Satellite database app by ALGGEN

Id Genbank id Name Type Indice Satlength Numrep Replength Seed Seq
16386 NC_012973.1 Helicobacter-pylori-B38-complete-genome Bacteria 0-56 57 4 14 GATTAGTGAT GATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGCGATTAGTGATTAGT
19415 NC_014962.1 Isosphaera-pallida-ATCC-43644 Bacteria 0-65 66 4 14 GTGGGGAGTG GTGGGGAGTGAGGAGTGAGGAGTGGGGAGTGGGGAGTGAGGA
62300 NZ_CP012584.1 Pseudomonas-aeruginosa-strain-PA_D25 Bacteria 100003-100057 55 4 12 TGGCTGTGGC TGGCTGTGGCTGTGGCTGTGGCTGTGGCTGTGGCTG
62255 NZ_CP012579.1 Pseudomonas-aeruginosa-strain-PA_D5 Bacteria 100004-100058 55 4 12 TGGCTGTGGC TGGCTGTGGCTGTGGCTGTGGCTGTGGCTGTGGCTG
62282 NZ_CP012582.1 Pseudomonas-aeruginosa-strain-PA_D21 Bacteria 100004-100058 55 4 12 TGGCTGTGGC TGGCTGTGGCTGTGGCTGTGGCTGTGGCTGTGGCTG