Satellite database app by ALGGEN

Id Genbank id Name Type Indice Satlength Numrep Replength Seed Seq
31837 NZ_AP014628.1 Pseudomonas-sp Bacteria 867617-868109 493 4 123 GTAGGAGCCG GTAGGAGCCGGCTTGCCGGCGAAGAGACCCCCAGGTTTTGCGCACGTCTTGAAATCGCTTTCGCTGGCAAGCCAGCTCCTACGGTGGCTGTGCGTATCGGGTCTGTCCGGCAATCGATCCCTTGTAGGAGCCGGCTTGCCGGCGAAGGGGCCCCCAGGTTTTGCGCACGTCTTGAAATCGCTTTCGCTGGCAAGCCAGCTCCTACGGTGGCTGTGTGCATCGTGTCTGTCCGGCAATCGATCCCTTGTAGGAGCCGGCTTGTCGGCGAAGGGGCCCCCAGGTTTTGCGCACGTCTTGAAATCGCTTTCGCTGGCAAGCCAGCTCCTACGGTGGCTGTGTGCATCGTGTCTATCCGGCAATCGATCCCTTGTAGGAGCCGGCTTGCCGGCGAAGGGGCACCCAGGTTTTGCGCACGTCTTGAAATCGCTTTCGCTGGCAAGCCAGCTCCTGCGGTGGCTGTGTGTATCGGGTCTATCCGGCAATCGATCCCTT
31838 NZ_AP014628.1 Pseudomonas-sp Bacteria 1141594-1142034 441 4 110 CTGGCTTGCC CTGGCTTGCCAGCGAAAGCGTCGTCACAGGCGGTGCAAGGCTCGCGGGCCCCTTCGCCGGCAAGCCGGCTCCTACGGGGAACTGCGCGGTGCACCTGACTGCTGTAGGCGCTGGCTTGCCAGCGAAGGCGTCGGTCCAGGCGCTGCAAGGCTTGCGGGCCCCTTCGCCGGCAAGCCGGCTCCTACGGGGAACTGCGCGGTGCACCTGACGGCTGTAGAAACTGGCTTGCCAGCGAAGGCGTCGGCCCAGGCGGTGCAAGGCTTGCGGGCCCCTTCGCCGGCAAGCCGGCTCCTACGGAGAACTGCGCGGTGCACCTGACTGCTGTAGGAGCTGGCTTGCCAGCGAAGGCGTCGTCACAGGCGGTGCAAGGCTCGCGGGCCCCTTCGCCGGCAAGCCGGCTCCTACGGAGAGCTGCGCGGTGCACCTGACGGCTGTAGGAG
31839 NZ_AP014628.1 Pseudomonas-sp Bacteria 1587657-1588300 644 5 129 GTCAGCCTGG GTCAGCCTGGTGTTCTGAAGCACGCCAGCCATCCACCTCGTAGGAGCTGGCTTGCCAGCGAAGGCGGCCGCATGACGGGTGCAGGGTTCAGGGGCTGTTCGCCAGCAAGCTGGCTCCTACGGCCGCTGTGTCAGCCTGGTGTTCTGAAGCACGCCAGTCATCCACCTCGTAGGAGCTGGCTTGCCAGCGAAGGTGGCCGCATGACGGGTGCAGGGTTCAGGGGCTGTTCGCCAGCAAGCTGGCTCCTACGGCCGCTGTGTCAGCCTGGTGTTCTGAAGCACGCCAGCCATCCACCTCGTAGGAGCTGGCTTGCCAGCGAAGGCGGCCGCATGAGGGGTGCAGGGTTGAGGGGCTGTTCGCCAGCAAGCTGGCTCCTACGGCTGCTGT
31840 NZ_AP014628.1 Pseudomonas-sp Bacteria 2300619-2300685 67 5 12 GCTCCAGCTC GCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCAGCTCCA
