTCTGAGTCGCTATCTGAGTCTGAGTCGCTATCTGAATCTGAGTCGCTGTCTGAGTCTGAGTCACTATCTGAGTCTGAATCACTGTCTGAATCTGAATCGCTATCTGAGTCTGAATCACTATCTGAGTCTGAATCACTGTCTGAATCTGAGTCGCTATCTGAGTCTGAGTCACTATCTGAATCTGAATCGCTA
171278 NZ_LT996890.1 Staphylococcus-aureus-isolate-24117-SCV-genome-assembly Bacteria 1817689-1818049 361 6 60 GCAACTGCAT GCAACTGCATAAGAGGCTCTAATAACTTAAGTTAAAGGCAAAAGGTATACAGTTGACTGCGCAACTGCATAAGAGGCTCTAATTACTTAAGTTAAAGGCAAAAGGTATACAGTTGACTGAGCAACTGCATAAGAGGCTCTAATTACTTAAGTTAAAGGCAAAAGGTATACAGTTGACTACGCAACTGCATAAGGGGCTCTAATAACTTAAGTTAAAGGCGAAAGGTATACAGTTGACTACGCAACTGCATAAGAGGCTCTAATTACTTAAGTTAAAGGCAAAAGGTATACAGTTGACTGAGCAACTGCATAAGAGTCTCTAATAACTTAAGTTAAAGGCGAAAGGTATACAGTTGACTAC
171274 NZ_LT996890.1 Staphylococcus-aureus-isolate-24117-SCV-genome-assembly Bacteria 845466-846114 649 34 18 TCTGAATCTG TCTGAATCTGAGTCGCTATCTGAGTCTGAATCGCTGTCCGAATCTGAGTCACTATCTGAGTCTGAATCGCTGTCTGAATCTGAGTCGCTATCTGAGTCTGAGTCGCTATCTGAATCTGAATCACTGTCTGAGTCTGAGTCGCTGTCTGAATCTGAGTCACTATCTGAGTCTGAGTCGCTGTCTGAATCTGAATCACTGTCTGAGTCTGAGTCGCTGTCTGAATCTGAATCGCTATCTGAGTCTGAGTCACTATCTGAATCTGAGTCGCTGTCTGAATCTGAATCGCTATCTGAGTCTGAGTCACTATCTGAATCTGAATCGCTGTCTGAATCTGAGTCGCTATCTGAGTCTGAGTCACTATCTGAATCTGAGTCGCTGTCTGAGTCTGAGTCGCTATCTGAATCTGAGTCGCTGTCTGAGTCTGAGTCACTATCTGAGTCTGAATCACTGTCTGAATCTGAGTCGCTATCTGAGTCTGAGTCACTATCTGAATCTGAATCGCTATCTGAATCTGAATCGCTGTCTGAGTCTGAGTCGCTGTCTGAATCTGAATCGCTGTCTGAATCTGAATCGCTG
171276 NZ_LT996890.1 Staphylococcus-aureus-isolate-24117-SCV-genome-assembly Bacteria 1496533-1497235 703 35 18 TCAGACAGCG TCAGACAGCGACTCAGGTTCAGATAGCGATTCGGATTCAGACAGCGATTCAGACTCAGACAGCGACTCAGGTTCAGATAGCGATTCGGATTCAGACAGCGACTCAGAATCAGACAGTGAGTCAGATTCAGATAGCGATTCAGAATCAGACAGTGACTCGGACTCAGATAGCGATTCAGACTCAGACAGCGATTCAGACTCAGACAGCGACTCAGATTCAGATAGCGACTCAGACTCAGACAGCGATTCAGAATCAGATAGCGATTCAGACTCAGACAGCGATTCAGACTCAGACAGCGACTCAGACTCAGACAGTGACTCAGACTCAGATAGCGACTCAGATTCAGATAGCGATTCAGACTCAGACAGCGATTCAGATTCAGACAGCGATTCAGACTCAGACAGCGACTCAGACTCAGACAGCGACTCAGAATCAGATAGCGATTCAGACTCAGACAGCGATTCAGATTCAGATAGCGACTCAGACTCAGACAGCGATTCAGATTCAGATAGCGACTCAGACTCAGACAGCGACTCAGAATCAGATAGCGATTCAGACTCAGACAGCGATTCAGAT
171269 NZ_LT996890.1 Staphylococcus-aureus-isolate-24117-SCV-genome-assembly Bacteria 233889-234308 420 5 64 TTATCAATTT TTATCAATTTATTGATTAGTGTTTCTTATGCATGAGCTTTAGCTCAGGCGTTCCTCTAATCTTCTTATCAATTTATTGATTAGTGTTTCTTATGCATGAGCTTTAGCTCAGGCGTTCCTCTAATCTTCTTATCAATTTATTGATTAGTGTTTCTTATACATGAGCTTTAGCTCAAGCGTTCCTCTAATCTTCTTATCAATTTATTGATTTCTGCGTCTTTATCTTGAGCTTTAGCTCAAGCGTTCCTCTAATCTTC
171277 NZ_LT996890.1 Staphylococcus-aureus-isolate-24117-SCV-genome-assembly Bacteria 1765910-1766151 242 4 60 GGTTGTTAGG GGTTGTTAGGGGCTTTTATGCATGCGCAAAGCGCAGGCGAACCGGAGCGCAGTGACCTCAGGTTGTTAGGGGCTTTTATGCATGCGCAAAGCGCAGGCGAACCGAAGCGCAGTGACCTCAGGTTGTTAGGGGCTTTTATGCATGCGCAAAGCGCAGGCGAACCGGAGCGCAGTGACCTCA
171271 NZ_LT996890.1 Staphylococcus-aureus-isolate-24117-SCV-genome-assembly Bacteria 408505-408793 289 5 58 GGCCCCAACA GGCCCCAACAAAGAAGCTGACGAAAAGTCAGCTTACAATAATGTGCAAGTTGGGGAGGGGCCCCAACACAGAGAATTTCGAAAAGAAATTCTACAGGCAATGTGAGTTGGGGTGTGGGCCCCAACAAAGAAGCTGACGAAAAGTCAGCTTACAATAATGTGCAAGTTGGGGATGGGCCCCAACACAGAGAATTTCGAAAAGAAATTCTACAGGCAATGCAAGTTGGGGGATG
171270 NZ_LT996890.1 Staphylococcus-aureus-isolate-24117-SCV-genome-assembly Bacteria 391799-392240 442 7 63 CCTTACAACT CCTTACAACTTTTAGTTGTTAGGGGATTTTATGCATGTGCTCGGCACATGTATCCCTCTCCTTCCTTACAACTTTTAGTTGTTAGGGGATTTTATGCATGTGCTCGGTGCATGTATCCCTCTTTTACCTTACAACTTTTAGTTGTTAGGGGATTTTATGCATGTGCTCGGTGCATGTATCCCTCTTTTACCTTACAACTTTTAGTTGTTAGGGGATTTTATGCATGTGCTCGGCGCATGTATCCCTCTCCTTCCTTACAACTTTTAGTTGTTAGGGGATTTTATGCATGTGCTCGGCGCATGTATCCCTCTCCTTCCTTACAACTTTTAGTTGTTAGGGGATTTTATGCATGTGCTCGGTGCATGTATCCCTCTTTTACCTTACAACTTTTAGTTGTTAGGGGCTTTTTTGCTTGCGCTCGGCGCATGTATCCCTCTTCTT