Satellite database app by ALGGEN

Id Genbank id Name Type Indice Satlength Numrep Replength Seed Seq
23231 NC_017366.1 Helicobacter-pylori-F32-DNA Bacteria 487189-487300 112 7 16 TTTTTTGAAC TTTTTTGAACTCTTTTTTTTTTGAACTCTTTTTTTTTTGAACTCTTTCTTTTTTGAACTCTTTCTTTTTTGAACTCTTTCTTTTTTGAACTCTTTC
135960 NZ_CP032910.1 Helicobacter-pylori-strain-20-A-EK1-chromosome Bacteria 269064-269164 101 5 14 TTTTTTGAAC TTTTTTAAACTCTTTGTTTTGAACTCCTTTTTTTGAACTCCTTTTTTTGAACCCTT
357 NC_007355.1 Methanosarcina-barkeri-str Arqueas 2944241-2944349 109 4 27 TTTTTTGAAA TTTTTTGAAAAGGTTTACGGTCAAGTCTTTTTTGAAAAGGTTTTTGATCAAATTTTTTTTGAAAAAGTTTGCGCTTAAGCCTTTTTTGAAAAGGTTTTTGATCAAGCT
81 NC_003901.1 Methanosarcina-mazei-strain-Goe1 Arqueas 2020853-2020949 97 5 12 TTTTTTCTTC TTTTTTCTTCTATTTTTTCTTCTATTTTTTCTTCTATTTTTTCTTCTA
84129 NZ_CP017599.1 Moorea-producens-PAL-8-15-08-1-chromosome Bacteria 29999-30172 174 4 41 TTTTTTCTCT TTTTTTCTCTAAAACAGAACCGTTCCGTCTTAGACCACCCGTTTTTTCTCTAAAACATAACCGCTCCGTCTTACACCACTGGTTTTTTCTCTAAAACAGAACCGTTCCGTCTTACACCACTGG
33156 NZ_AP018536.1 Lachnospiraceae-bacterium-GAM79-DNA Bacteria 1047530-1047738 209 4 52 TTTTTTCTCT TTTTTTCTCTGTTGAGCCCCGGAAGTTTCCGACAAGCGGGGCGTAATCTACATTTTTTCTCTGTTGAGCCCCGGAAGTTTCCGACAAGCGGGGCGTAATCTACATTTTTTCTCTGTTGAGCCCCGGAAGTTTGCGACAAGCGGGGCGTAATCCATGTTTTTTCTCTGTTGAGCCCCGGAAGTTCCTGACAAGCGGGGCAAAATTCATG
31573 NZ_AP013045.1 Tannerella-forsythia-KS16-DNA Bacteria 202948-203053 106 4 21 TTTTTTCGAT TTTTTTCGATCTGACGTCATGTTTTTTCGATCTGACATCGCATTTTTTCGTTCTGACATCGTA
293 NC_007355.1 Methanosarcina-barkeri-str Arqueas 1881525-1881637 113 8 14 TTTTTTCATC TTTTTTCATCTTAATTTTTTCATCTTAATTTTTTCATCTTAATTTTTTCATCTTAATTTTTTCATCTTAATTTTTTCATCTTAATTTTTTCATCTTAATTTTTTCATCTTAA
167771 NZ_LS483409.1 Streptococcus-gallolyticus-strain-NCTC13773-genome-assembly Bacteria 1976680-1976922 243 5 48 TTTTTTCACG TTTTTTCACGAGCCTTGAAATAAAGAAGCGAGTCAGTCCTGTGGACGTTTTTTTCACGAGCCTTGAAATAAAGAAGCGAGTCAGTCCTGTGGACGTTTTTTTCACAAGCCTTGAAATAAAGAAGCGAGTCAGTCCTGTGGACGTTTTTTTCACGAGCCTTGAAATAAAGAAGCGAGTCAGTCCTGTGGACTG