31841 NZ_AP014628.1 Pseudomonas-sp Bacteria 2433814-2434597 784 4 133 TGCCGGCGAA TGCCGGCGAAGAGGCCCTCAAGCCTTGCACCAGCCCGGATGACGCCTTCGCTGGCAAGCCAGCTCCTACGGAGGTCGCGCCGCGCATTCCTCGCCTATTTTCCGCATTGGCGCATTTCCCGTAGGAGCCGGCTTGCCGGCGAAGAGGCCCTCAAGCCTTGCACCAGCCCGGATGACGCCTTCGCTGGCAAGCCAGCTCCTACGGAGGTCGTGCCGCGCATTCCCCGCCTATTTTCCGCATTGGCGCATTTCCCGTAGGAGCCGGCTTGCCGGCGAAGAGGCCCTCAAGCCTTGCACCAGCCTGGATGACGCCTTCGCTGGCAAGCCAGCTCCTACGGAGGTGACGCGCCGCATTCCCCGCCTATTTTCCGCATTGGCGCCTTCCCCGTAGGAGCCGGCT
31842 NZ_AP014628.1 Pseudomonas-sp Bacteria 2454668-2455036 369 4 92 GGCTTGCCGG GGCTTGCCGGCGATGGCGGTCTTGCGGGCCCCTTCGCTGGCAAGCCAGCTCCTACGGGAGGCAGGTACATCGCGTGGAGCCTTGTAGGAGCCGGCTTGCCGGCGATGGCGGTCTTGCGGGCTTCTTCGCTGGCAAGCCAGCTCCTACGGTAGGCAGATACATCGCTTGGAGCCTTGTAGGAGCCGGCTTGCCGGCGAAGGCGATCTTGCGGGCCTCTTCGCTGGCAAGCCAGCTCCTACGGGAGGCAGGTACATCGCGTGGAGCCTTGTAGGAGCCGGCTTGCCGGCGAAGGCGATCTTGCGGGCTTCTTCGCTGGCAAGCCAGCTCCTACGGGAGGCAGGTACATAGCGTGGAGCCTTGTAGGAGCC
31843 NZ_AP014628.1 Pseudomonas-sp Bacteria 2522915-2523229 315 5 63 CCGCAGCAAC CCGCAGCAACGGATATGTACCCCGTCCCACTCGCTGTAAGAGCGAAACCCTAAGCGGCCGTGACCGCAGCAACGGATATGTACCCCGTCCCACTCGCTGTAAGAGCGAAACCCTAAGCGGCCGTGACCGCAGCAACGGATATGTACCCCGTCCCACTCGCTGTAAGAGCGAAACCCTAAGCGGCCGTAACCGCAGCAACGGATATGCACCCCGTCCCACTCGCTGTAAGAGCGAAACCCTAAGTAGCCGCAC
31844 NZ_AP014628.1 Pseudomonas-sp Bacteria 2547263-2547447 185 4 46 TTCGCCGGCA TTCGCCGGCAAGCCGGCTCCTACGGGTTGTGGGGCTTGAGAGCGCCTTCGCCGGCAAGCCGGCTCCTACGGGTTGTGGGGCTTGAGAGCGCCTTCGCCGGCAAGCCGGCTCCTACGGGTTGTTGGGCTTGAGATCGCTTTCGCCGGCAAGCCGGCTCCTACGGGTTGTGGGGCTTGAGATTGCT
31845 NZ_AP014628.1 Pseudomonas-sp Bacteria 2616973-2617029 57 4 14 AGCTGCAAGC AGCTGCAAGCTGCAAGCTGCAAGCTGCAAGCTGCAAGCTGCAAGCTGCAAGCTGCA
31846 NZ_AP014628.1 Pseudomonas-sp Bacteria 2632602-2633152 551 5 110 CGGTGCAAGG