Satellite database app by ALGGEN

Id Genbank id Name Type Indice Satlength Numrep Replength Seed Seq
28740 NC_021064.1 Cutibacterium-avidum-44067 Bacteria 0-366 367 6 61 CCGCGTAGGC CCGCGTAGGCGGGGAAGACTCGAACAGCTTGTTTTGGCTAAGCCCGACCATCGGCTCACCCCCGCGTAGGCGGGGAAGACACCGATTCGATGTGGGAGAATCCTCTAGCCGAAGGCTCACCCCCGCGTAGGCGGGGAAGACTTACGAATGGCTAGAGAATAATTTTCGTTAGCCGGCTCACCCCCGCGTAGGCGGGGAAGACATATGGGGAATAGGGGTCCCCGTGCTATGATAAGGCTCACCCCCGCGTAGGCGGGGAAGACCTTCGGGTGCGATTCCATCCGTGGCTTCCACTCGGCTCACCC
162579 NZ_HG813249.1 Listeria-monocytogenes-6179 Bacteria 0-395 396 6 66 ATAACATAGC ATAACATAGCTCTAAAACATGAAAGAGCATTCAGACTTTGGAAAAACGGTTTTGGTAGCATTCAAAATAACATAGCTCTAAAACCAAGCTAATGCGGTTATCTTTCGTAAGGTTGTTTTGGTAGCATTCAAAATAACATAGCTCTAAAACGTATACAGGTTAGGAAGTAAACTCCTTGTAGTTTTGGTAGCATTCAAAATAACATAGCTCTAAAACCTTAAAGTTGTCAACTTCTATTTTTTATATGTTTTGGTAGCATTCAAAATAACATAGCTCTAAAACAAAAAACGTATCAAAAGGCACTGTCGCGATGTTTTGGTAGCATTCAAAATAACATAGCTCTAAAACTCATTGTTTATCTTCTCCCAAATAAAATCAGTTTTGGTAGCATTCAAA
72377 NZ_CP014873.1 Lactobacillus-backii-strain-TMW-1 Bacteria 0-407 408 8 51 AGCAGCTACT AGCAGCTACTGTAGCAAGCAGTGCCAGTGATACGAAGAGTGCTGCTCAATCAGCAGCTACTGTAGCAAGCAGTGCCAGTGATACGAAGAGTGCTACTCAATCAGCAGCTACTGCAGCAAGCAGTGCCAGTGATACGAAGAGGGCTGCTCAATCAGCAGCTACTGCAGTAAGCAGTGCCAGTGATACGAAGAGTGCTGCTCAATCAGCAGCTACTGCAGTAAGCAGTGCCAGTGATACGAAGAGTGCTGCTCAATCAGCAGCTACTGCAGCAAGCAGTGCCAGTGATACGAAGAGGGCTGCTCAATCAGCAGCTACTGCAGTAAGCAGTGCCAGTGATACGAAGAGTGCTGCTCAATCAGCAGCTACTGCAGTAAGCAGTGCCAGTGATACGAAGAGTGCTGCTCAATC
155039 NZ_CP041781.1 Xanthomonas-citri-pv Bacteria 0-503 504 5 102 CGGCTGTTGC CGGCTGTTGCCGGTGCTGTGCCAGGCCCATGGCCTGACCCCGCAGCAGGTGGTGGCCATCGCCAGCCACGATGGCGGCAAGCAGGCGCTGGAGACGGTGCAGCGGCTGTTGCCGGTGCTGTGCCAGGCCCATGGCCTGACCCCGGAGCAGGTGGTGGCCATCGCCAGCAATATTGGTGGCAAGCAGGCGCTGGAGACGGTGCAGCGGCTGTTGCCGGTGCTGTGCCAGGCCCATGGCCTGACCCCGCAGCAGGTGGTGGCCATCGCCAGCCACGATGGCGGCAAGCAGGCGCTGGAGACGGTGCAGCGGCTGTTGCCGGTGCTGTGCCAGGCCCATGGCCTGACCCCGCAGCAGGTGGTGGCCATCGCCAGCAATGGCGGCGGCAGGCCGGCGCTGGAGACGGTGCAG
81376 NZ_CP017156.1 Macrococcus-sp Bacteria 0-510 511 10 51 CAAACAAATG CAAACAAATGCCCACATGGAAACAGAAGTGTGCACGAACAGGAAAAAACTACAAACAAATGCCCACATGGAATCAGAAGTGTGCACGAAAAGGAAAAAATTTCAAACAAATGCCCACATGGAAACAGAAGTGTGCAAGAACAGGAAAAAATTTCAAACAAATGCCCACATGGAAACAGAAGTGTGCAAGAACAGGAAAAAACTACAAACAAATGCCCACAACGAACTAGATGTGTGCACGAACAGGAAGAAACTTCAAACAAATGCCCACAACGAACTAGATGTGTGCATGAACAGGAAAAAACTTCAAACAAGTGCCCACATGGAATCAGAAGTGTGCACGAAAAGGAAAAAATTTCAAACAAATGCCCACAACGAACTAGAAGTGTGCACGAACAGGAAGAAATTTCAAACAAATGCCCACATGGAAACAGAAGTGTGCACGAACAGGAAGAAACTTCAAACAAATGCCCACATGGAATCAGAAGTGTGCACGAACAGGAAGAAACTT
16386 NC_012973.1 Helicobacter-pylori-B38-complete-genome Bacteria 0-56 57 4 14 GATTAGTGAT GATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGCGATTAGTGATTAGT
19415 NC_014962.1 Isosphaera-pallida-ATCC-43644 Bacteria 0-65 66 4 14 GTGGGGAGTG GTGGGGAGTGAGGAGTGAGGAGTGGGGAGTGGGGAGTGAGGA