90855 NZ_CP018822.1 Streptococcus-gallolyticus-subsp Bacteria 1975998-1976240 243 5 48 TTTTTTCACG TTTTTTCACGAGCCTTGAAATAAAGAAGCGAGTCAGTCCTGTGGACGTTTTTTTCACGAGCCTTGAAATAAAGAAGCGAGTCAGTCCTGTGGACGTTTTTTTCACAAGCCTTGAAATAAAGAAGCGAGTCAGTCCTGTGGACGTTTTTTTCACGAGCCTTGAAATAAAGAAGCGAGTCAGTCCTGTGGACTG
135367 NZ_CP032682.1 Staphylococcus-pseudintermedius-strain-G3C4-chromosome Bacteria 1835513-1836038 526 5 105 TTTTTTCACA TTTTTTCACAATACGATATGATCAATGAAGAAGCGTTAAAACAAGCACAACCTAAAACAGCAACACAATCAACAAAAGCAACGAGCCGTACACACAATGAAAACATTTTTTCACAATACGATATGATCAATGAAGAAGCGTTAAAACAAGCACAACCTAAAACAGCAACACAATCAACAAAAGCAACGAGCCGTACACACAATGAAAACATTTTTTCACAATACGATATGATCAATGAAGAAGCGTTAAAACAAGCACAACCTAAAACAGCAACACAACCAACAAAAGCAACGAGCCGTACACACAATGAAAACATTTTTTCACAATACGATATGATCAATGAAGAAGCGTTAAAACAAGCACAACCTAAAACAACAACACAATCAACAAAAGCAACGAGCCGTACACACAATGAAAACATTTTTTCACAATACGATATGATCAATGAAGAAGCGTTAAAACAAGCACAACCTAAAACAGCAACACAATCAACAAAAGCAACGAGCCGTACACACAATGAAAACA
94621 NZ_CP019962.1 Eubacterium-limosum-strain-ATCC-8486-chromosome Bacteria 2606283-2607275 993 5 164 TTTTTTATTT TTTTTTATTTTTTGAAAAGATAAAGTCAGACAGATAGCTCAGACGAAAAAGCAAGAGCGTCAAACAGGCAGCAGCCGGAAAAGAAGGCCTGTCGGTGGTTCGATTCCGCCTCTGGGCACCACTTTGAAATTTAGACGCAAGTTTGTCAGACAGCAGGTCTGACTTTTTTTATTTTTTGAAAAGATAAAGCCAGACAGATAGCTCAGACGAAAAAGCAAGAGCGTCAAACAGGCAGCAGCCGGAAAAGAAGGCCTGTCGGTGGTTCGATTCCGCCTCTGGGCACCACTTTGAAATTTAGCCGCAGGTTTGTCAGACAGCAGGTCTGGCTTTTTTTATTTTTTGAAAAGATAAAGCCAGACAGATAGCTCAGACGAAAAAGCAAGAGCGTCAAACAGGCAGCAGCCGGAAAAGAAGGCCTGTCGGTGGTTCGATTCCGCCTCTGGGCACCACTTTGAAATTTAGCCGCAGGTTTGTCAGACAGCAAGTCTGACT
3482 NZ_CP009515.1 Methanosarcina-lacustris-Z-7289 Arqueas 28156-28231 76 6 11 TTTTTTATTT TTTTTTATTTTTTTTTCATTTCTTTTTCATTTCTTTTTTATTTCTTTTTTATTTC
20219 NC_015578.1 Treponema-primitia-ZAS-2 Bacteria 184504-185011 508 4 102 TTTTTTATTT TTTTTTATTTTTGTCTCCGCGCTGCCTTTTTTGAAGCCCACGCCATGCTGCCTGAAACCAGGGGACACGCTCAATGTTTCGCGTGCTTTATACGGGCGGGCTTTTTTTATTTTTGTCTCCGCGCTGCCTTTTTTGAAGCCCACGCCATGCTGCCTGAAACCAGGGGACACGCTCAATGTTTCGCGTGCTTTATACGGGCGGGCTTTTTTTATTTTTGTGTCCGCGTTACCTTTTTTGAAGCCTACGCCGTGCTGTCTGAAACTAGGGGACACGCTCAATATTTCGCGTGCCTTATGCGGGCAGGCT