CGGTGCAAGGCTTGCGGGCCTGTTCGCCGGCAAGCCGGCTCCTACGCAATGCGCTGCCGCTGAGCGGGCGTCTGTAGGCGTTGGCTGGCCGGCGAAGGCGTCGGTTGGATCGGTGCAAGGCTTGTGGGTCTGTTCGCCGGCAAGCCAGCTCCTACGCAATGTGCTGCCGCTGAGCGGGCGTCTGTAGGCGCTGGCTGGCCAGCGAAGATGCCGGTTGGATCGGTGCAAGGCTTGTGGGTCTGTTCGCCGGCAAGCCGGCTCCTACGCAATGTGCTGCCGCTGAGCGGGTGTCTGTAGGCGCTGGCTGGCCGGCGAAGGCGTCGGTTGGATCGGTGCAAGGCTTGCGGGTCTGTTCGCCGGCAAGCCGGCTCCTACGCAATGTGTTGTCGCTGAGCGGGCGTCTATAGGCGCTGGCTGGCCAACGAAGATGCCGGTTGGATCGGTGCAAGGCTTGCGGGTCTGTTCGCCGGCAAGCCGGCTCCTACGTAATGTGCTGCCGCTGAGCGGGTGTCTGTAGGAGCTGGCTGGCCAGCGAAGGGGCCGTTTGGGG
31847 NZ_AP014628.1 Pseudomonas-sp Bacteria 2949684-2950092 409 4 102 GTAGGAGCTG GTAGGAGCTGGCTCGCCAGCGAAAGGGCCCGCAAGACAGGCGTCGGATTCAGCAACGCCTTCGCCGGCAAGCCGGCTCCTACCAGGGAGCCGCCCAATTCCGGTAGGAGCTGGCTTGCCAGCGAAAGGGCCCGCAAGACAGGCGTCGGATTCAGCAACGCCTTCGCCGGCAAGCCGGCTCCTACCAGGGAGCCGTCCAATTCCGGTAGGAGCTGGCTTGCCAGCGAAAGGGCCCGCAAGACAGGCGCCGGATTCAGCAACGCCTTCGCCGGCAAGCCGGCTCATACCAGGGAGCCGCCCAATTCCGGTAGGAGCTGGCTTGCCAGCGAAGAGGCCCGCACGACAGGCGCCGGATTCAGCAACGCCTTCGCCGGCAAGCCGGCTCCTACCAGGGAGCCGTCCAATTCCG
31848 NZ_AP014628.1 Pseudomonas-sp Bacteria 3065752-3066191 440 5 91 TGTAGCCGCT TGTAGCCGCTGCCGAAGGCTGCGAACGAGCCGTAGGCTCGCAGCGATTCCCCGGCCGCCGAGGCCCCTGCGGGCCTTCGCGCATCGCTTTATGTAGCCGCTGCCGAAGGCTGCGAACGAGCCGTAGGCTCGCAGCGACTCCCCGGCCGCCGAGGCCCCTGCGGGCCTTCGCGCATCGCTTTATGTAGCCGCTGCCGAAGGCTGCGAACGAGCCGTAGGCTCGCAGCGATTCCCCGGCCGCCGAGGCCCCTGCGGGCCTTCGCGCATCGCTTTATGTAGCCGCTGCCGAAGGCTGCGAACGAGCCGCAGGCTCGCAGCGATTCCCCGGCCACCGAGGCCCCTGCGGGCCTTCGCGCATCGCTTTA
31849 NZ_AP014628.1 Pseudomonas-sp Bacteria 3431777-3432011 235 6 39 TGCGCCATGG TGCGCCATGGATAAATGCAAGGTCGAGGCCTTGACTGCCTGCGCCATGGACAAGTGTAAGGTCGAGGCCTTGACCGCCTGCGCCATGGACAAGTGCAAGGTTGAAGCCCTCACCGCCTGCGCCATGGATAAATGCAAGGTCGAAGCCCTCACCGCCTGTGCCATGGATAAATGCAAGGTCGAAGCCCTGACCGCCTGCGCCATGGACAAGTGCAAGGTCGAAGCCCTCACCGCT
31850 NZ_AP014628.1 Pseudomonas-sp Bacteria 3646490-3647025 536 5 107 CTGGCTTGCC CTGGCTTGCCAGCCAAGGCGGTTTCGAAGCTGGCATCCGGCTTAGGGTCGTCTTCGCCGGCAAGCCGGCTCCTACAACAACCCGCGCACAACCTGCTGGCGTAGGAGCTGGCTTGCCAGCGAAGGCGTCCGCCAGAGCACCACAAGACTCAAGGCCCCCTTCGCCGGCAAGCCGGCTCCTACAACAACCCGCGCACCACCTGCTGGCGTAGGAGCTGGCTTGCCAGCGAAGGCGTCCGCCAGAGCACCGCAAGACTCAAGGTCCCCTTCGCCGGCAAGCCGGCTCCTACAACAACCTGCGCGCCACCTGCTGGCGTAGGAGCTGGCTTGCCAGCGAAGGCGTCCGCCAGAGCACCGCAAGACTCAAGGCCCCCTTCGCCGGCAAGCCGGCTCCTACAACAACCCGCGCACCACCTACTTGCGCAGGAGCTGGCTTGCCAGCGAAGGCGTCCGCCAGGGCACCGCAAGACTCAGGGCCCCCTTCGCCGGCAAGCCGGCTCCTACAACAACCCGCGCACCACCTGCTTGCGTAGGAG