91738 NZ_CP019047.1 Klebsiella-pneumoniae-subsp Bacteria 0-667 668 8 67 GAACAAGGGG GAACAAGGGGGTTGTTTTGTCCTGCCGGGGTATCAGAAAGCCGCTGGGCCACCCGAAGCAGCATTGCGAACAAGGGGGTTGTTTTGTCCTGCCGGGGTATCAGAAAGCCGCTGGGCCACCCGGAGCCGGACTGCGAACAAGGGGGTTGTTTTAATGTGACTGGCTATCAGGAAGCTGCTGGGGCTCCCGGAGCAGGACTGCGAACAAGGGGGTTGTTTTGTCCTGCCGGGGTATCAGAAAGCCGCTGGGCCTCCCGAAGCAGAACTGCGAACAAGGGGGTTGTTTTGTCCTGCCGGGGCATCAGAAAGCCGCAGGGTCTCCCGAAGCAGAACTGCGAACAAGGGGGTTGTTTTGTCCTGCCGGGGTATCAGAAAGCCGCTGGGCCACCCGGAGCAGAACTGC
94020 NZ_CP019770.1 Pseudoalteromonas-sp Bacteria 0-76 77 5 14 CGGGGTTCGG CGGGGTTCGGGGTTCGGGGTTCGGGGTTCGGGGTTCGGGGTTCGGGGTTCGGGGTT
87483 NZ_CP018380.1 Burkholderia-pseudomallei-strain-2008724734-chromosome-1 Bacteria 0-83 84 6 14 GGCGTTCGGC GGCGTTCGGCGTTCGGCGTTCGGCGTTCGGCGTTCGGCGTTCGGCGTTCGGCGTTCGGCGTTCGGCGTTCGGCGTTCGGCGTTC
22848 NC_017259.1 Buchnera-aphidicola-str Bacteria 0-83 84 4 21 AGATTTTGGA AGATTTTGGAAAGTTATCCACAGATTTTGGAAAGTTATCCACAGATTTTGGAAAGTTATCCACAGATTTTGGAAAGTTATCCAC
65562 NZ_CP013149.1 Lactobacillus-plantarum-strain-MF1298 Bacteria 0-87 88 4 22 TTTATCGACT TTTATCGACTACATTTTGTCTGTTTATCGACTACATTTTGTCTGTTTATCGACTACATTTTGTCTGTTTATCGACTACATTTTGTCTG
18229 NC_014256.1 Helicobacter-pylori-B8 Bacteria 0-87 88 4 22 AAGAACTACC AAGAACTACCCTTATCGTTGGCAAGAACTACCCTTATCGTTGGCAAGAACTACCCTTATCGTTGGCAAGAACTACCCTTATCGTTGGC
90651 NZ_CP018789.1 Campylobacter-sp Bacteria 0-87 88 4 22 TTTGGGGACT TTTGGGGACTATTAAAAACCCTTTTGGGGACTATTAAAAACCCTTTTGGGGACTATTAAAAACCCTTTTGGGGACTATTAAAAACCCT
155543 NZ_CP042211.1 Helicobacter-pylori-strain-B128-7 Bacteria 0-87 88 4 22 AAGAACTACC AAGAACTACCCTTATCGTTGGCAAGAACTACCCTTATCGTTGGCAAGAACTACCCTTATCGTTGGCAAGAACTACCCTTATCGTTGGC
61380 NZ_CP012376.1 Escherichia-coli-strain-GE3 Bacteria 0-9498 9499 32 297 CTCGGCCGGG CTCGGCCGGGGTCTTCGCTGCCACGACCGCATCATGCTTGGCCGTCAGATCATCATGTTTCGGCTGGTCGATCACATCGCCTGCTGCCTTCAGTGCATCTTCTGCAACCTTCTCGGCTTCCTCTGCTTTTGCAACCAGATCTTCCGCCGCGTCCAGCGCTTCCTGTGCATCCTGGCTATCCGGCTTGCCGTTGCCGTCTGCATCGTTCACCGCCGGTACCTGGATACCATCCACCGCATCCAGACGACCTTTCAGGGCTTCTTTCTCCGGTCCTTCCGGCAGGTTGTTCACCGCAGCCTCGGCCGGGGTCTTCGCTGCCACGACCGCATCATGCTTGGCCGTCAGATCATCATGTTTCGGCTGGTCGATCACATCGCCTGCTGCCTTCAGTGCATCTTCTGCAACCTTCTCGGCTTCCTCTGCTTTTGCAACCAGATCTTCCGCCGCGTCCAGCGCTTCCTGTGCATCCTGGCTATCCGGCTTGCCGTTGCCGTCTGCATCGTTCACCGCCGGTACCTGGATACCATCCACCGCATCCAGACGACCTTTCAGGGCTTCTTTCTCCGGTCCTTCCGGCAGGTTGTTCACCGCAGCCTCGGCCGGGGTCTTCGCTGCCACGACCGCATCATGCTTGGCCGTCAGATCATCATGTTTCGGCTGGTCGATCACATCGCCTGCTGCCTTCAGTGCATCTTCTGCAACCTTCTCGGCTTCCTCTGCTTTTGCAACCAGATCTTCCGCCGCGTCCAGCGCTTCCTGTGCATCCTGGCTATCCGGCTTGCCGTTGCCGTCTGCATCGTTCACCGCCGGTACCTGGATACCATCCACCGCATCCAGACGACCTTTCAGGGCTTCTTTCTCCGGTCCTTCCGGCAGGTTGTTCACCGCAGCCTCGGCCGGGGTCTTCGCTGCCACGACCGCATCATGCTTGGCCGTCAGATCATCATGTTTCGGCTGGTCGATCACATCGCCTGCTGCCTTCAGTGCATCTTCTGCAACCTTCTCGGCTTCCTCTGCTTTTGCAACCAGATCTTCCGCCGCGTCCAGCGCTTCCTGTGCATCCTGGCTATCCGGCTTGCCGTTGCCGTCTGCATCGTTCACCGCCGGTACCTGGATACCATCCACCGCATCCAGACGACCTTTCAGGGCTTCTTTCTCCGGTCCTTCCGGCAGGTTGTTCACCGCAGCCTCGGCCGGGGTCTTCGCTGCCACGACCGCATCATGCTTGGCCGTCAGATCATCATGTTTCGGCTGGTCGATCACATCGCCTGCTGCCTTCAGTGCATCTTCTGCAACCTTCTCGGCTTCCTCTGCTTTTGCAACCAGATCTTCCGCCGCGTCCAGCGCTTCCTGTGCATCCTGGCTATCCGGCTTGCCGTTGCCGTCTGCATCGTTCACCGCCGGTACCTGGATACCATCCACCGCATCCAGACGACCTTTCAGGGCTTCTTTCTCCGGTCCTTCCGGCAGGTTGTTCACCGCAGCCTCGGCCGGGGTCTTCGCTGCCACGACCGCATCATGCTTGGCCGTCAGATCATCATGTTTCGGCTGGTCGATCACATCGCCTGCTGCCTTCAGTGCATCTTCTGCAACCTTCTCGGCTTCCTCTGCTTTTGCAACCAGATCTTCCGCCGCGTCCAGCGCTTCCTGTGCATCCTGGCTATCCGGCTTGCCGTTGCCGTCTGCATCGTTCACCGCCGGTACCTGGATACCATCCACCGCATCCAGACGACCTTTCAGGGCTTCTTTCTCCGGTCCTTCCGGCAGGTTGTTCACCGCAGCCTCGGCCGGGGTCTTCGCTGCCACGACCGCATCATGCTTGGCCGTCAGATCATCATGTTTCGGCTGGTCGATCACATCGCCTGCTGCCTTCAGTGCATCTTCTGCAACCTTCTCGGCTTCCTCTGCTTTTGCAACCAGATCTTCCGCCGCGTCCAGCGCTTCCTGTGCATCCTGGCTATCCGGCTTGCCGTTGCCGTCTGCATCGTTCACCGCCGGTACCTGGATACCATCCACCGCATCCAGACGACCTTTCAGGGCTTCTTTCTCCGGTCCTTCCGGCAGGTTGTTCACCGCAGCCTCGGCCGGGGTCTTCGCTGCCACGACCGCATCATGCTTGGCCGTCAGATCATCATGTTTCGGCTGGTCGATCACATCGCCTGCTGCCTTCAGTGCATCTTCTGCAACCTTCTCGGCTTCCTCTGCTTTTGCAACCAGATCTTCCGCCGCGTCCAGCGCTTCCTGTGCATCCTGGCTATCCGGCTTGCCGTTGCCGTCTGCATCGTTCACCGCCGGTACCTGGATACCATCCACCGCATCCAGACGACCTTTCAGGGCTTCTTTCTCCGGTCCTTCCGGCAGGTTGTTCACCGCAGCCTCGGCCGGGGTCTTCGCTGCCACGACCGCATCATGCTTGGCCGTCAGATCATCATGTTTCGGCTGGTCGATCACATCGCCTGCTGCCTTCAGTGCATCTTCTGCAACCTTCTCGGCTTCCTCTGCTTTTGCAACCAGATCTTCCGCCGCGTCCAGCGCTTCCTGTGCATCCTGGCTATCCGGCTTGCCGTTGCCGTCTGCATCGTTCACCGCCGGTACCTGGATACCATCCACCGCATCCAGACGACCTTTCAGGGCTTCTTTCTCCGGTCCTTCCGGCAGGTTGTTCACCGCAGCCTCGGCCGGGGTCTTCGCTGCCACGACCGCATCATGCTTGGCCGTCAGATCATCATGTTTCGGCTGGTCGATCACATCGCCTGCTGCCTTCAGTGCATCTTCTGCAACCTTCTCGGCTTCCTCTGCTTTTGCAACCAGATCTTCCGCCGCGTCCAGCGCTTCCTGTGCATCCTGGCTATCCGGCTTGCCGTTGCCGTCTGCATCGTTCACCGCCGGTACCTGGATACCATCCACCGCATCCAGACGACCTTTCAGGGCTTCTTTCTCCGGTCCTTCCGGCAGGTTGTTCACCGCAGCCTCGGCCGGGGTCTTCGCTGCCACGACCGCATCATGCTTGGCCGTCAGATCATCATGTTTCGGCTGGTCGATCACATCGCCTGCTGCCTTCAGTGCATCTTCTGCAACCTTCTCGGCTTCCTCTGCTTTTGCAACCAGATCTTCCGCCGCGTCCAGCGCTTCCTGTGCATCCTGGCTATCCGGCTTGCCGTTGCCGTCTGCATCGTTCACCGCCGGTACCTGGATACCATCCACCGCATCCAGACGACCTTTCAGGGCTTCTTTCTCCGGTCCTTCCGGCAGGTTGTTCACCGCAGCCTCGGCCGGGGTCTTCGCTGCCACGACCGCATCATGCTTGGCCGTCAGATCATCATGTTTCGGCTGGTCGATCACATCGCCTGCTGCCTTCAGTGCATCTTCTGCAACCTTCTCGGCTTCCTCTGCTTTTGCAACCAGATCTTCCGCCGCGTCCAGCGCTTCCTGTGCATCCTGGCTATCCGGCTTGCCGTTGCCGTCTGCATCGTTCACCGCCGGTACCTGGATACCATCCACCGCATCCAGACGACCTTTCAGGGCTTCTTTCTCCGGTCCTTCCGGCAGGTTGTTCACCGCAGCCTCGGCCGGGGTCTTCGCTGCCACGACCGCATCATGCTTGGCCGTCAGATCATCATGTTTCGGCTGGTCGATCACATCGCCTGCTGCCTTCAGTGCATCTTCTGCAACCTTCTCGGCTTCCTCTGCTTTTGCAACCAGATCTTCCGCCGCGTCCAGCGCTTCCTGTGCATCCTGGCTATCCGGCTTGCCGTTGCCGTCTGCATCGTTCACCGCCGGTACCTGGATACCATCCACCGCATCCAGACGACCTTTCAGGGCTTCTTTCTCCGGTCCTTCCGGCAGGTTGTTCACCGCAGCCTCGGCCGGGGTCTTCGCTGCCACGACCGCATCATGCTTGGCCGTCAGATCATCATGTTTCGGCTGGTCGATCACATCGCCTGCTGCCTTCAGTGCATCTTCTGCAACCTTCTCGGCTTCCTCTGCTTTTGCAACCAGATCTTCCGCCGCGTCCAGCGCTTCCTGTGCATCCTGGCTATCCGGCTTGCCGTTGCCGTCTGCATCGTTCACCGCCGGTACCTGGATACCATCCACCGCATCCAGACGACCTTTCAGGGCTTCTTTCTCCGGTCCTTCCGGCAGGTTGTTCACCGCAGCCTCGGCCGGGGTCTTCGCTGCCACGACCGCATCATGCTTGGCCGTCAGATCATCATGTTTCGGCTGGTCGATCACATCGCCTGCTGCCTTCAGTGCATCTTCTGCAACCTTCTCGGCTTCCTCTGCTTTTGCAACCAGATCTTCCGCCGCGTCCAGCGCTTCCTGTGCATCCTGGCTATCCGGCTTGCCGTTGCCGTCTGCATCGTTCACCGCCGGTACCTGGATACCATCCACCGCATCCAGACGACCTTTCAGGGCTTCTTTCTCCGGTCCTTCCGGCAGGTTGTTCACCGCAGCCTCGGCCGGGGTCTTCGCTGCCACGACCGCATCATGCTTGGCCGTCAGATCATCATGTTTCGGCTGGTCGATCACATCGCCTGCTGCCTTCAGTGCATCTTCTGCAACCTTCTCGGCTTCCTCTGCTTTTGCAACCAGATCTTCCGCCGCGTCCAGCGCTTCCTGTGCATCCTGGCTATCCGGCTTGCCGTTGCCGTCTGCATCGTTCACCGCCGGTACCTGGATACCATCCACCGCATCCAGACGACCTTTCAGGGCTTCTTTCTCCGGTCCTTCCGGCAGGTTGTTCACCGCAGCCTCGGCCGGGGTCTTCGCTGCCACGACCGCATCATGCTTGGCCGTCAGATCATCATGTTTCGGCTGGTCGATCACATCGCCTGCTGCCTTCAGTGCATCTTCTGCAACCTTCTCGGCTTCCTCTGCTTTTGCAACCAGATCTTCCGCCGCGTCCAGCGCTTCCTGTGCATCCTGGCTATCCGGCTTGCCGTTGCCGTCTGCATCGTTCACCGCCGGTACCTGGATACCATCCACCGCATCCAGACGACCTTTCAGGGCTTCTTTCTCCGGTCCTTCCGGCAGGTTGTTCACCGCAGCCTCGGCCGGGGTCTTCGCTGCCACGACCGCATCATGCTTGGCCGTCAGATCATCATGTTTCGGCTGGTCGATCACATCGCCTGCTGCCTTCAGTGCATCTTCTGCAACCTTCTCGGCTTCCTCTGCTTTTGCAACCAGATCTTCCGCCGCGTCCAGCGCTTCCTGTGCATCCTGGCTATCCGGCTTGCCGTTGCCGTCTGCATCGTTCACCGCCGGTACCTGGATACCATCCACCGCATCCAGACGACCTTTCAGGGCTTCTTTCTCCGGTCCTTCCGGCAGGTTGTTCACCGCAGCCTCGGCCGGGGTCTTCGCTGCCACGACCGCATCATGCTTGGCCGTCAGATCATCATGTTTCGGCTGGTCGATCACATCGCCTGCTGCCTTCAGTGCATCTTCTGCAACCTTCTCGGCTTCCTCTGCTTTTGCAACCAGATCTTCCGCCGCGTCCAGCGCTTCCTGTGCATCCTGGCTATCCGGCTTGCCGTTGCCGTCTGCATCGTTCACCGCCGGTACCTGGATACCATCCACCGCATCCAGACGACCTTTCAGGGCTTCTTTCTCCGGTCCTTCCGGCAGGTTGTTCACCGCAGCCTCGGCCGGGGTCTTCGCTGCCACGACCGCATCATGCTTGGCCGTCAGATCATCATGTTTCGGCTGGTCGATCACATCGCCTGCTGCCTTCAGTGCATCTTCTGCAACCTTCTCGGCTTCCTCTGCTTTTGCAACCAGATCTTCCGCCGCGTCCAGCGCTTCCTGTGCATCCTGGCTATCCGGCTTGCCGTTGCCGTCTGCATCGTTCACCGCCGGTACCTGGATACCATCCACCGCATCCAGACGACCTTTCAGGGCTTCTTTCTCCGGTCCTTCCGGCAGGTTGTTCACCGCAGCCTCGGCCGGGGTCTTCGCTGCCACGACCGCATCATGCTTGGCCGTCAGATCATCATGTTTCGGCTGGTCGATCACATCGCCTGCTGCCTTCAGTGCATCTTCTGCAACCTTCTCGGCTTCCTCTGCTTTTGCAACCAGATCTTCCGCCGCGTCCAGCGCTTCCTGTGCATCCTGGCTATCCGGCTTGCCGTTGCCGTCTGCATCGTTCACCGCCGGTACCTGGATACCATCCACCGCATCCAGACGACCTTTCAGGGCTTCTTTCTCCGGTCCTTCCGGCAGGTTGTTCACCGCAGCCTCGGCCGGGGTCTTCGCTGCCACGACCGCATCATGCTTGGCCGTCAGATCATCATGTTTCGGCTGGTCGATCACATCGCCTGCTGCCTTCAGTGCATCTTCTGCAACCTTCTCGGCTTCCTCTGCTTTTGCAACCAGATCTTCCGCCGCGTCCAGCGCTTCCTGTGCATCCTGGCTATCCGGCTTGCCGTTGCCGTCTGCATCGTTCACCGCCGGTACCTGGATACCATCCACCGCATCCAGACGACCTTTCAGGGCTTCTTTCTCCGGTCCTTCCGGCAGGTTGTTCACCGCAGCCTCGGCCGGGGTCTTCGCTGCCACGACCGCATCATGCTTGGCCGTCAGATCATCATGTTTCGGCTGGTCGATCACATCGCCTGCTGCCTTCAGTGCATCTTCTGCAACCTTCTCGGCTTCCTCTGCTTTTGCAACCAGATCTTCCGCCGCGTCCAGCGCTTCCTGTGCATCCTGGCTATCCGGCTTGCCGTTGCCGTCTGCATCGTTCACCGCCGGTACCTGGATACCATCCACCGCATCCAGACGACCTTTCAGGGCTTCTTTCTCCGGTCCTTCCGGCAGGTTGTTCACCGCAGCCTCGGCCGGGGTCTTCGCTGCCACGACCGCATCATGCTTGGCCGTCAGATCATCATGTTTCGGCTGGTCGATCACATCGCCTGCTGCCTTCAGTGCATCTTCTGCAACCTTCTCGGCTTCCTCTGCTTTTGCAACCAGATCTTCCGCCGCGTCCAGCGCTTCCTGTGCATCCTGGCTATCCGGCTTGCCGTTGCCGTCTGCATCGTTCACCGCCGGTACCTGGATACCATCCACCGCATCCAGACGACCTTTCAGGGCTTCTTTCTCCGGTCCTTCCGGCAGGTTGTTCACCGCAGCCTCGGCCGGGGTCTTCGCTGCCACGACCGCATCATGCTTGGCCGTCAGATCATCATGTTTCGGCTGGTCGATCACATCGCCTGCTGCCTTCAGTGCATCTTCTGCAACCTTCTCGGCTTCCTCTGCTTTTGCAACCAGATCTTCCGCCGCGTCCAGCGCTTCCTGTGCATCCTGGCTATCCGGCTTGCCGTTGCCGTCTGCATCGTTCACCGCCGGTACCTGGATACCATCCACCGCATCCAGACGACCTTTCAGGGCTTCTTTCTCCGGTCCTTCCGGCAGGTTGTTCACCGCAGCCTCGGCCGGGGTCTTCGCTGCCACGACCGCATCATGCTTGGCCGTCAGATCATCATGTTTCGGCTGGTCGATCACATCGCCTGCTGCCTTCAGTGCATCTTCTGCAACCTTCTCGGCTTCCTCTGCTTTTGCAACCAGATCTTCCGCCGCGTCCAGCGCTTCCTGTGCATCCTGGCTATCCGGCTTGCCGTTGCCGTCTGCATCGTTCACCGCCGGTACCTGGATACCATCCACCGCATCCAGACGACCTTTCAGGGCTTCTTTCTCCGGTCCTTCCGGCAGGTTGTTCACCGCAGCCTCGGCCGGGGTCTTCGCTGCCACGACCGCATCATGCTTGGCCGTCAGATCATCATGTTTCGGCTGGTCGATCACATCGCCTGCTGCCTTCAGTGCATCTTCTGCAACCTTCTCGGCTTCCTCTGCTTTTGCAACCAGATCTTCCGCCGCGTCCAGCGCTTCCTGTGCATCCTGGCTATCCGGCTTGCCGTTGCCGTCTGCATCGTTCACCGCCGGTACCTGGATACCATCCACCGCATCCAGACGACCTTTCAGGGCTTCTTTCTCCGGTCCTTCCGGCAGGTTGTTCACCGCAGCCTCGGCCGGGGTCTTCGCTGCCACGACCGCATCATGCTTGGCCGTCAGATCATCATGTTTCGGCTGGTCGATCACATCGCCTGCTGCCTTCAGTGCATCTTCTGCAACCTTCTCGGCTTCCTCTGCTTTTGCAACCAGATCTTCCGCCGCGTCCAGCGCTTCCTGTGCATCCTGGCTATCCGGCTTGCCGTTGCCGTCTGCATCGTTCACCGCCGGTACCTGGATACCATCCACCGCATCCAGACGACCTTTCAGGGCTTCTTTCTCCGGTCCTTCCGGCAGGTTGTTCACCGCAGCCTCGGCCGGGGTCTTCGCTGCCACGACCGCATCATGCTTGGCCGTCAGATCATCATGTTTCGGCTGGTCGATCACATCGCCTGCTGCCTTCAGTGCATCTTCTGCAACCTTCTCGGCTTCCTCTGCTTTTGCAACCAGATCTTCCGCCGCGTCCAGCGCTTCCTGTGCATCCTGGCTATCCGGCTTGCCGTTGCCGTCTGCATCGTTCACCGCCGGTACCTGGATACCATCCACCGCATCCAGACGACCTTTCAGGGCTTCTTTCTCCGGTCCTTCCGGCAGGTTGTTCACCGCAGC
70463 NZ_CP014159.1 Aerococcus-christensenii-strain-CCUG28831 Bacteria 0-9598 9599 20 480 ACGACTTTCG ACGACTTTCGTCGTCTCTGTCTCGCTGACTTTCTTGTCTGGCTCAGTCTGTGTCACACTGATCTCAGTCCCCACAGTTAGCCCTTCAGGTAACTCTGCTTTCCAGCTTGTTCCTGTGACCTTCGCTTCGATTGGCGCTTTCCCTGGAATCGTCACTTTCACTGTCGCTCCGTCAACACCTGTTCCGGTGATTTCCTTGCTTTGCGTATGTGGCGCTTTATCAATCCCTGGTTTAGCGCTCGTCTCACGTTCTGTCATCAAGTCTGTGGTGGATACCTCTTTCTTGCTGCCATCGTCATACGTGATTGTCGTCTTGCCGTTGTCGCCTATCGTGATATGGCCCTTGTCACTGACACCCTTATCTTTATTCTTATCAATGATGGCGTCCTTGATCTTGTCCTTATCCTTCTCATCCAATTCGCCTACCCCATGTTCTACCACGGTTTTATCTGGTGTTGCGAACTGATCAGATTTTGGCGCTACGACTTTCGTCGTCTCTGTCTCGCTGACTTTCTTGTCTGGCTCAGTCTGTGTCACACTGATCTCAGTCCCCACAGTTAGCCCTTCAGGTAACTCTGCTTTCCAGCTTGTTCCTGTGACCTTCGCTTCGATTGGCGCTTTCCCTGGAATCGTCACTTTCACTGTCGCTCCGTCAACACCTGTTCCGGTGATTTCCTTGCTTTGCGTATGTGGCGCTTTATCAATCCCTGGTTTAGCGCTCGTCTCACGTTCTGTCATCAAGTCTGTGGTGGATACCTCTTTCTTGCTGCCATCGTCATACGTGATTGTCGTCTTGCCGTTGTCGCCTATCGTGATATGGCCCTTGTCACTGACACCCTTATCTTTATTCTTATCAATGATGGCGTCCTTGATCTTGTCCTTATCCTTCTCATCCAATTCGCCTACCCCATGTTCTACCACGGTTTTATCTGGTGTTGCGAACTGATCAGATTTTGGCGCTACGACTTTCGTCGTCTCTGTCTCGCTGACTTTCTTGTCTGGCTCAGTCTGTGTCACACTGATCTCAGTCCCCACAGTTAGCCCTTCAGGTAACTCTGCTTTCCAGCTTGTTCCTGTGACCTTCGCTTCGATTGGCGCTTTCCCTGGAATCGTCACTTTCACTGTCGCTCCGTCAACACCTGTTCCGGTGATTTCCTTGCTTTGCGTATGTGGCGCTTTATCAATCCCTGGTTTAGCGCTCGTCTCACGTTCTGTCATCAAGTCTGTGGTGGATACCTCTTTCTTGCTGCCATCGTCATACGTGATTGTCGTCTTGCCGTTGTCGCCTATCGTGATATGGCCCTTGTCACTGACACCCTTATCTTTATTCTTATCAATGATGGCGTCCTTGATCTTGTCCTTATCCTTCTCATCCAATTCGCCTACCCCATGTTCTACCACGGTTTTATCTGGTGTTGCGAACTGATCAGATTTTGGCGCTACGACTTTCGTCGTCTCTGTCTCGCTGACTTTCTTGTCTGGCTCAGTCTGTGTCACACTGATCTCAGTCCCCACAGTTAGCCCTTCAGGTAACTCTGCTTTCCAGCTTGTTCCTGTGACCTTCGCTTCGATTGGCGCTTTCCCTGGAATCGTCACTTTCACTGTCGCTCCGTCAACACCTGTTCCGGTGATTTCCTTGCTTTGCGTATGTGGCGCTTTATCAATCCCTGGTTTAGCGCTCGTCTCACGTTCTGTCATCAAGTCTGTGGTGGATACCTCTTTCTTGCTGCCATCGTCATACGTGATTGTCGTCTTGCCGTTGTCGCCTATCGTGATATGGCCCTTGTCACTGACACCCTTATCTTTATTCTTATCAATGATGGCGTCCTTGATCTTGTCCTTATCCTTCTCATCCAATTCGCCTACCCCATGTTCTACCACGGTTTTATCTGGTGTTGCGAACTGATCAGATTTTGGCGCTACGACTTTCGTCGTCTCTGTCTCGCTGACTTTCTTGTCTGGCTCAGTCTGTGTCACACTGATCTCAGTCCCCACAGTTAGCCCTTCAGGTAACTCTGCTTTCCAGCTTGTTCCTGTGACCTTCGCTTCGATTGGCGCTTTCCCTGGAATCGTCACTTTCACTGTCGCTCCGTCAACACCTGTTCCGGTGATTTCCTTGCTTTGCGTATGTGGCGCTTTATCAATCCCTGGTTTAGCGCTCGTCTCACGTTCTGTCATCAAGTCTGTGGTGGATACCTCTTTCTTGCTGCCATCGTCATACGTGATTGTCGTCTTGCCGTTGTCGCCTATCGTGATATGGCCCTTGTCACTGACACCCTTATCTTTATTCTTATCAATGATGGCGTCCTTGATCTTGTCCTTATCCTTCTCATCCAATTCGCCTACCCCATGTTCTACCACGGTTTTATCTGGTGTTGCGAACTGATCAGATTTTGGCGCTACGACTTTCGTCGTCTCTGTCTCGCTGACTTTCTTGTCTGGCTCAGTCTGTGTCACACTGATCTCAGTCCCCACAGTTAGCCCTTCAGGTAACTCTGCTTTCCAGCTTGTTCCTGTGACCTTCGCTTCGATTGGCGCTTTCCCTGGAATCGTCACTTTCACTGTCGCTCCGTCAACACCTGTTCCGGTGATTTCCTTGCTTTGCGTATGTGGCGCTTTATCAATCCCTGGTTTAGCGCTCGTCTCACGTTCTGTCATCAAGTCTGTGGTGGATACCTCTTTCTTGCTGCCATCGTCATACGTGATTGTCGTCTTGCCGTTGTCGCCTATCGTGATATGGCCCTTGTCACTGACACCCTTATCTTTATTCTTATCAATGATGGCGTCCTTGATCTTGTCCTTATCCTTCTCATCCAATTCGCCTACCCCATGTTCTACCACGGTTTTATCTGGTGTTGCGAACTGATCAGATTTTGGCGCTACGACTTTCGTCGTCTCTGTCTCGCTGACTTTCTTGTCTGGCTCAGTCTGTGTCACACTGATCTCAGTCCCCACAGTTAGCCCTTCAGGTAACTCTGCTTTCCAGCTTGTTCCTGTGACCTTCGCTTCGATTGGCGCTTTCCCTGGAATCGTCACTTTCACTGTCGCTCCGTCAACACCTGTTCCGGTGATTTCCTTGCTTTGCGTATGTGGCGCTTTATCAATCCCTGGTTTAGCGCTCGTCTCACGTTCTGTCATCAAGTCTGTGGTGGATACCTCTTTCTTGCTGCCATCGTCATACGTGATTGTCGTCTTGCCGTTGTCGCCTATCGTGATATGGCCCTTGTCACTGACACCCTTATCTTTATTCTTATCAATGATGGCGTCCTTGATCTTGTCCTTATCCTTCTCATCCAATTCGCCTACCCCATGTTCTACCACGGCTTTATCTGGTGTTGCGAACTGATCAGATTTTGGCGCTACGACTTTCGTCGTCTCTGTCTCGCTGACTTTCTTGTCTGGCTCAGTCTGTGTCACACTGATCTCAGTCCCCACAGTTAGCCCTTCAGGTAACTCTGCTTTCCAGCTTGTTCCTGTGACCTTCGCTTCGATTGGCGCTTTCCCTGGAATCGTCACTTTCACTGTCGCTCCGTCAACACCTGTTCCGGTGATTTCCTTGCTTTGCGTATGTGGCGCTTTATCAATCCCTGGTTTAGCGCTCGTCTCACGTTCTGTCATCAAGTCTGTGGTGGATACCTCTTTCTTGCTGCCATCGTCATACGTGATTGTCGTCTTGCCGTTGTCGCCTATCGTGATATGGCCCTTGTCACTGACACCCTTATCTTTATTCTTATCAATGATGGCGTCCTTGATCTTGTCCTTATCCTTCTCATCCAATTCGCCTACCCCATGTTCTACCACGGTTTTATCTGGTGTTGCGAACTGATCAGATTTTGGCGCTACGACTTTCGTCGTCTCTGTCTCGCTGACTTTCTTGTCTGGCTCAGTCTGTGTCACACTGATCTCAGTCCCCACAGTTAGCCCTTCAGGTAACTCTGCTTTCCAGCTTGTTCCTGTGACCTTCGCTTCGATTGGCGCTTTCCCTGGAATCGTCACTTTCACTGTCGCTCCGTCAACACCTGTTCCGGTGATTTCCTTGCTTTGCGTATGTGGCGCTTTATCAATCCCTGGTTTAGCGCTCGTCTCACGTTCTGTCATCAAGTCTGTGGTGGATACCTCTTTCTTGCTGCCATCGTCATACGTGATTGTCGTCTTGCCGTTGTCGCCTATCGTGATATGGCCCTTGTCACTGACACCCTTATCTTTATTCTTATCAATGATGGCGTCCTTGATCTTGTCCTTATCCTTCTCATCCAATTCGCCTACCCCATGTTCTACCACGGTTTTATCTGGTGTTGCGAACTGATCAGATTTTGGCGCTACGACTTTCGTCGTCTCTGTCTCGCTGACTTTCTTGTCTGGCTCAGTCTGTGTCACACTGATCTCAGTCCCCACAGTTAGCCCTTCAGGTAACTCTGCTTTCCAGCTTGTTCCTGTGACCTTCGCTTCGATTGGCGCTTTCCCTGGAATCGTCACTTTCACTGTCGCTCCGTCAACACCTGTTCCGGTGATTTCCTTGCTTTGCGTATGTGGCGCTTTATCAATCCCTGGTTTAGCGCTCGTCTCACGTTCTGTCATCAAGTCTGTGGTGGATACCTCTTTCTTGCTGCCATCGTCATACGTGATTGTCGTCTTGCCGTTGTCGCCTATCGTGATATGGCCCTTGTCACTGACACCCTTATCTTTATTCTTATCAATGATGGCGTCCTTGATCTTGTCCTTATCCTTCTCATCCAATTCGCCTACCCCATGTTCTACCACGGTTTTATCTGGTGTTGCGAACTGATCAGATTTTGGCGCTACGACTTTCGTCGTCTCTGTCTCGCTGACTTTCTTGTCTGGCTCAGTCTGTGTCACACTGATCTCAGTCCCCACAGTTAGCCCTTCAGGTAACTCTGCTTTCCAGCTTGTTCCTGTGACCTTCGCTTCGATTGGCGCTTTCCCTGGAATCGTCACTTTCACTGTCGCTCCGTCAACACCTGTTCCGGTGATTTCCTTGCTTTGCGTATGTGGCGCTTTATCAATCCCTGGTTTAGCGCTCGTCTCACGTTCTGTCATCAAGTCTGTGGTGGATACCTCTTTCTTGCTGCCATCGTCATACGTGATTGTCGTCTTGCCGTTGTCGCCTATCGTGATATGGCCCTTGTCACTGACACCCTTATCTTTATTCTTATCAATGATGGCGTCCTTGATCTTGTCCTTATCCTTCTCATCCAATTCGCCTACCCCATGTTCTACCACGGTTTTATCTGGTGTTGCGAACTGATCAGATTTTGGCGCTACGACTTTCGTCGTCTCTGTCTCGCTGACTTTCTTGTCTGGCTCAGTCTGTGTCACACTGATCTCAGTCCCCACAGTTAGCCCTTCAGGTAACTCTGCTTTCCAGCTTGTTCCTGTGACCTTCGCTTCGATTGGCGCTTTCCCTGGAATCGTCACTTTCACTGTCGCTCCGTCAACACCTGTTCCGGTGATTTCCTTGCTTTGCGTATGTGGCGCTTTATCAATCCCTGGTTTAGCGCTCGTCTCACGTTCTGTCATCAAGTCTGTGGTGGATACCTCTTTCTTGCTGCCATCGTCATACGTGATTGTCGTCTTGCCGTTGTCGCCTATCGTGATATGGCCCTTGTCACTGACACCCTTATCTTTATTCTTATCAATGATGGCGTCCTTGATCTTGTCCTTATCCTTCTCATCCAATTCGCCTACCCCATGTTCTACCACGGTTTTATCTGGTGTTGCGAACTGATCAGATTTTGGCGCTACGACTTTCGTCGTCTCTGTCTCGCTGACTTTCTTGTCTGGCTCAGTCTGTGTCACACTGATCTCAGTCCCCACAGTTAGCCCTTCAGGTAACTCTGCTTTCCAGCTTGTTCCTGTGACCTTCGCTTCGATTGGCGCTTTCCCTGGAATCGTCACTTTCACTGTCGCTCCGTCAACACCTGTTCCGGTGATTTCCTTGCTTTGCGTATGTGGCGCTTTATCAATCCCTGGTTTAGCGCTCGTCTCACGTTCTGTCATCAAGTCTGTGGTGGATACCTCTTTCTTGCTGCCATCGTCATACGTGATTGTCGTCTTGCCGTTGTCGCCTATCGTGATATGGCCCTTGTCACTGACACCCTTATCTTTATTCTTATCAATGATGGCGTCCTTGATCTTGTCCTTATCCTTCTCATCCAATTCGCCTACCCCATGTTCTACCACGGTTTTATCTGGTGTTGCGAACTGATCAGATTTTGGCGCTACGACTTTCGTCGTCTCTGTCTCGCTGACTTTCTTGTCTGGCTCAGTCTGTGTCACACTGATCTCAGTCCCCACAGTTAGCCCTTCAGGTAACTCTGCTTTCCAGCTTGTTCCTGTGACCTTCGCTTCGATTGGCGCTTTCCCTGGAATCGTCACTTTCACTGTCGCTCCGTCAACACCTGTTCCGGTGATTTCCTTGCTTTGCGTATGTGGCGCTTTATCAATCCCTGGTTTAGCGCTCGTCTCACGTTCTGTCATCAAGTCTGTGGTGGATACCTCTTTCTTGCTGCCATCGTCATACGTGATTGTCGTCTTGCCGTTGTCGCCTATCGTGATATGGCCCTTGTCACTGACACCCTTATCTTTATTCTTATCAATGATGGCGTCCTTGATCTTGTCCTTATCCTTCTCATCCAATTCGCCTACCCCATGTTCTACCACGGTTTTATCTGGTGTTGCGAACTGATCAGATTTTGGCGCTACGACTTTCGTCGTCTCTGTCTCGCTGACTTTCTTGTCTGGCTCAGTCTGTGTCACACTGATCTCAGTCCCCACAGTTAGCCCTTCAGGTAACTCTGCTTTCCAGCTTGTTCCTGTGACCTTCGCTTCGATTGGCGCTTTCCCTGGAATCGTCACTTTCACTGTCGCTCCGTCAACACCTGTTCCGGTGATTTCCTTGCTTTGCGTATGTGGCGCTTTATCAATCCCTGGTTTAGCGCTCGTCTCACGTTCTGTCATCAAGTCTGTGGTGGATACCTCTTTCTTGCTGCCATCGTCATACGTGATTGTCGTCTTGCCGTTGTCGCCTATCGTGATATGGCCCTTGTCACTGACACCCTTATCTTTATTCTTATCAATGATGGCGTCCTTGATCTTGTCCTTATCCTTCTCATCCAATTCGCCTACCCCATGTTCTACCACGGTTTTATCTGGTGTTGCGAACTGATCAGATTTTGGCGCTACGACTTTCGTCGTCTCTGTCTCGCTGACTTTCTTGTCTGGCTCAGTCTGTGTCACACTGATCTCAGTCCCCACAGTTAGCCCTTCAGGTAACTCTGCTTTCCAGCTTGTTCCTGTGACCTTCGCTTCGATTGGCGCTTTCCCTGGAATCGTCACTTTCACTGTCGCTCCGTCAACACCTGTTCCGGTGATTTCCTTGCTTTGCGTATGTGGCGCTTTATCAATCCCTGGTTTAGCGCTCGTCTCACGTTCTGTCATCAAGTCTGTGGTGGATACCTCTTTCTTGCTGCCATCGTCATACGTGATTGTCGTCTTGCCGTTGTCGCCTATCGTGATATGGCCCTTGTCACTGACACCCTTATCTTTATTCTTATCAATGATGGCGTCCTTGATCTTGTCCTTATCCTTCTCATCCAATTCGCCTACCCCATGTTCTACCACGGTTTTATCTGGTGTTGCGAACTGATCAGATTTTGGCGCTACGACTTTCGTCGTCTCTGTCTCGCTGACTTTCTTGTCTGGCTCAGTCTGTGTCACACTGATCTCAGTCCCCACAGTTAGCCCTTCAGGTAACTCTGCTTTCCAGCTTGTTCCTGTGACCTTCGCTTCGATTGGCGCTTTCCCTGGAATCGTCACTTTCACTGTCGCTCCGTCAACACCTGTTCCGGTGATTTCCTTGCTTTGCGTATGTGGCGCTTTATCAATCCCTGGTTTAGCGCTCGTCTCACGTTCTGTCATCAAGTCTGTGGTGGATACCTCTTTCTTGCTGCCATCGTCATACGTGATTGTCGTCTTGCCGTTGTCGCCTATCGTGATATGGCCCTTGTCACTGACACCCTTATCTTTATTCTTATCAATGATGGCGTCCTTGATCTTGTCCTTATCCTTCTCATCCAATTCGCCTACCCCATGTTCTACCACGGTTTTATCTGGTGTTGCGAACTGATCAGATTTTGGCGCTACGACTTTCGTCGTCTCTGTCTCGCTGACTTTCTTGTCTGGCTCAGTCTGTGTCACACTGATCTCAGTCCCCACAGTTAGCCCTTCAGGTAACTCTGCTTTCCAGCTTGTTCCTGTGACCTTCGCTTCGATTGGCGCTTTCCCTGGAATCGTCACTTTCACTGTCGCTCCGTCAACACCTGTTCCGGTGATTTCCTTGCTTTGCGTATGTGGCGCTTTATCAATCCCTGGTTTAGCGCTCGTCTCACGTTCTGTCATCAAGTCTGTGGTGGATACCTCTTTCTTGCTGCCATCGTCATACGTGATTGTCGTCTTGCCGTTGTCGCCTATCGTGATATGGCCCTTGTCACTGACACCCTTATCTTTATTCTTATCAATGATGGCGTCCTTGATCTTGTCCTTATCCTTCTCATCCAATTCGCCTACCCCATGTTCTACCACGGTTTTATCTGGTGTTGCGAACTGATCAGATTTTGGCGCTACGACTTTCGTCGTCTCTGTCTCGCTGACTTTCTTGTCTGGCTCAGTCTGTGTCACACTGATCTCAGTCCCCACAGTTAGCCCTTCAGGTAACTCTGCTTTCCAGCTTGTTCCTGTGACCTTCGCTTCGATTGGCGCTTTCCCTGGAATCGTCACTTTCACTGTCGCTCCGTCAACACCTGTTCCGGTGATTTCCTTGCTTTGCGTATGTGGCGCTTTATCAATCCCTGGTTTAGCGCTCGTCTCACGTTCTGTCATCAAGTCTGTGGTGGATACCTCTTTCTTGCTGCCATCGTCATACGTGATTGTCGTCTTGCCGTTGTCGCCTATCGTGATATGGCCCTTGTCACTGACACCCTTATCTTTATTCTTATCAATGATGGCGTCCTTGATCTTGTCCTTATCCTTCTCATCCAATTCGCCTACCCCATGTTCTACCACGGTTTTATCTGGTGTTGCGAACTGATCAGATTTTGGCGCT
39522 NZ_CP007605.1 Helicobacter-pylori-strain-BM012B Bacteria 0-97 98 7 14 TGATTAGTGA TGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAG
118005 NZ_CP026324.1 Helicobacter-pylori-strain-26695-dRdM2-chromosome Bacteria 0-97 98 7 14 TGATTAGTGA TGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAGTGATTAG
65963 NZ_CP013264.1 Sphingobium-baderi-strain-DE-13 Bacteria 0-99 100 5 20 CCGGGACCAC CCGGGACCACGGTCCTGCTACCGGGACCACGGTCCTGCTACCGGGACCACGGTCCTGCTACCGGGACCACGGTCCTGCTACCGGGACCACGGTCCTACCA
14716 NC_011080.1 Salmonella-enterica-subsp Bacteria 1000020-1000299 280 7 39 CCGGTAGCGC CCGGTAGCGCCGCAGCCGCAGTATCAGCAGCCGCAGCAGCCGGTAGCGCCGCAGCCGCAGTATCAGCAGCCGCAACAGCCGGTAGCGCCTCAGCCGCAGTATCAGCAGCCGCAACAGCCGGTAGCGCCGCAGCCGCAGTATCAGCAGCCGCAACAGCCGGTAGCGCCGCAGCCGCAGTATCAGCAGCCGCAACAGCCGGTAGCGCCGCAGCCACAGTATCAGCAGCCGCAGCAG
23345 NC_017382.1 Helicobacter-pylori-51 Bacteria 1000030-1000134 105 6 16 AATCATTTAA AATCATTTAATCATTTAATCATTTAATCATTTAATCATTTAATCATTTAATCATTTAATCATTTAATCATTTAATCATTT
62300 NZ_CP012584.1 Pseudomonas-aeruginosa-strain-PA_D25 Bacteria 100003-100057 55 4 12 TGGCTGTGGC TGGCTGTGGCTGTGGCTGTGGCTGTGGCTGTGGCTG
62309 NZ_CP012585.1 Pseudomonas-aeruginosa-strain-PA_D1 Bacteria 100004-100058 55 4 12 TGGCTGTGGC TGGCTGTGGCTGTGGCTGTGGCTGTGGCTGTGGCTG
62255 NZ_CP012579.1 Pseudomonas-aeruginosa-strain-PA_D5 Bacteria 100004-100058 55 4 12 TGGCTGTGGC TGGCTGTGGCTGTGGCTGTGGCTGTGGCTGTGGCTG