5871 NZ_CP009530.1 Methanosarcina-barkeri-227 Arqueas 3416188-3416271 84 4 21 TTTTTTATTT TTTTTTATTTCAAGATTTACGTTTTTTATTTTGAAAGTTACTTTTTTTATTTTGAAAGTTACT
74 NC_003901.1 Methanosarcina-mazei-strain-Goe1 Arqueas 1848496-1848933 438 5 15 TTTTTTATTG TTTTTTATTGCTGATTTTTTTATTGCTGATTTTTTTATTGCTGAT
6145 NZ_CP014265.1 Methanobrevibacter-olleyae-strain-YLM1 Arqueas 1989022-1989089 68 6 11 TTTTTTATTA TTTTTTATTAGTTTTTTATTAGTTTTTTATTAGTTTTTTATTAGTTTTTTATTAG
4516 NZ_CP009520.1 Methanosarcina-vacuolata-Z-761 Arqueas 4187944-4188088 145 9 16 TTTTTTATGA TTTTTTATGAGTTTAGTTTTTTATGAATTTAGTTTTTTATGAATTTAGTTTTTTATGAATTTAGTTTTTTATGAATTTAGTTTTTTATGAATTTAGTTTTTTATGAATTTAGTTTTTTACGAATTTAGTTTTTTATGAGTTTAA
29143 NC_021218.3 Helicobacter-pylori-UM066 Bacteria 731505-731565 61 4 15 TTTTTTATCC TTTTTTATCCCTAGCTTTTTTATCCCTAGCTTTTTTATCCCTAGCTTTTTTATCCCTAGC
64 NC_003901.1 Methanosarcina-mazei-strain-Goe1 Arqueas 1574180-1574380 201 10 20 TTTTTTATAT TTTTTTATATCTTTTTATAGTTTTTTATATCTTTTTATAGTTTTTTATATCTTTTTATAATTTTTTATATCTTTTTATAATTTTTTATATCTTTTTATAATTTTTTATATCTTTTTATAATTTTTTATATCTTTTTATAATTTTTTATATCTTTTTATAATTTTTTATATCTTTTTATAATTTTTTATATCTTTTTATAA
146929 NZ_CP038009.1 Acinetobacter-haemolyticus-strain-TJR01-chromosome Bacteria 24463-25211 749 8 84 TTTTTTATAA TTTTTTATAAATGGTTTGTAAACTTTCTTCCGTCCTAATGACGTAAGTTATTGTTTTATAGTGGTGCCAAAATACGAGCGAAACTTTTTTATAAATGGGTTGTAAACTTTCTTCCGTCCTAATGATGTAAGTTGTTGATTTATAGTGCTGGCAAATTTCGAGCGAAACTTTTTTATAAATGGGTTGTAAACTTTCTTCCGTCCTAATGATGTAAGTTGTTGATTTATAGTGCTGGCAAATTTCGAGCGAAAGTTTTTTATAAATGGGTTGTAAACTTTCTTCCGTCCTAATGATGTAAGTTGTTGATTTATATTGCTGGCAAATTTCGAGCGAAAGTTTTTTATAAATGGGTTGTAAACTTTCTTCCGTCCTAATGACGTAAGTTATTGATTTATAGTTGTGTCAAAATACGAGCGAAAG
52899 NZ_CP010350.1 Acinetobacter-johnsonii-XBB1 Bacteria 54240-54988 749 8 84 TTTTTTATAA TTTTTTATAAATGGTTTGTAAACTTTCTTCCGTCCTAATGACGTAAGTTATTGTTTTATAGTGGTGCCAAAATACGAGCGAAACTTTTTTATAAATGGGTTGTAAACTTTCTTCCGTCCTAATGATGTAAGTTGTTGATTTATAGTGCTGGCAAATTTCGAGCGAAACTTTTTTATAAATGGGTTGTAAACTTTCTTCCGTCCTAATGATGTAAGTTGTTGATTTATAGTGCTGGCAAATTTCGAGCGAAAGTTTTTTATAAATGGGTTGTAAACTTTCTTCCGTCCTAATGATGTAAGTTGTTGATTTATATTGCTGGCAAATTTCGAGCGAAAGTTTTTTATAAATGGGTTGTAAACTTTCTTCCGTCCTAATGACGTAAGTTATTGATTTATAGTTGTGTCAAAATACGAGCGAAAG
134293 NZ_CP032286.1 Acinetobacter-sp Bacteria 30079-30827 749 8 84 TTTTTTATAA TTTTTTATAAATGGTTTGTAAACTTTCTTCCGTCCTAATGACGTAAGTTATTGTTTTATAGTGGTGCCAAAATACGAGCGAAACTTTTTTATAAATGGGTTGTAAACTTTCTTCCGTCCTAATGATGTAAGTTGTTGATTTATAGTGCTGGCAAATTTCGAGCGAAACTTTTTTATAAATGGGTTGTAAACTTTCTTCCGTCCTAATGATGTAAGTTGTTGATTTATAGTGCTGGCAAATTTCGAGCGAAAGTTTTTTATAAATGGGTTGTAAACTTTCTTCCGTCCTAATGATGTAAGTTGTTGATTTATATTGCTGGCAAATTTCGAGCGAAAGTTTTTTATAAATGGGTTGTAAACTTTCTTCCGTCCTAATGACGTAAGTTATTGATTTATAGTTGTGTCAAAATACGAGCGAAAG
157565 NZ_CP043052.1 Acinetobacter-pittii-strain-AP43-chromosome Bacteria 229468-230216 749 8 84 TTTTTTATAA TTTTTTATAAATGGTTTGTAAACTTTCTTCCGTCCTAATGACGTAAGTTATTGTTTTATAGTGGTGCCAAAATACGAGCGAAACTTTTTTATAAATGGGTTGTAAACTTTCTTCCGTCCTAATGATGTAAGTTGTTGATTTATAGTGCTGGCAAATTTCGAGCGAAACTTTTTTATAAATGGGTTGTAAACTTTCTTCCGTCCTAATGATGTAAGTTGTTGATTTATAGTGCTGGCAAATTTCGAGCGAAAGTTTTTTATAAATGGGTTGTAAACTTTCTTCCGTCCTAATGATGTAAGTTGTTGATTTATATTGCTGGCAAATTTCGAGCGAAAGTTTTTTATAAATGGGTTGTAAACTTTCTTCCGTCCTAATGACGTAAGTTATTGATTTATAGTTGTGTCAAAATACGAGCGAAAG
158695 NZ_CP043307.1 Acinetobacter-johnsonii-strain-Acsw19-chromosome Bacteria 99996-100744 749 8 84 TTTTTTATAA TTTTTTATAAATGGTTTGTAAACTTTCTTCCGTCCTAATGACGTAAGTTATTGTTTTATAGTGGTGCCAAAATACGAGCGAAACTTTTTTATAAATGGGTTGTAAACTTTCTTCCGTCCTAATGATGTAAGTTGTTGATTTATAGTGCTGGCAAATTTCGAGCGAAACTTTTTTATAAATGGGTTGTAAACTTTCTTCCGTCCTAATGATGTAAGTTGTTGATTTATAGTGCTGGCAAATTTCGAGCGAAAGTTTTTTATAAATGGGTTGTAAACTTTCTTCCGTCCTAATGATGTAAGTTGTTGATTTATATTGCTGGCAAATTTCGAGCGAAAGTTTTTTATAAATGGGTTGTAAACTTTCTTCCGTCCTAATGACGTAAGTTATTGATTTATAGTTGTGTCAAAATACGAGCGAAAG