31851 NZ_AP014628.1 Pseudomonas-sp Bacteria 3794973-3795490 518 5 110 GCTTCGCCGG GCTTCGCCGGCAAGCCGGCTCCTACGAAAATATCGTGCAGTGCCAGGGCGACCTTAGGAGCTGGCTTGCCAGCGAAGGCGCTCACCAGGGCAATGCAAGACCTGATGGCCGCTTCGCCGGCAAGCCGGCTCCTACGAAAATATCGTGCAGTGCCAGGGCGACCTTAGGAGCTGGCTTGCCAGCGAAGGCGCTCACCAGGGCAATGCAAGACCTGATGGTCGCTTCGCCGGCAAGCCGGCTCCTACGAAAATATCGTGCAGTGCCAGGGCGACCGTAGGAGCTGGCTTGCCAGCGAAGGCGCTCACCAGGGCAATGCAAGACCTGATGGCC
31852 NZ_AP014628.1 Pseudomonas-sp Bacteria 4194330-4194969 640 4 160 GATCGCCAGG GATCGCCAGGCAAGGTCCTGCGGACCTTGTCGCAGCCTCGCCACCGGCTCGGCAGCGGCTACAGCCACCCCTGAACGATCGTGTAGCCGCTGCCGCAGGCTGCGTACGGCTGCGCAGCAGACGCAACGATTTCAAGTCCACCCGGTGGTGGTCGGCGGGTGATCGCCAGGCAAGGTCCTGCGGACCTTGTCGCAGCCTCGCCACCGGCTCGGCAGCGGCTACAGCCACCCCTGAGCGATCGTGTAGCCGCTGCCGCAGGCTGCGTACGGCTGCGCAGCAGACGCAACGATTTCAAATCCGCCCGGTGGTGGTCGGCGGGTGATCGCCAGGCAAGGCCCTGCGGACCTTGTCGCAGCCTCGCCACAGGCTCGGCAGCGGCTACAGCCACATCTGGGCGATCGTGTAGCCGCTGCCGCAGGCTGCGTACGGCTGCGCAGCAGACGCAACGATTTCAAATCCACCCGGTGGTGGTCGGCGGGT
31853 NZ_AP014628.1 Pseudomonas-sp Bacteria 4653820-4654244 425 4 106 CTTGCCGGCC CTTGCCGGCCCATTCGCCGGCCAGCCGGCTCCTACGGATACCTATTGCTCGCCTCCCTTGTAGGAGCAGGCGGGCCCGCGAAGGCGTCAGCGGGGGCGCTGCATGGCTTGCCGGCCCATTCGCCGGCAAGCCGGCTCCTACGGATACCTATTGCTCGCCACCCTTGTAGGAGCGGGCTGGCCCGCGAAGGCGTCAGCTGGGGCGCTGCATGGCTTGCCGGCCTGTTCGCCGGCAAGCCGGCTCCTACGGGTACGTATTGCTCGCCTCCCTTGTAGGAGCGGGCTGGCCCGCGAAGGCGTCAGTGGGGGCGCTGAATGGCTTGCCGGCCCATTCGTCGGCAAGCCGGCTCCTACGGATACCTATTGCTTGCCCCACTTGTAGGAGCGGGCGGGGCCGCGAAGGCGTAAGCGGGGGCGCTGCACGG
32167 NZ_AP017367.1 Leptolyngbya-sp Bacteria 860035-860091 57 4 14 GACGGTTTTC GACGGTTTTCCAGGGACGGTTTTCCAGGGACGGTTTTCCAGGGACGGTTTTCCAGG
31855 NZ_AP014628.1 Pseudomonas-sp Bacteria 5298633-5298906 274 7 39 CGCACCGGTT CGCACCGGTTCCGCCACTCTCGCTGCCGATGGCTACGACCGCACCGGTTCCGCCACCTTCGCTGCCGATGGCTACGACCGCACCGGTTCCGCCACCTTCGCGGCCGACGGTTACGACCGCACCGGTTCCGCCACCCTCGCCGCCGATGGTTACGATCGCACCGGTTCCGCCACCCTCGCTGAAGACGGCTACGACCGCACCGGTTCCGCCACCTTCGCCGCCGATGGCTACGATCGCACCGGTTCCGCCACCTTCGCGGCCGACGGTTACGAT
31856 NZ_AP014628.1 Pseudomonas-sp Bacteria 6418028-6418532 505 5 112 GCATCGCCCT GCATCGCCCTTGCGAGCGCCTTCGCTGGCAAGCCAGCTCCCACAGCAGCATTCAGGGTGCTACCGCCGCCACCGTAGGAGCCGGCTTGCCGGCGAATGGGCCTTTGAACCTTGCATCGCCCTCGCGAGCGCCTTCGCTGGCTAGCCAGCTCCCACAGCAGCATTCAGGGTGCTGGCGCCGCCACCGTAGGAGCCGGCTTGCCGGCGAATGGGCCTTTAAACCTCGCATCGCCCTCGCGAGCGCCTTCGCTGGCTAGCCAGCTCCTACAGCAGCATTCGGGGTGCTGGCGCCGCCACCGTAGGAGCCGGCTTGCCGGCGAATGAGCCTTTGAACCTT
31857 NZ_AP014633.1 Thioploca-ingrica-DNA Bacteria 86745-86850 106 4 21 ACATTTAATT ACATTTAATTGGACACTGATAATATTTAATTAACAATGGGTCACATTTAATTTAATACGAATA
31858 NZ_AP014633.1 Thioploca-ingrica-DNA Bacteria 144065-144212 148 5 21 TTATCGACTA TTATCGACTAACAGCAACCTGTTATCAACTAACAGCGTTCTGTTATCGACTAACAGCAACCTG
31859 NZ_AP014633.1 Thioploca-ingrica-DNA Bacteria 1026413-1026701 289 4 72 CTAGGCAATC CTAGGCAATCTCAGTAAGTTGCAATATCTTGGCCTCAGTAACAACCAACTCAGCGGCCCGATCCCCCCAGAGCTAGGTAATCTCAGGAAGTTGTACAATCTTTACCTAGATAGCAACCAATTCAGCGGCCCGATCCCACCAAAGCTAGGCAATCTCAGGAAGTTGCAAGGTCTTGACCTCAGTAACAACCAACTCAGCAGCCCGATCCCACCAAAGCTAGGCAATCTCAGGAAGTTGCAATATCTTGGCCTCAGTAACAACCAACTCAGTGGTTCTATTCCCCCAGAG
31860 NZ_AP014633.1 Thioploca-ingrica-DNA Bacteria 1106562-1106667 106 5 21 AACCCCGGAA AACCCCGGAAATTAAACCAATAACCCCGGAAACTAAACCAATAACCCCGGAAACTAAACCAACAACCCCGGAAATTAAACCAACAACCCCGGAAACTAAACTATC
31861 NZ_AP014633.1 Thioploca-ingrica-DNA Bacteria 1252121-1252349 229 4 57 AGGAAGAAAC AGGAAGAAACTAAACAACCGCAACTAGCTGAGAAACCGGCTCAACCGCCACAACCCAAGGAAGAAACTAAACAACCGCAACTAACTGAGAAACCGGCTCAACCGCCACAACCCAAGGAAGAAACTAAACAACCGCAACTAACCGAGGAACCGGCTCAACCGCCACAACCCAAGGAAGAAACTAAACAACCGCAACTAACTGAGAAACCGGCTCAACCGCCACAACCCA